DETECCIÓN DE UN FRAGMENTO DEL GEN ENV DEL VIH EN PLASMA Y GLÓBULOS BLANCOS EN PACIENTES CON VIH/sida. Presenta: Fernando I. Puerto

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "DETECCIÓN DE UN FRAGMENTO DEL GEN ENV DEL VIH EN PLASMA Y GLÓBULOS BLANCOS EN PACIENTES CON VIH/sida. Presenta: Fernando I. Puerto"

Transcripción

1 DETECCIÓN DE UN FRAGMENTO DEL GEN ENV DEL VIH EN PLASMA Y GLÓBULOS BLANCOS EN PACIENTES CON VIH/sida Presenta: Fernando I. Puerto

2 ANTECEDENTES En los 80 s, esta pandemia se identificó como peligro para la seguridad mundial. Hoy en día es catalogada como una de las epidemias más importantes de la historia. Virus de la Inmunodeficiencia Humana (VIH) que ataca el sistema de defensas del ser humano y lo deja vulnerable a enfermedades oportunistas. Síndrome Virus de la De Inmunodeficiencia Inmunodeficien Humana cia Adquirida

3

4 Estructura del virus 3 genes: Env: glicoproteinas Gag: proteinas est Pol: proteasa, integrasa, ribonucleasa y transcriptasa reversa

5 CLASIFICACIÓN DEL VIRUS DEL VIH Pertenece a la familia Retroviridae, género Lentivirus. Su genoma es una cadena de ARN monocatenario que debe copiarse provisionalmente al ADN para poder multiplicarse e integrarse en el genoma de la célula que infecta. Los antígenos proteicos de la envoltura exterior se acoplan de forma específica con proteínas de la membrana de las células infectables, especialmente de los linfocitos T CD4.

6 GENÉTICA DEL VIRUS DEL VIH La diversidad genética de los subtipos de VIH está dada por acontecimientos muy importantes que son alto ritmo de replicación, mutación y recombinación. La enzima viral transcriptasa reversa tiene una frecuencia de error en la síntesis de ADN de 1 en 1700 a 1 en 4000 nucleótidos polimerizados.

7 DISTRIBUCIÓN DE LOS SUBTIPOS Y CFR s DEL VIH La gran mayoría de la asignación de genotipo del VIH, está basado en las secuencias de segmentos subgenómicos que comprenden desde el 2 al 30% del genoma. Las cepas del VIH que circulan alrededor del mundo presentan gran heterogeneidad de genotipos y de subtipos virales.

8 Circulating Recombinant Forms CRF S

9

10

11 CASOS DE YUCATÁN Hasta diciembre de 2016 en México han sido notificados 185,902 casos de VIH/SIDA Yucatán 3,407 casos, Mérida, Progreso, Tizimín, Kanasín y Valladolid. En la mayoría de los casos el contagio se da en los hombres que tienen sexo con hombres en edad productiva entre años de edad.

12 SITUACIÓN ACTUAL DE LA EPIDEMIA A nivel mundial 36.7 millones de personas viven con VIH/SIDA A nivel nacional registrados se encuentran registrados 127,823 Casos de VIH/SIDA Cerca del 35% de las nuevas infecciones ocurre en jóvenes de entre 20 y 35 años. De acuerdo con ONUSIDA, México tiene una epidemia concentrada en grupos de riesgo. CASOS DE VIH/SIDA NOTIFICADO S ( ) 186,655 En México 2016: Total: 9,257 Sida: 4,112 VIH: 5,145 Yucatán: 15.5 casos por cada 100 mil habitantes

13 PRUEBAS IMPORTANTES DEL VIH Usadas generalmente para evaluar la resistencia o susceptibilidad del paciente a su medicamento. Permite Evaluar mutaciones archivadas. Se puede realizar en pacientes con una carga viral indetectable. Permite una optimización de los recursos al proporcionar información previa al cambio de medicamento. Estudios recientes muestran una correlación entre los resultados de genotipo en ADN proviral y ARN de plasma. La carga viral debe se entre 500/1000 copias/ml. Segunda vez con CV menos a 1000 Predice resistencia, más no susceptibilidad.

14 PREGUNTA DE INVESTIGACIÓN Es posible identificar en los glóbulos blancos de los pacientes con VIH/SIDA con tratamiento genoma del VIH?

15 Objetivo General Comparar la eficacia en la identificación del VIH en muestras de plasma y de glóbulos blancos de pacientes con VIH/SIDA con tratamiento. Objetivos específicos Identificación y sensibilización de los grupos de estudio. Caracterización clínica de cada paciente al momento de la toma de muestra. Detección de una parte del genoma viral en una muestra de plasma y de glóbulos blancos. Correlacionar la efectividad de cada una de pruebas utilizadas.

16 RECOLECCIÓN DE LOS DATOS Y MUESTRA En noviembre de 2016 se hace la invitación para que la población participe. Participaron 28 hombres y 3 mujeres de entre 24 a 58 años. A los que accedieron a formar parte del estudio se les aplicó una entrevista y firmaron un consentimiento informado. A los 5 ml de sangre que se le extrajeron al paciente se realizó lo siguiente.

17 DIAGRAMA DE FLUJO DEL TRABAJO Toma de muestra Separación de las fases Plasma Extracción del ARN RT - PCR Glóbulos rojos Extracción del ADN PCR Glóbulos blancos Electroforesis Electroforesis

18 Transcriptasa reversa (TR) Reactivos y concentración Volumen 5x Reaction Buffer 4.0 µl Ribolock RNase Inhibitor (20U/ µl) 1.0 µl dntp s (10 mm) 2.0 µl ReverAid H Minus M-MulV Reverse Transcriptase (200U/ 1 µl µl) Amplificación de ENV Con los protocolos para PCR Anidada y secuenciación usados por el CDC de USA para el diagnóstico de VIH por RT-PCR GP40. TCTTAGGAGCAGCAGCGAAGCAACTATGGG GP41. AACGACAAAGGTGAGTATCCCTGCCTAA GP46. ACAATTATTGTCTGGTATAGTGCACAGCA GP47. TTAAACCTATCAAGCCTCCTACTATCATTA Volume total 8 µl Temperatura Tiempo (en minutos) Procedimiento 25 C 5 Alineación 42 C 60 Elongación del cdna 70 C 5 Inactivación de la TR

19 RESULTADOS Participaron 28 hombres y 3 mujeres de entre 24 a 58 años. Todos se encontraban en fase de VIH Sólo 3 de los varones no se tenían un tratamiento antirretroviral (10.8%) y el 100% de las mujeres si se encontraban con un tratamiento.

20 RESULTADOS EN GRÁFICA Muestra de plasma No amplifico Si amplifico 89% 11% 100% 11% tienen Muestras en glóbulos blancos No amplificó Si amplificó 57% 43%

21 GELES DE AGAROSA DE PLASMA Y GLÓBULOS BLANCOS MM C C- MM C C-

22 DISCUSIÓN No hay un estudio que compare la eficacia de la detección del genoma del VIH en suero y glóbulos blancos a la vez. Por lo cual este sería el primero en su tipo y es de suma importancia seguir con la investigación. La presencia de virus en los glóbulos blancos, es probable que sean monocitos que migraron al torrente sanguíneo provenientes de tejido linfático. Que es el tejido en donde están los virus mientras están con tratamiento efectivo.

23 Gracias

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Fase aguda: Entre el 40% a 90% sintomáticos (similar mononucleosis) Fase crónica: asintomaticos El

Más detalles

ALBERTO JIMÉNEZ BENÍTEZ 1º BACH

ALBERTO JIMÉNEZ BENÍTEZ 1º BACH ALBERTO JIMÉNEZ BENÍTEZ 1º BACH 1.) Las características principales del virus (estructura, genoma ) A pesar de su pequeño tamaño, el genoma es muy complejo. El ARN del VIH contiene instrucciones genéticas

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular

Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular Aislamiento, análisis y manipulación de ácidos nucleicos Generación de moléculas de DNA recombinante Ingeniería Genética AISLAMIENTO

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta

Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta El HIV es un retrovirus que pertenece al género de los Lentivirus.

Más detalles

RT- PCR diagnóstica del Cotton leafroll dwarf virus (CLRDV) en plantas de algodón

RT- PCR diagnóstica del Cotton leafroll dwarf virus (CLRDV) en plantas de algodón RT- PCR diagnóstica del Cotton leafroll dwarf virus (CLRDV) en plantas de algodón La identificación rápida y precisa de los patógenos que afectan a los cultivos de interés agronómico es crítica para predecir

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

TEMA 14 NUEVAS TECNOLOGÍAS PARA EL ESTUDIO DE LAS ENFERMEDADES INFECCIOSAS: MÉTODOS GENÉTICOS

TEMA 14 NUEVAS TECNOLOGÍAS PARA EL ESTUDIO DE LAS ENFERMEDADES INFECCIOSAS: MÉTODOS GENÉTICOS TEMA 14 NUEVAS TECNOLOGÍAS PARA EL ESTUDIO DE LAS ENFERMEDADES INFECCIOSAS: MÉTODOS GENÉTICOS Tema 14. Nuevas tecnologías para el estudio de enfermedades infecciosas: métodos genéticos Métodos genéticos

Más detalles

Universidad de Los Andes Facultad de Medicina Instituto Inmunología Clínica Maestría en Inmunología

Universidad de Los Andes Facultad de Medicina Instituto Inmunología Clínica Maestría en Inmunología TÉCNICAS EN BIOLOGÍA MOLECULAR RESPONSABLE: Dra. Lisbeth Berrueta. CREDITOS: 2 El curso de Técnicas de Biología Molecular está destinado a profesionales del área biomédica con conocimientos básicos relativos

Más detalles

HIV TIPS Número 1 Octubre de 2009

HIV TIPS Número 1 Octubre de 2009 HIV TIPS Número 1 Octubre de 2009 Sabía usted que El VIH es un virus perteneciente a la familia Retroviridae, subfamilia Lentiviridae 4,5. Existen dos formas semejantes: VIH 1 y VIH 2, pero difieren en

Más detalles

PCR gen 16S ARNr bacteriano

PCR gen 16S ARNr bacteriano PCR gen 16S ARNr bacteriano Ref. PCR16S 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y la práctica de la Reacción en Cadena de la Polimerasa

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref. PCR18S 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

INGENIERÍA GENÉTICA Apuntes de biología

INGENIERÍA GENÉTICA Apuntes de biología INGENIERÍA GENÉTICA Son técnicas para la manipulación del genoma; entre ellas, las principales: - Técnicas de ADN recombinante - Clonación de genes - Hibridación de ácidos nucleicos Técnica del ADN Recombinante:

Más detalles

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA. Estudio comparativo del diagnóstico del virus del PRRS por RT-PCR, PCR anidada y RT-PCR en tiempo real. Zoalli Angélica

Más detalles

Reconoce las características de los virus:

Reconoce las características de los virus: ASIGNATURA: GRADO: BLOQUE SABERES DECLARATIVOS PROPÓSITOS Biología I Cuarto Semestre de Bachillerato V. Conoce la biodiversidad y propone cómo preservarla. Reconoce las características de los virus: Composición

Más detalles

Óscar Castaño, Cristofer Amaya, Ana Caperote y Delia Dominguez 3ºB

Óscar Castaño, Cristofer Amaya, Ana Caperote y Delia Dominguez 3ºB Óscar Castaño, Cristofer Amaya, Ana Caperote y Delia Dominguez 3ºB INDICE Agente causante y cómo actúa el agente Los síntomas que provoca Existe algún tipo de tratamiento Cómo se contagia Medidas de prevención

Más detalles

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis virales Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis Características generales Es un proceso asociado a muchas causas, tanto infecciosas como

Más detalles

FAMILIA RETROVIRIDAE. Prof. Adj. Dra. Dora Ruchansky Departamento de Bacteriologia y Virología Instituto de Higiene - Facultad de Medicina Abril 2010

FAMILIA RETROVIRIDAE. Prof. Adj. Dra. Dora Ruchansky Departamento de Bacteriologia y Virología Instituto de Higiene - Facultad de Medicina Abril 2010 FAMILIA RETROVIRIDAE Prof. Adj. Dra. Dora Ruchansky Departamento de Bacteriologia y Virología Instituto de Higiene - Facultad de Medicina Abril 2010 FAMILIA SUBFAMILIA GENERO EJEMPLOS Retroviridae Orthoretrovirinae

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Lic. en Bioquímica Lic. en Biotecnología Microbiología de los Alimentos 2016 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

KITS EDUCATIVOS DE BIOLOGÍA MOLECULAR

KITS EDUCATIVOS DE BIOLOGÍA MOLECULAR KITS EDUCATIVOS DE BIOLOGÍA MOLECULAR Índice General Aula GENYCA. Flujo de trabajo. 3 Kits Educativos de Técnicas Básicas 5 P1-A. Extracción de ADN de Sangre 6 P1-B. Extracción de ADN en Columna 7 P2.

Más detalles

Monitoreo de los serotipos de Rotavirus en la Región

Monitoreo de los serotipos de Rotavirus en la Región Immunization Unit / FCH Monitoreo de los serotipos de Rotavirus en la Región Simposio Subregional de Nuevas Vacunas: Neumococo y Rotavirus San José, Costa Rica 20-21 agosto, 2007 Monitoreo de los Serotipos

Más detalles

Prevención n y diagnostico de la resistencia del VIH a los ARV

Prevención n y diagnostico de la resistencia del VIH a los ARV Prevención n y diagnostico de la resistencia del VIH a los ARV Dr. Samuel Navarro Álvarez, MSP Medico Internista e Infectólogo Objetivos de aprendizaje Reconocer las bases fisiopatologícas de la drogo

Más detalles

AMPLIFICACIÓN Y DETECCIÓN POR PCR DEL LOCUS HUMANO D1S80

AMPLIFICACIÓN Y DETECCIÓN POR PCR DEL LOCUS HUMANO D1S80 AMPLIFICACIÓN Y DETECCIÓN POR PCR DEL LOCUS HUMANO D1S80 Ref. PCR1 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Aplicaciones Clínicas

Aplicaciones Clínicas Número de módulos: 13 Aplicaciones Clínicas Precio: $ 5.876.000 + IVA 1. Prueba de paternidad de ADN Referencia: 222 Este experimento se hace a los estudiantes una introducción al uso de la huella genética

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS 6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS Introducción.................... 663 Clasificación de la infección

Más detalles

DETECCIÓN VIH POR RT-PCR

DETECCIÓN VIH POR RT-PCR Ref. PCRHIV (4 prácticas) DETECCIÓN VIH POR RT-PCR 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

BOLETÍN EPIDEMIOLÓGICO DE CASTILLA-LA MANCHA OCTUBRE 2008/ Vol.20 /Nº 41

BOLETÍN EPIDEMIOLÓGICO DE CASTILLA-LA MANCHA OCTUBRE 2008/ Vol.20 /Nº 41 BOLETÍN EPIDEMIOLÓGICO DE CASTILLA-LA MANCHA OCTUBRE 2008/ Vol.20 /Nº 41 EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) El VIH forma parte del grupo de los virus ARN; es decir, cuyo material genético se

Más detalles

Universidad Nacional de Rosario - Facultad de Ciencias MédicasM

Universidad Nacional de Rosario - Facultad de Ciencias MédicasM Universidad Nacional de Rosario - Facultad de Ciencias MédicasM Cátedra de Microbiología, Virología a y Parasitología HIV - Área Injuria - 2015 HTLV HIV Genero: Deltaretrovirus HTLV-1 y HTLV2 (Virus linfotrofico

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

E. Coli productora de toxinas (STEC)

E. Coli productora de toxinas (STEC) E. Coli productora de toxinas (STEC) Detección n por PCR en alimentos Por Mariana Motter, Vet. E. Coli O157 H7 Primer serotipo asociado a diarreas hemorrágicas Agente causal de síndrome s urémico hemolítico

Más detalles

Métodos de detección del Virus de Inmunodeficiencia Humana

Métodos de detección del Virus de Inmunodeficiencia Humana Métodos de detección del Virus de Inmunodeficiencia Humana Generalidades No existe ninguna manifestación clínica que sea característica de la infección por el virus de inmunodeficiencia humana VIH-1 o

Más detalles

FERRER P 1, SOBARZO 2 M y AFANI A 1 1 Hospital Clínico Universidad de Chile. 2 Hospital Barros Luco, Santiago, Chile

FERRER P 1, SOBARZO 2 M y AFANI A 1 1 Hospital Clínico Universidad de Chile. 2 Hospital Barros Luco, Santiago, Chile ADN PROVIRAL DE VIH ES EL BLANCO GENÉTICO ADECUADO PARA EL ESTUDIO DE RESISTENCIA GENOTÍPICA A ANTIRRETROVIRALES EN PACIENTES CON VIREMIAS DE BAJO NIVEL FERRER P 1, SOBARZO 2 M y AFANI A 1 1 Hospital Clínico

Más detalles

BIOQUIMICA Y GENETICA MOLECULAR APLICADA A LA VETERINARIA

BIOQUIMICA Y GENETICA MOLECULAR APLICADA A LA VETERINARIA BIOQUIMICA Y GENETICA MOLECULAR APLICADA A LA VETERINARIA PROFESORADO CURSO 1994-1995: Dr. J. Ariño (Unidad de Bioquímica) Dra. F. Bosch (Unidad de Bioquímica) Dr. A. Sánchez (Unidad de Genética y Mejora)

Más detalles

Dr. Alberto Navarro Romero

Dr. Alberto Navarro Romero Dr. Alberto Navarro Romero Cuáles de las células c ataca el VIH? Las células c CD4+ T o linfocitos CD4 T. El recuento de CD4 es el número n de linfocitos CD4 en una muestra de sangre, esta es la célula

Más detalles

VIH DETENGAMOS LA PANDEMIA. Dr. Andrés Cornejo Porcile Internista Infectologo Programa VIH del HRLBO

VIH DETENGAMOS LA PANDEMIA. Dr. Andrés Cornejo Porcile Internista Infectologo Programa VIH del HRLBO VIH DETENGAMOS LA PANDEMIA Dr. Andrés Cornejo Porcile Internista Infectologo Programa VIH del HRLBO 30 de Mayo 2017 Temario Impacto mundial de la Pandemia. Transmisión, fisiopatología de la infección por

Más detalles

HIV. Curso de Salud Internacional. Máster en Ciencias de la Salud: Salud Pública. Curso 2007-2008

HIV. Curso de Salud Internacional. Máster en Ciencias de la Salud: Salud Pública. Curso 2007-2008 HIV Curso de Salud Internacional Máster en Ciencias de la Salud: Salud Pública Curso 2007-2008 Virus de Inmunodeficiencia Humana - HIV Infección por HIV y progresión hacia el SIDA Problema: Por qué hay

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Curso: Biología Molecular y Genómica Enero 2014. Conceptos elementales sobre la técnica de reacción en cadena de la polimerasa (PCR) Dr. Juan Venegas Hermosilla Programa de Biología Celular y Molecular

Más detalles

Diagnóstico molecular de tuberculosis

Diagnóstico molecular de tuberculosis Diagnóstico molecular de tuberculosis Santiago Atehortúa Muñoz MD Microbiólogo Hospital Universitario de San Vicente Fundación. www.sanvicentefundacion.com Amplificación y detección de Ácidos nucleicos

Más detalles

Virus de inmunodeficiencia Humana (VIH)

Virus de inmunodeficiencia Humana (VIH) Virus de inmunodeficiencia Humana (VIH) Documento elaborado por: Mario Roberto Bernabe Guapillo Vargas Objetivo Identificar las características de la infección por el VIH a partir de la revisión de los

Más detalles

RESULTADOS Y DISCUSIÓN

RESULTADOS Y DISCUSIÓN RESULTADOS Y DISCUSIÓN Extracción de ADN en sangre periférica La técnica de extracción por GeneClean empleada en este trabajo dio un buen rendimiento, ya que la cantidad de ADN y el nivel de purificación

Más detalles

PLANIFICACIÓN DE ASIGNATURA

PLANIFICACIÓN DE ASIGNATURA PLANIFICACIÓN DE ASIGNATURA I IDENTIFICACION GENERAL DE LA ASIGNATURA CARRERA BIOQUIMICA DEPARTAMENTO BIOLOGIA ASIGNATURA BIOLOGIA MOLECULAR II CÓDIGO 1681 PRERREQUISITOS Biología Molecular I CREDITOS

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

Unidad curricular Introducción a la biología celular y molecular (preguntas 51 a 80)

Unidad curricular Introducción a la biología celular y molecular (preguntas 51 a 80) Unidad curricular Introducción a la biología celular y molecular (preguntas 51 a 80) 51. Cuál es la normalidad de una solución de NaOH 20 g/l? Dato: peso molecular del NaOH es 40 g/mol a. 0,35 N b. 0,50

Más detalles

PRUEBAS DE DIAGNOSTICO. Hospital Roosevelt Laboratorio Clínica de Enfermedades Infecciosas Septiembre 2013

PRUEBAS DE DIAGNOSTICO. Hospital Roosevelt Laboratorio Clínica de Enfermedades Infecciosas Septiembre 2013 PRUEBAS DE DIAGNOSTICO Hospital Roosevelt Laboratorio Clínica de Enfermedades Infecciosas Septiembre 2013 DIAGNÓSTICO DE LA INFECCIÓN POR EL VIH El diagnóstico definitivo de la infección por el VIH sólo

Más detalles

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH.

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Jose Maria Kindelán. Hospital Universitario Reina Sofía. Córdoba I. Historia natral de la

Más detalles

7.012 Serie de ejercicios 7

7.012 Serie de ejercicios 7 Nombre AT Grupo 7.012 Serie de ejercicios 7 Pregunta 1 a) Mi gata, Sophie, está enfadada porque paso demasiado tiempo trabajando como profesor auxiliar. Una noche, en un ataque de celos, me arañó un dedo.

Más detalles

Programa Formativo. Objetivos. Código: Curso: Hematología y Hemoterapia. Duración: 70h.

Programa Formativo. Objetivos. Código: Curso: Hematología y Hemoterapia. Duración: 70h. Código: 40657 Curso: Hematología y Hemoterapia Modalidad: ONLINE Duración: 70h. Objetivos La sangre es un tejido líquido que circula permanentemente por el sistema vascular y está formado por vasos sanguíneos

Más detalles

EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA

EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA Liliana Gómez Flores Ramos 1, Martha Escoto Delgadillo 2, Eduardo Vázquez Valls

Más detalles

ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR

ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR Ref. PCRALU 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena

Más detalles

1. Cuáles de las siguientes soluciones de NaCl tiene la mayor concentración de sal a. 1 b. 2 c. 3 d. 4

1. Cuáles de las siguientes soluciones de NaCl tiene la mayor concentración de sal a. 1 b. 2 c. 3 d. 4 SIMULACRO VIRTUAL QUIMICA PREGUNTAS: 7 PROFESOR: ADRIANA GUTIERREZ RIVAS Las preguntas 1 y 2 se responden teniendo en cuenta la siguiente información 1. Cuáles de las siguientes soluciones de NaCl tiene

Más detalles

Soluciones de la serie de ejercicios 7 (7.012)

Soluciones de la serie de ejercicios 7 (7.012) Nombre AT Grupo Pregunta 1 Soluciones de la serie de ejercicios 7 (7.012) a) Mi gata, Sophie, está enfadada porque paso demasiado tiempo trabajando como profesor auxiliar. Una noche, en un ataque de celos,

Más detalles

Técnico en Hematología y Hemoterapia. Sanidad, Dietética y Nutrición

Técnico en Hematología y Hemoterapia. Sanidad, Dietética y Nutrición Técnico en Hematología y Hemoterapia Sanidad, Dietética y Nutrición Ficha Técnica Categoría Sanidad, Dietética y Nutrición Referencia 166762-1501 Precio 50.36 Euros Sinopsis La sangre es la especialidad

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Técnicas moleculares para el diagnóstico de microorganismos fitopatógenos

Técnicas moleculares para el diagnóstico de microorganismos fitopatógenos Técnicas moleculares para el diagnóstico de microorganismos fitopatógenos Dra. Ing. Agr. Sandra Alaniz Unidad de Fitopatología setiembre de 2015 Unidades taxonómicas Dominio Orden Familia Género Especie

Más detalles

Desarrollo del tema: Características generales de los virus

Desarrollo del tema: Características generales de los virus Balthasar van der Ast, 1620 Flowers & Fruit VIRUS y VIROIDES FITOPATOGENOS Curso- 2003 Ing. Agr. Elena Pérez MSc Unidad de Fitopatología Desarrollo del tema: Características generales de los virus Importancia

Más detalles

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS 6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS Introducción....................... 871 Clasificación de la infección

Más detalles

Ensayos de restricción

Ensayos de restricción Ensayos de restricción Vector con inserto= Vector recombinante 6500pb Objetivos de ensayos de restricción de plásmidos Conocer el principio de separación y detección de ácidos nucleicos en geles de agarosa.

Más detalles

7. RESULTADOS. De las 18 cepas previamente congeladas (-70 C) se recuperaron 13 cepas. En los

7. RESULTADOS. De las 18 cepas previamente congeladas (-70 C) se recuperaron 13 cepas. En los 7. RESULTADOS De las 18 cepas previamente congeladas (-70 C) se recuperaron 13 cepas. En los pacientes infectados con estas cepas, 8 (61.5%) presentaron gastritis crónica, 2 (15.38%) gastritis folicular,

Más detalles

MARCADORES GENÉTICOS

MARCADORES GENÉTICOS MARCADORES GENÉTICOS MARCADORES GENÉTICOS La diferencia entre individuos se denotaba señalando diferencias en su aspecto externo (fenotipo) Marcadores Morfológicos Carácter Informativo Variación POLIMORFISMO

Más detalles

LA NUEVA BIOTECNOLOGÍA

LA NUEVA BIOTECNOLOGÍA LA NUEVA BIOTECNOLOGÍA Ingeniería genética: técnicas que permiten manipular la información genética de un ser vivo. TECNOLOGÍA TRADICIONAL DEL ADN RECOMBINANTE CLONACIÓN DE GENES: Obtención de muchas copias

Más detalles

11. MÉTODOS PARA LA DETECCIÓN DEL ROTAVIRUS. Actualmente existen diversos métodos en el mercado que pueden utilizarse

11. MÉTODOS PARA LA DETECCIÓN DEL ROTAVIRUS. Actualmente existen diversos métodos en el mercado que pueden utilizarse 11. MÉTODOS PARA LA DETECCIÓN DEL ROTAVIRUS Actualmente existen diversos métodos en el mercado que pueden utilizarse para el diagnóstico de rotavirus, las cuales pueden realizarse directamente a partir

Más detalles

DIAGNÓSTICO MOLECULAR CMV Y EBV

DIAGNÓSTICO MOLECULAR CMV Y EBV DIAGNÓSTICO MOLECULAR CMV Y EBV DIAGNÓSTICO MOLECULAR REACCIÓN EN CADENA DE LA POLIMERASA (PCR) ALTA SENSIBILIDAD Y ESPECIFICIDAD DIAGNÓSTICO MOLECULAR REACCIÓN EN CADENA DE LA POLIMERASA (PCR) PCR PUNTO

Más detalles

VIH/SIDA, tratamiento antiretroviral

VIH/SIDA, tratamiento antiretroviral VIH/SIDA, tratamiento antiretroviral Dr. Samuel Navarro Alvarez, MSP Medico Internista e Infectólogo Objetivos de aprendizaje Mostrar los beneficios del tratamiento anti retroviral Describir cuales son

Más detalles

Alteraciones del sistema inmune. Unidad 4 / Inmunología una Mirada Preventiva

Alteraciones del sistema inmune. Unidad 4 / Inmunología una Mirada Preventiva Alteraciones del sistema inmune Unidad 4 / Inmunología una Mirada Preventiva Índice Introducción Lección 1. Alergias y Síndrome de Inmunodeficiencia adquirida a) Alergias. Qué es la alergia? Síntomas de

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

EL VIRUS VIH (VIRUS DE LA INMUNODEFICIENCIA HUMANA) Infecta linfocitos T CD4+

EL VIRUS VIH (VIRUS DE LA INMUNODEFICIENCIA HUMANA) Infecta linfocitos T CD4+ Infección causada por un virus Infección crónica Infecta linfocitos T CD4+ Consecuencias de la infección crónica Epidemiología de la enfermedad en el mundo y en Murcia Formas de contagio Predicción de

Más detalles

Sociedad Venezolana Medicina Interna 1 DE DICIEMRE DIA MUNDIAL DE LA LUCHA CONTRA EL SIDA

Sociedad Venezolana Medicina Interna 1 DE DICIEMRE DIA MUNDIAL DE LA LUCHA CONTRA EL SIDA Sociedad Venezolana Medicina Interna 1 DE DICIEMRE DIA MUNDIAL DE LA LUCHA CONTRA EL SIDA Aspectos Generales 01 Resolviendo el enigma 02 Entendiendo la enfermedad 03 El remedio de la enfermedad 04 Un resultado

Más detalles

DESCRIPCIÓN DE UN MÉTODO CUANTITATIVO DE PCR PARA LA ESTIMACIÓN DEL CONTENIDO DE VIRUS EN VACUNAS MULTIVALENTES DE ROTAVIRUS

DESCRIPCIÓN DE UN MÉTODO CUANTITATIVO DE PCR PARA LA ESTIMACIÓN DEL CONTENIDO DE VIRUS EN VACUNAS MULTIVALENTES DE ROTAVIRUS DESCRIPCIÓN DE UN MÉTODO CUANTITATIVO DE PCR PARA LA ESTIMACIÓN DEL CONTENIDO DE VIRUS EN VACUNAS MULTIVALENTES DE ROTAVIRUS María L. Pombo Departmento de Control de Vacunas Instituto Nacional de Higiene

Más detalles

SITUACIÓN ACTUAL Y MANEJO DEL VIH-SIDA

SITUACIÓN ACTUAL Y MANEJO DEL VIH-SIDA SITUACIÓN ACTUAL Y MANEJO DEL VIH-SIDA Augusto G. Escalante Candia Médico Infectólogo Hospital Regional Docente de Medicina Tropical Pedro Ortiz Cabanillas VIH SIDA: OMS 2014 35 millones de personas

Más detalles

MANUAL DE OPERACIÓN VIH. FALLA VIROLÓGICA INMUNOLÓGICA Versión Vigente: 2

MANUAL DE OPERACIÓN VIH. FALLA VIROLÓGICA INMUNOLÓGICA Versión Vigente: 2 Página 1 de 5 FALLA VIROLÓGICA INMUNOLÓGICA Versión Vigente: 2 1. Objetivo: Detectar con toda oportunidad rebote en el RNA del VIH en suero, debido a resistencia a agentes antirretrovirales provocando

Más detalles

T. 15 INFECCIONES VÍRICAS DESTACADAS II. INFECCIÓN POR V.I.H. VIRUS DE LA INMUNODEFICIENCIA HUMANA 1. VIH. ESTRUCTURA y CICLO VITAL

T. 15 INFECCIONES VÍRICAS DESTACADAS II. INFECCIÓN POR V.I.H. VIRUS DE LA INMUNODEFICIENCIA HUMANA 1. VIH. ESTRUCTURA y CICLO VITAL T. 15 INFECCIONES VÍRICAS DESTACADAS II. INFECCIÓN POR V.I.H. VIRUS DE LA INMUNODEFICIENCIA HUMANA 1. VIH. ESTRUCTURA y CICLO VITAL 2. PRUEBAS DE DIAGNÓSTICO SEROLÓGICO DE INFECCIÓN VIH: A) PRUEBAS DE

Más detalles

Fecha de última actualización: 12 de Mayo de 2010

Fecha de última actualización: 12 de Mayo de 2010 Programa elaborado por: Fecha de elaboración: PROGRAMA DE ESTUDIO INGENIERÍA GENÉTICA Programa Educativo: Área de Formación : Licenciatura en Biología Transversal Horas teóricas: 2 Horas prácticas: 2 Total

Más detalles

Cursos de SANIDAD. Principios de Biología Molecular A distancia 80 h

Cursos de SANIDAD. Principios de Biología Molecular A distancia 80 h Cursos de SANIDAD [ Principios de Biología Molecular ] A distancia 80 h PRINCIPIOS DE BIOLOGÍA MOLECULAR El curso de Principios de biología molecular da a conocer a los participantes la estructura y propiedades

Más detalles

Genotipat de VHC en el context actual. Dra Isabel Viciana Hospital Virgen de la Victoria Málaga

Genotipat de VHC en el context actual. Dra Isabel Viciana Hospital Virgen de la Victoria Málaga Genotipat de VHC en el context actual Dra Isabel Viciana Hospital Virgen de la Victoria Málaga Introducción VHC Familia Flaviviridae ARN monocatenario Nucleocápside icosaédrica (proteina C) Envuelta: glicoproteínas

Más detalles

REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS ANÁLISIS DE LA EXPRESIÓN DE LACZ

REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS ANÁLISIS DE LA EXPRESIÓN DE LACZ REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS ANÁLISIS DE LA EXPRESIÓN DE LACZ Para conocer la organización del ADN se desarrollaron métodos que permitieron conocer la secuencia exacta de nucleótidos,

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Uno de los principales objetivos de estos proyectos es la obtención de aislados primarios de VIH-1:

Uno de los principales objetivos de estos proyectos es la obtención de aislados primarios de VIH-1: DESARROLLO DE UN PANEL DE CEPAS DE VIH-1 DE DIFERENTES FORMAS GENÉTICAS PARA LA EVALUACIÓN DE POSIBLES CANDIDATOS VACUNALES Y DE MÉTODOS DE DIAGNÓSTICO MOLECULAR. Mª Teresa Cuevas, Elena Delgado, Mónica

Más detalles

Maira Cabrera, PhD LSHTM

Maira Cabrera, PhD LSHTM Maira Cabrera, PhD LSHTM Determinar la Importancia Biológica del Sistema Mayor de Histocompatibilidad en el desarrollo de la Respuesta Inmune Adaptativa Un ratón de un genotipo dado recibe un injerto

Más detalles

No. ISBN: Editorial Interna del Centro de Investigaciones en Óptica, León Guanajuato. Cuarta Edición. Año: 2007 pp 1-5.

No. ISBN: Editorial Interna del Centro de Investigaciones en Óptica, León Guanajuato. Cuarta Edición. Año: 2007 pp 1-5. No. ISBN: 978-968-9241-03-4. Editorial Interna del Centro de Investigaciones en Óptica, León Guanajuato. Cuarta Edición. Año: 2007 pp 1-5. ANÁLISIS COMPARATIVO DE MÉTODOS MOLECULARES (PCR, RT-PCR EN TIEMPO

Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles

Universidad de Chile Facultad de Odontología Marzo de Genética Bacteriana. Prof. Carla Lozano M.

Universidad de Chile Facultad de Odontología Marzo de Genética Bacteriana. Prof. Carla Lozano M. Universidad de Chile Facultad de Odontología Marzo de 2011 Genética Bacteriana Prof. Carla Lozano M. Qué es la Genética? Disciplina científica que estudia la Herencia Gregor Mendel GENES Unidad básica,

Más detalles

TESIS PARA CUBRIR PARCIALEMNTE LOS REQUISTIOS NECESARIOS PARA OBTENER EL GRADO DE MAESTROS EN CIENCIAS PRESENTA NORMA CONCEPCIÓN MARTÍNEZ CISNEROS

TESIS PARA CUBRIR PARCIALEMNTE LOS REQUISTIOS NECESARIOS PARA OBTENER EL GRADO DE MAESTROS EN CIENCIAS PRESENTA NORMA CONCEPCIÓN MARTÍNEZ CISNEROS UNIVERSIDAD AUTÓNOMA DE BAJA CALIFORNIA FACULTAD DE CIENCIAS MARINAS INSTITUTO DE INVESTIGACIONES OCEANOLÓGICAS IDENTIFICACIÓN MOLECULAR DE LOS SUBTIPOS DE VIH-1 EN ENSENADA Y TIJUANA, BAJA CALIFORNIA

Más detalles

Clonación. Producción de un gran número de copias de una región de ADN (fragmentos o

Clonación. Producción de un gran número de copias de una región de ADN (fragmentos o CLONACIÓN Clonación Producción de un gran número de copias de una región de ADN (fragmentos o genes) o de ADNc Clonación Celular Acelular Célula anfitriona PCR Secuenciación Estudio de estructura de ácido

Más detalles

CICLO DE REPLICACIÓN VIRAL. ETAPAS

CICLO DE REPLICACIÓN VIRAL. ETAPAS CICLO DE REPLICACIÓN VIRAL. ETAPAS Adsorción del virus al receptor celular Penetración del virus a la célula Decapsidación ó desnudamiento Replicación del genoma viral Síntesis de proteínas virales Ensamblaje

Más detalles

ADN ---- Proteínas. ADN ---? --- Proteínas

ADN ---- Proteínas. ADN ---? --- Proteínas El dogma central de la biología molecular es un concepto que explica los mecanismos de transmisión y expresión de la herencia genética tras el descubrimiento de la molécula del ADN en doble hélice. Propone

Más detalles

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica Genotipificación de VIH en el INS: técnica local y técnicas convencionales Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. lar Responsable de los Procesos

Más detalles

ABREVIATURAS... XI I. INTRODUCCIÓN EL TOMATE... 3

ABREVIATURAS... XI I. INTRODUCCIÓN EL TOMATE... 3 ÍNDICE ABREVIATURAS... XI I. INTRODUCCIÓN... 1 1 EL TOMATE... 3 1.1 Taxonomía... 3 1.2 Características generales... 3 1.3 La flor... 4 1.4 Características del fruto... 5 2 CUAJADO Y DESARROLLO DEL FRUTO...

Más detalles

GenomeLab GeXP Sistema de Análisis Genético

GenomeLab GeXP Sistema de Análisis Genético GenomeLab GeXP Sistema de Análisis Genético PLATAFORMA CON MULTIPLES APLICACIONES DETECCIÓN DE VIRUS, BACTERIAS, LEVADURAS, HONGOS, APLICACIONES ESPECIALES, ETC. GenomeLab GeXP GenomeLab GeXP Qué es? Es

Más detalles

El objetivo del VIH es sobrevivir

El objetivo del VIH es sobrevivir El objetivo del VIH es sobrevivir Generando diversidad Crea copias de sí mismo con mutaciones que le permiten escapar de la presión ambiental Escondiéndose del sistema immune Se integra en el genoma Esconde

Más detalles

El virus de influenza porcina y su evolución en México

El virus de influenza porcina y su evolución en México El virus de influenza porcina y su evolución en México Colaboración entre: Genetics and Genomic Sciences Icahn Institute for Multiscale Biology El virus de la gripe o influenza Megan L. Shaw and Peter

Más detalles

INFECCION POR VIRUS INMUNODEFICIENCIA HUMANA

INFECCION POR VIRUS INMUNODEFICIENCIA HUMANA La infección por el virus de VIH cobra anualmente miles de muertes en todo el mundo, es un problema de salud pública, que no tiene cura. Desde el año 2000 al 2014, unos 38,1 millones de personas se han

Más detalles

Seminario Genética. Técnicas de Biología Molecular

Seminario Genética. Técnicas de Biología Molecular Seminario Genética Técnicas de Biología Molecular Contenidos Extracción de ADN Enzimas de restricción PCR Southern Blot Secuenciación método de Sanger y automática 1º Extracción de ADN Se pueden tomar

Más detalles