PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)"


1 PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico rápido. El objetivo es obtener un gran número de copias a partir de un segmento determinado de DNA. Componentes del PCR REACTIVOS Y ENZIMAS - Taq polimerasa. - Primers u oligonucleotidos. - Buffer de amplificación (KCl, Tris y MgCl 2 ). - Deoxinucleotidos trifosfato dntps. - Muestra de DNA ó cdna. FUNDAMENTO La reacción en cadena de la polimerasa (PCR) es una técnica que permite amplificar mas de un millón de veces un DNA obtenido a partir de una región seleccionada del genoma, utilizando para ello las propiedades de la Taq Polimerasa, siempre y cuando se conozca una parte de la secuencia de nucleótidos. MATERIALES Y EQUIPOS - Micropipetas de 2, 100 y 1000 µl. - Puntas para micropipetas. - Termociclador - Tubos Eppendorf Se debe disponer de un primer en sentido 5 a 3, este será el F ó Forward. Y un primer en sentido inverso, este será el R ó Reverso que en realidad es un Inverso complementario a la hebra que va en sentido 3-5 y debe sintetizarse en sentido 5-3!!! El diseño de cebadores no debe basarse en una sola secuencia conocida, pues debemos tener la seguridad de que estos se incorporaran a regiones que no sean variables entre individuos de la misma especie, genero o familia. ACTINALVANN_F: ACCCCATCGAGCACGGCATCG ACTINALVANN_R: TGGTCTCGTGGATGCCGCAGG Inv compl CCTGCGGCATCCACGAGACCA Primer F Primer R Así se sintetiza GATGCACATATCTGACTAGTATCTATGCTAGCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTAGTATTTATGCTAGCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTAGTATCTATGCTACCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTAGTATCTATGCTAGCCACATGCTAGCTTATATTCAGC GATGCACATATCTGACTACTATCTATGCTAGCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTAGTATCTTTGCTACCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTACTATCTATGCTAGCCACATGCTAGATTATAATCAGC CATGCATATATCTGAC-AGTATCTATGCTAGCCACATGCTAGATTATATTCAGC CATGCATATATCTGAC-AGTATCTATGCTAGCCACATGCTAGATTATATTCAGT CATGCATATATCTGAC-AGTATCTTTGCTAGCCACATGCTAGATTATATTCAGC CATGCATATATCTGAC-AGTATCTATGCTAGCCACATGCTAGAACATATTCAGC CATGCATATATCTGAC-AGTATCTTTGCTAGCCACATGCTAGATCATATTCAGC 1

2 0 Cebador especie 1: GATGCACATATCTGACT GATGCACATATCTGACTAGTATCTATGCTAGCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTAGTATTTATGCTAGCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTAGTATCTATGCTACCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTAGTATCTATGCTAGCCACATGCTAGCTTATATTCAGC GATGCACATATCTGACTACTATCTATGCTAGCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTAGTATCTTTGCTACCCACATGCTAGATTATATTCAGC GATGCACATATCTGACTACTATCTATGCTAGCCACATGCTAGATTATAATCAGC Cebador especie 2: CATGCATATATCTGAC CATGCATATATCTGAC-AGTATCTATGCTAGCCACATGCTAGATTATATTCAGC CATGCATATATCTGAC-AGTATCTATGCTAGCCACATGCTAGATTATATTCAGT CATGCATATATCTGAC-AGTATCTTTGCTAGCCACATGCTAGATTATATTCAGC CATGCATATATCTGAC-AGTATCTATGCTAGCCACATGCTAGAACATATTCAGC CATGCATATATCTGAC-AGTATCTTTGCTAGCCACATGCTAGATCATATTCAGC Reglas Generales para el diseño de cebadores para PCR Secuencia única de nucleótidos Extremo 3 con presencia de GC Complementariedad interna Complementariedad con el otro cebador Composición y distribución de nucleótidos Longitud del cebador Parámetro Temperatura de Incorporación Composición de la secuencia flanqueada Longitud de la secuencia flanqueada Sitio único de hibridación en el templete 1-2 G-C nucleótidos < 3 bases contiguas < 3 bases contiguas %GC 45-60, TM C, < 4 G s ó C s Continuas nucleótidos 1-2 C de diferencia entre cebadores Parecida en proporción de bases al cebador nucleótidos Óptimos Evitar formación de palindromes o dimeros. Un perfil de PCR es la secuencia de pasos que se programan en el termociclador para indicar las condiciones de la reacción: DESNATURALIZACION Desnaturalización Inicial 95 C 5 min Fase Cíclica (X) 3 Desnaturalización 95 C 1 min Extensión Final Extensión 72 C 72 C Incorporación 2 min 5 min Enfriamiento Desnaturalización por calor aplicando temperaturas de 90 a 95 C C 1.5 min C Indefinido 2

3 HIBRIDACION ENLONGACION Annealing o de emparejamiento. 40 hasta 65 C. Temperatura optima de apareamiento entre los primers y la cadena de ADN a amplificar. La taq polimerasa incorpora nucleótidos en el extremo 3 del primer. La temperatura a la que se lleva a cabo este paso suele ser 72 +/- 5 C. Depende de la enzima utilizada Cada enzima tiene diferentes requerimientos y varía en especificidad, eficiencia y velocidad Estos tres pasos constituyen un ciclo. La repetición de este ciclo permite obtener, amplificación, millones de copias del fragmento de interés. Los modelos también evolucionan. Todo esto, se realiza de forma automatizada, en un termociclador. Para verificar que la PCR ha generado el fragmento de DNA se emplean técnicas de electroforesis. Agarosa polisacarido extraído de algas marinas. Se usa a concentraciones de 0.5-2%. Facil de preparar y no tóxico. Separa fragmentos de ,000 pb. Bajo poder de resolución. RT- PCR TIPOS DE PCR Donde el molde inicial es RNA (mrna) y se requiere de una transcriptasa inversa, para realizar la conversión del RNA a un tipo de DNA llamado DNAc (DNA complementario). Polyacrilamida- son polimeros de acrilamida. Se usa a concentraciones de %. Dificil de preparar y acrilamida neurotóxica. Rango bastante reducido de separación, pero de gran poder de resolución. Separa fragmentos de 500 pb. Mas usual para proteínas. 3

4 PCR anidada Técnica muy sensible, el producto de la amplificación es utilizado como molde para realizar una segunda amplificación con primers que se encuentran en la primer secuencia amplificada. PCR IN SITU Consiste en una reacción de PCR en secciones histológicas o células, donde los productos generados pueden visualizarse en el sitio de amplificación. Es realizada sobre preparaciones fijas en un portaobjetos. Se realiza una primera amplificación de DNA blanco y luego detección mediante hibridación in situ convencional con sondas de DNA/RNA. De esta manera pueden detectarse cantidades pequeñísimas de genoma. PCR Multiplex Se amplifica mas de una secuencia en una misma reacción, se emplean dos o mas pares de primers con el fin de amplificar simultáneamente múltiples segmentos de DNA PCR TIEMPO REAL La principal característica es que permite cuantificar la cantidad de DNA o RNA presentes en la muestra original. Se utiliza comúnmente para determinar la expresión del mrna de un gen. Se utiliza una sustancia marcada con un fluorocromo que, en un termociclador con sensores para medir fluorescencia tras excitar el fluorocromo a la longitud de onda apropiada, permite medir la tasa de generación de uno o más productos específicos. SYBR Green Taqman Aplicaciones La técnica tiene una multitud de aplicaciones: Medicina Permite el genotipar la especie o especies que provocan un determinado cuadro infeccioso Se emplea fundamentalmente como herramienta de diagnosis (Coleman y Tsongalis, 2006). Agronomía y diversidad Permiten discernir entre grupos infraespecíficos de cultivos de interés agronómico. Paleontología, antropología biológica, y ciencias forenses. permite recuperar las escasas cantidades de ADN que aún no se han degradado. 4

5 TSV en America 1992 DNA WSSV en America 1998 ssrna RT-PCR como técnica poderosa para detectar portadores asintomaticos Materiales y Métodos: Primers para WSSV (Lo et al., 1996) Primers para TSV (Nunan et al., 1998) -Pl a Juveniles de 3.5 g libres de WSSV y TSV por PCR. -90 camarones por acuario de 90L. Objetivo: Realizar la detección simultanea de WSSV y TSV en un solo tubo por 1-step multiplex RT-PCR -Inoculos de P. monodon y L. vannamei infectados. -Pleopodos colectados de organismos moribundos (20 ng). Extracción de RNA Fragmentos: TSV 231 pb WSSV 530 pb ITS 892 pb RT-PCR multiplex Gel de agarosa al 2% Resultado: 5

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles



Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles


FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles



Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Un poco de historia La técnica de PCR fue inventada por Kary B. Mullis en 1983. La primer publicación sobre PCR apareció en 1985, aunque el principio básico de replicar

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ Northern blot Marcación no radioactiva: Digoxigenina: se usa uno de los dntps marcado con digoxigenina Detección: Anticuerpo conjugado con enzima (ALP) o fluorocromo Biotina: se usa uno de los dntps

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo

PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo Índice: PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo Historia La Reacción en cadena de la polimerasa (PCR) Algunos tips experimentales

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles


PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles



Más detalles

El diagnóstico genómico de las enfermedades. (Seminario práctico) radica en el DNA que se encuentra empaquetado

El diagnóstico genómico de las enfermedades. (Seminario práctico) radica en el DNA que se encuentra empaquetado El diagnóstico genómico de las enfermedades (Seminario práctico) La información n genética radica en el DNA que se encuentra empaquetado en el núcleo n de las célulasc 1 Si todas las células c del organismo

Más detalles



Más detalles


EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07 PCR A TIEMPO REAL María Maiques R4-Bioquímica Clínica 25-Abril-07 VEAMOS Herramientas para detectar mutaciones Moléculas fluorescentes y tecnología FRET PCR a tiempo real: equipos y métodos de detección

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles


CURSO DE PRIMAVERA PATOLOGÍA MOLECULAR DEL CÁNCER CURSO DE PRIMAVERA PATOLOGÍA MOLECULAR DEL CÁNCER Conceptos básicos sobre ADN y ARN Técnicas de amplificación (PCR y variantes) Aplicaciones principales Dr. Juan C. Cigudosa Madrid 29 y 30 de mayo, 2014

Más detalles



Más detalles



Más detalles



Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

Química Biológica Patológica Técnicas de Biología Molecular aplicadas a Bioquímica Clínica Tema 2 Dra. Silvia Varas qbpatologica.unsl@gmail.com Tema 2 PCR Historia Bases Optimización de una reacción de

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles



Más detalles



Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles



Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

(aislado directamente de células o tejidos) de otros tipos de ADN, como el

(aislado directamente de células o tejidos) de otros tipos de ADN, como el Glosario admixtura: se refiere al estado de estar mezclado (del inglés admixture). Ocurre cuando se entrecruzan individuos de dos o más poblaciones que se encontraban previamente separadas y el resultado

Más detalles

Francis Crick and James Watson point out features of their model for the structure of DNA. ( A. Barrington Brown/Science Source/Photo Researchers,

Francis Crick and James Watson point out features of their model for the structure of DNA. ( A. Barrington Brown/Science Source/Photo Researchers, Francis Crick and James Watson point out features of their model for the structure of DNA. ( A. Barrington Brown/Science Source/Photo Researchers, Inc.) ACIDOS NUCLEICOS ADN ARN Métodos de cuantificación

Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles



Más detalles


LA REACCION EN CADENA DE LA POLIMERASA LA REACCION EN CADENA DE LA POLIMERASA ADN super enrollado Secuencia Blanco Hebra de ADN ADN doble cadena Cromosoma Dra. Cristina Gutiérrez García Lab.. Virología a Molecular INHRR ESTRUCTURA DEL ADN.

Más detalles

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático Criterios para diseñar primers Iván Ferrer Rodríguez, Ph.D. Catedrático 1 Qué es un primer? Es una cadena corta de nucleótidos, un oligonucleótido. Sirve como punto de partida para la replicación del DNA.

Más detalles

Amplificación de Nucleó.dos Reacción en Cadena de la Polimerasa

Amplificación de Nucleó.dos Reacción en Cadena de la Polimerasa Amplificación de Nucleó.dos Reacción en Cadena de la Polimerasa Historia de la PCR Reacción en Cadena de la Polimerasa 1983: Kary Mullis tuvo la idea de PCR mientras trabajaba para Cetus Corpora.on in

Más detalles



Más detalles

Amplificación de ácidos nucleicos in vitro.

Amplificación de ácidos nucleicos in vitro. Amplificación de ácidos nucleicos in vitro. El principal objetivo de las técnicas de amplificación de ácidos nucleicos in vitro, es mejorar la sensibilidad de los test basados en ácidos nucleicos y simplificarlos

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1

LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1 LECCIÓN 3. Caracterización mediante marcadores moleculares - ADN. Lección 3 1 Nociones generales sobre Marcadores Moleculares -ADN Analizan directamente la molécula de ADN. Detectan ciertas variaciones

Más detalles



Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5 PCR Caracteristicas del ADN Se rompen con las siguientes condiciones -Temperaturas >90 C - ph >10.5 Baja astringencia tiene uniones parciales o imperfectas. Renaturalización Dependiendo de: -Contenido

Más detalles



Más detalles


PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles



Más detalles


DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias.

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Dra. Sonia Arduino Dep. de Clínica Estomatología Facultad de Postgrado en Ciencias de la Salud

Más detalles

Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler

Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler Por Olfert Landt y Andreas Nitsche, TIB MOLBIOL, Berlín Traducción: Adriana

Más detalles