Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publca


3 DEFINICIONES Genotipo : Secuencia de nucleótidos del virus de la cual se deduce la secuencia de aminoácido de una proteína (En el caso del HIV, la RT y PV) Mutaciones : cambios en la secuencia de AA deducida de la secuencia de nucleótidos con respecto a la secuencia de una cepa de referencia (sensible o salvaje) Ejemplo: Met184Val. Mutaciones específicas se identifican como causantes de resistencia genotípica Fenotipo : Deriva del genotipo. En el ejemplo, el cambio Met184Val se traduce fenotípicamente como resistencia a 3TC, ddc y Abacavir.

4 Regiones de PR y RT Evaluadas por test de Resistencia Gag Cleavage Sites p7nc p1 p6 RNase PR RT H IN 242 Genotipificación VIH-INS

5 DE LA MUESTRA A LOS RESULTADOS Pre-Analitica Analitica Post-Analitica

6 Colecta de la muestra Pre-Analítica Envío y Almacenamiento Codificación de muestra Extracción de Ac. Nucleico Amplificación de Ac. Analítica Nucleico Edición de Secuencia Ensamblaje de Secuencia Secuenciamiento Automático Post-Analítica Alineamiento de Secuencia Determinación de mutaciones Reporte de resultados

7 MUESTRA : Sangre Total


9 SEPARACIÓN DEL PLASMA Y EXTRACCIÓN DEL MATERIAL GENETICO (ARN ) Controles de la Prueba Controles Mutantes Controles Silvestres


11 RT-PCR (Reverse Transcription PCR) RNA Ł c DNA




15 SECUENCIAMIENTO DE PRODUCTOS DE PCR (Equipo : Analizador Genético)


17 SOFTWARE : SeqScape

18 La secuencia de ADN del virus obtenido es ingresado en la base de datos de la Universidad de Stanford empleando para ello el Programa HIVdb. Este programa analiza las secuencias y determina si están presentes las mutaciones del virus relacionadas a la resistencia antiretroviral.





23 ELECTROFORESIS No amplifica Si amplifica SEGUNDO PCR (Primers alternativos) PURIFICACION Y CUANTIFICACIÓN DE PRODUCTOS DE PCR No amplifica 1a vez No amplifica 2da vez Si amplifica SECUENCIAMIENTO DE PRODUCTOS DE PCR INDETERMINADO No hay secuencia 1a vez SECUENCIAMIENTO CON PRIMERS ALTERNATIVOS Hay secuencia ANÁLISIS DE SECUENCIAS No hay secuencia 2da vez Hay secuencia REPORTE DE RESULTADO



26 Muestra / Separación de Plasma Extracción de ARN RT-PCR Electroforesis Reporte Análisis de Datos Análisis de Datos

27 Por qué son útiles y necesarios los ensayos de Resistencia Asiste al médico en la toma de decisiones terapéuticas en distintos escenarios: Clarifica los tratamientos disponibles Selecciona los regímenes mas activos Mejora el resultado clínico Clarifica la etiología de los aumentos de carga viral Reduce el uso de drogas inactivas. Provee beneficios a nivel de salud pública Clarifica la epidemiología de la resistencia al HIV reduce transmisión de virus resistentes Permite mejorar las guías de tratamiento Asiste en el desarrollo de nuevas drogas terapéuticas

28 AGRADECIMIENTOS Dr Robert Grant Robert Hance Maribel Acuña Carlos Yabar Equipo del laboratorio de VIH y del Laboratorio de Biología Molecular

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica Genotipificación de VIH en el INS: técnica local y técnicas convencionales Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. lar Responsable de los Procesos

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles



Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles


QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

Administración Nacional de Medicamentos Alimentos y Tecnología Medica y,

Administración Nacional de Medicamentos Alimentos y Tecnología Medica y, Ministerio de Salud "2011 - Año del Trabajo Decente, la Salud y Seguridad de los Trabajadores" Secretaría de Políticas, Regulación... e Institutos DI8POStOlul'f "",6 2 2 3 A.N. M. A. T. BUENOS AIRES,'

Más detalles



Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles


INDICE DE MATERIAS I- LISTA DE FIGURAS, 8. II- LISTA DE CUADROS, 10. III- RESUMEN, 11. IV- SUMMARY, 12. 1- INTRODUCCIÓN, 13. INDICE DE MATERIAS I- LISTA DE FIGURAS, 8. II- LISTA DE CUADROS, 10. III- RESUMEN, 11. IV- SUMMARY, 12. 1- INTRODUCCIÓN, 13. 1.1 Presentación de la especie Fragaria chiloensis, 14. 1.1.1 Clasificación

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: http://microbiologí

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles



Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles



Más detalles



Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales página 2 Objetivo del Curso El objetivo del «Curso de Técnicas Experimentales en Investigación Biomédica» es proporcionar a los asistentes unas nociones básicas sobre las metodologías y tecnología habitualmente

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Biología Molecular en el Diagnóstico de Enfermedades Infecciosas Dirección Médica Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Existen diversas técnicas de Biología Molecular

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

III. Material genético. b. Composición y estructura del RNA.

III. Material genético. b. Composición y estructura del RNA. III. Material genético b. Composición y estructura del RNA. RNA (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa: en la posición 2' del anillo del azúcar hay un grupo

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles


2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores.

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Dr. Jaeson S. Calla Choque Universidad Peruana Cayetano Heredia

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Tamizaje de infecciones transmisibles por transfusión en Argentina (Ley 22.990 - Ley Nacional de Sangre ) HVB: Enzimoinmunoensayos

Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles


UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU La Unidad de secuenciación del Hospital Universitario Sant Joan de Déu, es una unidad de reciente creación que nace con el objetivo de prestar

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles

Hospital de Pediatría SAMIC Prof. Dr. Juan Pedro Garrahan

Hospital de Pediatría SAMIC Prof. Dr. Juan Pedro Garrahan Caso de éxito Hospital de Pediatría SAMIC Prof. Dr. Juan Pedro Garrahan El Hospital de Pediatría SAMIC Prof. Dr. Juan Pedro Garrahan es el máximo referente de salud pública, gratuita y de alta complejidad

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles


FORMATO 1. ASIGNATURA FORMATO 1. ASIGNATURA Nombre de la asignatura: MCBA-0707-ITEL Técnicas Biotecnológicas de Diagnóstico Línea de investigación o trabajo: Biotecnología en Ciencia Animal - Horas prácticas - Horas trabajo

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles


5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

5. La infección hospitalaria: herramientas para su control

5. La infección hospitalaria: herramientas para su control 5. La infección hospitalaria: herramientas para su control Por definición se considera infección nosocomial o de adquisición hospitalaria a la que no está presente ni se está incubando en el momento del

Más detalles



Más detalles

Utilidad de la Biología Molecular en el Diagnóstico y Vigilancia del Dengue

Utilidad de la Biología Molecular en el Diagnóstico y Vigilancia del Dengue Utilidad de la Biología Molecular en el Diagnóstico y Vigilancia del Dengue José Usme Ciro Unidad de Secuenciación y Análisis Genómico Grupo de Virología Instituto Nacional de Salud Virus dengue (DENV)

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles



Más detalles



Más detalles

GenomeLab GeXP Sistema de Análisis Genético


Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis virales Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis Características generales Es un proceso asociado a muchas causas, tanto infecciosas como

Más detalles


EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles


PERFIL DE LOS NUEVOS CABA 2010-2011 PERFIL DE LOS NUEVOS DIAGNÓSTICOS CABA 2010-2011 Distribución de las notificaciones según sexo y estadio clínico al momento del diagnóstico CABA 2010-2011 Estadio % mujeres % hombres SRA 1,9 1,8 Asintomático

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B Fabián Fay CIBIC Rosario Argentina HBV - Marcadores Serológicos HBsAg: Antígeno de Superficie Anti-HBc (total):

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

(Estudios in vivo y estudios in vitro)

(Estudios in vivo y estudios in vitro) (Estudios in vivo y estudios in vitro) IN VIVO: es la experimentación con un todo, que viven organismos en comparación. Ensayos con animales y ensayos clínicos son dos formas de investigación in vivo.

Más detalles

Fundación Maní Argentino

Fundación Maní Argentino Fundación Maní Argentino Aspectos epidemiológicos del Groundnut ringspot virus en cultivos de maní Antecedentes En Córdoba, el cultivo de maní es afectado naturalmente por Groundnut ringspot virus (GRSV,

Más detalles


BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA Objetivos: Diferenciar los niveles de organización y compactación del material genético. Comprender los principios básicos

Más detalles

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto

Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

BIOMOL-EXOME: Secuenciación y Análisis Bioinformático de Exoma Humano para la detección de enfermedades de origen genético.

BIOMOL-EXOME: Secuenciación y Análisis Bioinformático de Exoma Humano para la detección de enfermedades de origen genético. BIOMOL-EXOME: Secuenciación y Análisis Bioinformático de Exoma Humano para la detección de enfermedades de origen genético. Biomol-Informatics SL BIOMOL-EXOME es un servicio de Biomol-Informatics, compañía

Más detalles

Dra. Natàlia Casamitjana


Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles


Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles

Estrategia utilizada

Estrategia utilizada Estrategia utilizada 1) Extracción HIV RNA V3 7114 7218 2) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC

Más detalles



Más detalles

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares MSc. Juan Agapito Panta Laboratorio de Genómica y Biología Molecular Instituto Peruano de Energía Nuclear

Más detalles


CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Centro Nacional de Alerta y Respuesta Rápida. Dirección de Epidemiología CORONAVIRUS

Centro Nacional de Alerta y Respuesta Rápida. Dirección de Epidemiología CORONAVIRUS CORONAVIRUS Introducción Los coronavirus constituyen una gran familia de virus que en el ser humano pueden causar diversas enfermedades que van desde el resfriado común hasta el SRAS (síndrome respiratorio

Más detalles

El Laboratorio en el diagnóstico de las tuberculosis y Micobacterias atípicas: Herramientas diagnósticas disponibles en Chile

El Laboratorio en el diagnóstico de las tuberculosis y Micobacterias atípicas: Herramientas diagnósticas disponibles en Chile El Laboratorio en el diagnóstico de las tuberculosis y Micobacterias atípicas: Herramientas diagnósticas disponibles en Chile Dra. Patricia González A. Médico Microbiólogo Laboratorio Clínica Alemana Facultad

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles


TEMA 5 DIAGNÓSTICO MICROBIOLÓGICO TEMA 5 DIAGNÓSTICO MICROBIOLÓGICO TEMA 5. DIAGNÓSTICO MICROBIOLÓGICO. Definición de diagnóstico microbiológico. Propósito del diagnóstico microbiológico. Ciclo del diagnóstico microbiológico. Etapas del

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles



Más detalles

Estructura y estabilidad de un dominio proteico BRCT. Obregón Mansilla, Alexandra J. I. CAPÍTULO II ANTECEDENTES

Estructura y estabilidad de un dominio proteico BRCT. Obregón Mansilla, Alexandra J. I. CAPÍTULO II ANTECEDENTES CAPÍTULO II ANTECEDENTES Frecuentemente se observa alteraciones en la abundancia de proteínas reguladoras críticas en células cancerosas (20). La pérdida de proteínas supresoras de tumores o el incremento

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico

EDUCACION CONTINUADA. Introducción. Caso clínico EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, B. Calvo An Esp Pediatr 1997;47:201-206. Introducción a la biología molecular y aplicación a la pediatría (6): Caso clínico: Trastorno molecular en la diabetes

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

Conferencia "Biotecnología y nuevos alimentos"

Conferencia Biotecnología y nuevos alimentos Conferencia "Biotecnología y nuevos alimentos" Dra. Mary Lopretti Post PhD., Instituto Nacional Politécnico de Grenoble, Francia. Jefa, Departamento de Bioprocesos y Biotecnología, LATU. Auditorio ORT

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles



Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles


I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS Asignatura: Frecuencia: Docente a cargo: Destinatarios: Anual 5 horas por semana Lic. César R. Olsina

Más detalles