CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?"



2 CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo con el tiempo, hasta que la reacción llega a una fase de saturación en la que ya no se produce incremento de ADN. Además, la cantidad de ADN amplificado se detecta al final de la PCR cuando la mayoría de reacciones han alcanzado ya la fase de saturación y por tanto, la cantidad de ADN obtenido no guarda mucha relación con la concentración inicial de ADN en la muestra. La PCR a tempo real en cambio, si es cuantitativa ya que permite saber la cantidad de ADN tras cada ciclo de amplificación, debido a que dicho ADN está marcado con fluorescencia. 2. Componentes de la PCR. En la PCR podemos diferenciar los siguientes componentes: - Tampón: buffer de amplificación. Los más utilizados contienen KCl, Tris y MgCl 2. Éste último es esencial para la actividad de la Taq polimerasa ya que el Mg 2+ actúa como cofactor de ésta. No obstante, hay que tener cuidado con las cantidades de Mg ya que un exceso de este dará lugar a productos inespecíficos y a una cantidad insuficiente. - Primers o cebadores: deben ser complementarios a cada uno de los extremos 3' de la región que queremos amplificar y son necesarios para la actividad de la polimerasa. - Desoxinucleótidos trifosfatos (dntps): son necesarios para que la polimerasa los use como sustrato y pueda llevar a cabo la reacción de amplificación. Se añaden los cuatro tipos de dntps que componen el ADN en una mezcla equimolar. - Taq-polimerasa: polimerasa resistente a las altas temperaturas a las que vamos a someter nuestro tubo de reacción. Es una polimerasa aislada de la bacteria termoresistente, Thermus aquaticus. - ADN muestra: ADN que queremos amplificar. 2

3 3. Por que son necesarios tres tipos de cebadores en la RT-PCR?, para qué sirven cada uno de ellos? - Random primers pd (N) 6: son cebadores cortos (10 KB) que se utilizan para secuenciar al azar cuando el ADN es desconocido. El cebador se unirá al ADN patrón en secuencias complementarias de ubicación desconocida, por lo tanto no se conocerá la naturaleza de los productos obtenidos. - Oligo (dt): se unen a las colas de poli (A) presentes en los mrnas. Se utilizan para secuenciar RNAm. - Cebadores específicos: se utilizan para secuenciar ADN conocido. Tienen una secuencia complementaria a dicho ADN. 4.- Fundamentos para la cuantificación de RNA por PCR a tiempo real Permite cuantificar, la cantidad de ADN o ARN amplificado en cada momento mediante el marcaje con fluorocromos y detectar la fluorescencia emitida cuando se genera el fragmento específico durante la amplificación. Existen diversos formatos de detección: - Uso de moléculas fluorescentes que se intercalan en el ADN de cadena doble. Ej. SYBR-GREEN: - Doble sonda marcada o sondas de hibridación (sondas "LightCycler"). En este caso se emplean dos sondas marcadas con moléculas fluorescentes en posición 5' (sonda A) y 3' (sonda B) y que hibridan en regiones adyacentes del DNA diana. Cuando se produce la hibridación, la primera sonda emite fluorescencia que excita al colorante de la segunda sonda, produciendo una señal detectable 3

4 - Cebadores fluorescentes ("Molecular Beacons"). En estos tipos, la molécula fluorescente y la molécula que absorbe la fluorescencia se mantienen próximas mediante la formación de una horquilla de hibridación. Esta horquilla se abre durante la amplificación, aumentando la emisión de fluorescencia. - Sondas Taqman. Diseñadas por Applied Biosystems, hacen uso de la actividad 5' exonucleasa de la Taq (Thermus aquaticus) DNA polimerasa. Estas sondas tienen un marcador fluorescente en el extremo 5' y una molécula que absorbe ("quencher") la fluorescencia emitida por el marcador en el otro extremo. La sonda hibrida con el fragmento específico (si está presente) y, a medida que se sintetiza la hebra complementaria al fragmento, la sonda se va degradando por la acción exonucleasa, liberando el marcador que ahora sí emite fluorescencia. -Fundamentos para la cuantificación de RNA por PCR a tiempo real En la RT-PCR el molde inicial es ARN y mediante la retrotranscriptasa se obtiene el ADNc (ADN complementario). Este ADNc es posteriormente amplificado. De esta forma, se puede medir la expresión génica mediante una técnica alternativa al Northern blot o Dot Blot, ensayos de protección de RNasa, hibridación in situ, y ensayos de nucleasa S1. 5. Universal ProbeLibrary. Ejercicio con cebadores. Cebador Sncaα: Izquierdo: 5 TGGCAGTGAGGCTTATGAAA3 Sí funciona en el ratón ya que se une desde el primer hasta el último nucleótido. No funciona en la rata porque no se une en todos los nucleótidos. Derecho: 5 GCTTCAGGCTCATAGTCTTGG3 Funciona tanto en rata como en ratón ya que en ambos casos se une desde el primer hasta el último nucleótido. Este cebador sólo funciona en ratón. Cebador DCX: UP: 5 GCATTACTTGTGAGGCATTTTGGAG3 Sí funciona en el ratón ya que se une desde el primer hasta el último nucleótido. No funciona en la rata porque no se une en todos los nucleótidos. 4

5 DOWN: 5 GGGAGATTAACGGTCACAGGAGAT3 Sí funciona en el ratón ya que se une desde el primer hasta el último nucleótido. No funciona en la rata porque no se une en todos los nucleótidos. Este cebador sólo funciona en ratón. RESULTADOS Aislamiento de ARN Para ver si hemos aislado con éxito ARN de los centros de cerebro de rata se llevó a cabo una PCR. Los resultados son los siguientes: Nosotros cargamos en el pocillo 7 en el que no se observa ARN pero esto puede ser debido a contaminación por ARNasas. Pocillo 7 RT-PCR con β-actina Para comprobar si en el aislamiento de ARN anterior, no aparecía nada porque ha sido degradado por contaminación con ARNasas o porque verdaderamente no hemos aislado ARN, se realizó una RT-PCR en la que se empleó β-actina como housekeeper. Pocillos 9 y 10 5

6 En nuestros pocillo 9 y 10 se observan dos bandas de igual tamaño aproximadamente, lo que indica que hemos partido de la misma concentración inicial de cdna. Además esto indica que sí habíamos aislado ARN anteriormente por lo que su ausencia se debe a una degradación por RNAasas. PCR Inespecífica Bandas específicas En la fotografía se aprecian bandas inespecíficas y bandas específicas. Las bandas inespecíficas se observan a bajas temperaturas de Annealing ya que los cebadores se unen inespecíficamente. PRC convencional de TH Esta PCR ha salido mal en general. A 28 ciclos debería haber salido, el problema puede haber sido una contaminación por estándar interno que es una molécula muy volátil. 6

7 PCR competitiva (muestra 1) En esta PCR lo que se ha hecho es añadir a la muestra un estándar interno a diferentes concentraciones: 70, 700 y 7000 fentogramos/??. El tubo al que añadimos el estándar menos concentrado dará lugar a una banda grande de ADN de la muestra y a una pequeña del estándar interno mientras que el tubo al que añadimos el estándar más concentrado dará lugar a una banda grande de estándar interno y auna pequeña de ADN de la muestra, ya que compite más el estándar interno. Los resultados se recogen en la siguiente fotografía, donde la banda superior es ADNc y la banda inferior es el estándar interno: A continuación medimos la DO del ADNc y la del estándar interno de manera que la relación DO de estándar interno/ DO del ADNc será mayor mientras más estándar interno haya y al representar gráficamente dicha relación frente a la concentración de estándar interno obtenemos una recta: 7

8 y = mx + b En el punto en que DO estándar interno / DO ADN c = 1: m= 0.766; b= -2.4 log (DO estándar interno / DO ADN c) = log Estándar interno log (1) = log Estándar interno = log Estándar interno log Estándar interno = 2.4 / = Estándar interno = fentogramos PCR competitiva (muestra 2) 8

9 Procediendo de la misma manera que en el caso anterior obtenemos: y = mx + b En el punto en que DO estándar interno / DO ADN c = 1: m= 0.65; b= log (DO estándar interno / DO ADN c) = log Estándar interno log (1) = 0.65 log Estándar interno = log Estándar interno log Estándar interno = 1.82 / 0.65 = 2.8 Estándar interno = fentogramos / = 1.99 veces mayor la expresión de TH en la muestra 1 que en la muestra 2. 9

10 PCR a tiempo real Nuestro SYBR-GREEN de Roche estaba en mal estado y por tanto la RT-PCR no ha salido bien. Para el SYBR-GREEN de BR el experimento sí ha tenido éxito. Unos de los datos obtenidos en con éste SYBR-GREEN son los siguientes: M o / R o = 2 - C = 2 (C t muestra C t referencia) C t referencia = 6.44 C t muestra 1 = C t muestra 2 = M 1 / R o = - 2 ( ) = M 1 M 2 / R o = - 2 ( ) = = 7.55 M 2 La muestra 1 tiene 7.55 veces más que la muestra 2. 10

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07 PCR A TIEMPO REAL María Maiques R4-Bioquímica Clínica 25-Abril-07 VEAMOS Herramientas para detectar mutaciones Moléculas fluorescentes y tecnología FRET PCR a tiempo real: equipos y métodos de detección

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles



Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles


FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles



Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles



Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5 PCR Caracteristicas del ADN Se rompen con las siguientes condiciones -Temperaturas >90 C - ph >10.5 Baja astringencia tiene uniones parciales o imperfectas. Renaturalización Dependiendo de: -Contenido

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler

Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler Por Olfert Landt y Andreas Nitsche, TIB MOLBIOL, Berlín Traducción: Adriana

Más detalles



Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles



Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

La expresión fenotípica de las

La expresión fenotípica de las Panorama Métodos Rápidos y Automatizados Aplicados al Análisis Microbiológico de los Alimentos Rosario Martín de Santos* Se describen los métodos rápidos susceptibles de atomatización y que emplean las

Más detalles

PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo

PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo Índice: PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo Historia La Reacción en cadena de la polimerasa (PCR) Algunos tips experimentales

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles



Más detalles


SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS Secugen recomienda que para la visualización de las secuencias se usen programas que permitan ver el dato crudo, ya que a partir de ese dato se

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles



Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO

Más detalles

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ Northern blot Marcación no radioactiva: Digoxigenina: se usa uno de los dntps marcado con digoxigenina Detección: Anticuerpo conjugado con enzima (ALP) o fluorocromo Biotina: se usa uno de los dntps

Más detalles

Extracción y purificación de los ácidos nucleicos

Extracción y purificación de los ácidos nucleicos Extracción y purificación de los ácidos nucleicos Todos los tipos de macromoléculas biológicas tienen una característica en común que va a permitir el desarrollo de un método de separación especifico para

Más detalles


PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: CASO CLINICO: Rubéola Evolución

Más detalles


FUNDAMENTOS DE LA TÉCNICA PCR FUNDAMENTOS DE LA TÉCNICA PCR 1 2 PCR Qué es? REACCIÓN EN CADENA DE LA POLIMERASA Técnica que nos permite amplificar selectivamente un segmento específico de DNA, hasta obtener una cantidad suficiente

Más detalles

Química Biológica Patológica Técnicas de Biología Molecular aplicadas a Bioquímica Clínica Tema 2 Dra. Silvia Varas Tema 2 PCR Historia Bases Optimización de una reacción de

Más detalles



Más detalles



Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles


LA REACCION EN CADENA DE LA POLIMERASA LA REACCION EN CADENA DE LA POLIMERASA ADN super enrollado Secuencia Blanco Hebra de ADN ADN doble cadena Cromosoma Dra. Cristina Gutiérrez García Lab.. Virología a Molecular INHRR ESTRUCTURA DEL ADN.

Más detalles



Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular

Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular Aislamiento, análisis y manipulación de ácidos nucleicos Generación de moléculas de DNA recombinante Ingeniería Genética AISLAMIENTO

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Repaso de PCR y qpcr

Repaso de PCR y qpcr Repaso de PCR y qpcr 1. Los siguientes oligonucleótidos se utilizaron para amplificar una región específica de DNA o RNA, el diseño es variable de acuerdo a el propósito de los oligonucleótidos, a continuación

Más detalles



Más detalles


PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Un poco de historia La técnica de PCR fue inventada por Kary B. Mullis en 1983. La primer publicación sobre PCR apareció en 1985, aunque el principio básico de replicar

Más detalles


CURSO DE PRIMAVERA PATOLOGÍA MOLECULAR DEL CÁNCER CURSO DE PRIMAVERA PATOLOGÍA MOLECULAR DEL CÁNCER Conceptos básicos sobre ADN y ARN Técnicas de amplificación (PCR y variantes) Aplicaciones principales Dr. Juan C. Cigudosa Madrid 29 y 30 de mayo, 2014

Más detalles

Determinación de patógenos en Alimentos por Biología Molecular Hugo Mingo Agilent Technologies Jesús García Microbial System

Determinación de patógenos en Alimentos por Biología Molecular Hugo Mingo Agilent Technologies Jesús García Microbial System Determinación de patógenos en Alimentos por Biología Molecular Hugo Mingo Agilent Technologies Jesús García Microbial System Introducción a la PCR Se fundamenta en la propiedad natural de las ADN polimerasas

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

II.-Capítulo 3. Herramientas básicas de ingeniería genética

II.-Capítulo 3. Herramientas básicas de ingeniería genética II.-Capítulo 3 Herramientas básicas de ingeniería genética Gómez, Marisa; Echenique, Viviana 1 Introducción Hasta aproximadamente 1970 el ADN era la molécula de la célula que planteaba más dificultades

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

PCR gen 16S ARNr bacteriano

PCR gen 16S ARNr bacteriano PCR gen 16S ARNr bacteriano Ref. PCR16S 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y la práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias.

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Dra. Sonia Arduino Dep. de Clínica Estomatología Facultad de Postgrado en Ciencias de la Salud

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles

Cuantificación mediante la técnica de PCR en tiempo real Usos y aplicaciones

Cuantificación mediante la técnica de PCR en tiempo real Usos y aplicaciones Cuantificación mediante la técnica de PCR en tiempo real Usos y aplicaciones Paula Fernández Instituto de Biotecnología. CICVyA. INTA-Castelar PCR Standard vs. PCR Tiempo Real Análisis de punto final

Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

Electroforesis de DNA

Electroforesis de DNA Electroforesis de DNA DNA Topoisomerasas Izquierda Derecha Enzimas de restricción Clasificadas en 3 tipos, donde la mayoría pertenece al grupo II (proteínas monoméricas, poseen simetria rotacional y generalmente

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles