every contact leaves a trace Edmond Locard

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "every contact leaves a trace Edmond Locard"

Transcripción

1 Técnicasgenéticasaplicadas alascienciasforenses VíctorAcuñaAlonzo LicenciaturadeAntropologíaFísica EscuelaNacionaldeAntropologíaeHistoria

2 every contact leaves a trace Edmond Locard

3 Conceptos Identificaciónindividualyparentesco Característicasde? Basesdedatospoblacionales Ejemplos

4 Conceptos ElADNcomoevidencia Pruebaderutinaparaidentificaciónhumanaydisputas depaternidad PCRdealtasensibilidad obtencióndeevidenciaa partirdeescasomaterialbiológico Basesdedatosdeperfilesgenéticos búsquedaágildecoincidenciadeperfilesgenéticos (totaloparcial) posibilidadderesolvercasosnoresueltos(coldcases) asignacióndeunvalorestadísticoalaidentificación JoblingMAyGillP.2004.Encodedevidence:DNAinforensicanalysis.NatureReviewsGenetics.5:

5 Conceptos ElADNcomoevidencia Laevidenciagenéticadebeconsiderarseenel marcodeotrosdatos,elpapeldelgenetistano eshacerpresuncionesdeinocenciao culpabilidad,sinoproveerinformaciónobjetiva aljuezojurado JoblingMAyGillP.2004.Encodedevidence:DNAinforensicanalysis.NatureReviewsGenetics.5:

6 Conceptos EnlaactualidadseusanPCRmultiplexparamicrosatélites autosómicos(amplificaciónsimultáneadevariosloci) Otrosmarcadoresparausosespecíficos: SNPsautosómicos MarcadoresdelcromosomaY(crY) MarcadoresdelADNmitocondrial(mtDNA) Ademásdeladeterminacióndeperfilesgenéticospara identificaciónydisputasdepaternidad,otrasposibles aplicacionesdelagenéticason: Deduccióndelorigen(ancestría) Informaciónfenotípica Análisisdeotrasespecies JoblingMAyGillP.2004.Encodedevidence:DNAinforensicanalysis.NatureReviewsGenetics.5:

7 Conceptos Genomahumano BrownTA.2002.Genomes.GarlandScience.

8 23ParesdeCromosomas+mtDNA Conceptos Núcleodelacélula Autosomas 2copias por célula mtdna XY ADNnuclear Mitocondria (múltiplescopias) 3,200millonesbp Cromosomas sexuales ButlerJM.2005.ForensicDNATyping,2ndEdition.ElsevierAcademicPress 16,569bp ADN mitocondrial Variascopias porcélula

9

10 STRsautosómicos(microsatélites) Conceptos Fuentedevariación: Herenciaindependiente,recombinaciónymutación Ventajas: Poderdediscriminaciónextremadamentealto Desventajas: Difícildetipificarenmuestrasdegradadas >20milSTRs

11 SNPsautosómicos Conceptos Fuentedevariación: Herenciaindependiente,recombinaciónymutación Ventajas: Sepuedentipificarenmuestrasdegradadas Desventajas: Poderdediscriminaciónrelativamentebajo(bialélicos) >3millonesdeSNPs FrazerKA,etal2009.Humangeneticvariationanditscontributiontocomplextraits.NatureReviewsGenetics10,

12 STRscrY Conceptos Fuentedevariación: Sólomutación Ventajas: Específicodevarones,útilenmezclademuestrasdemujeryvarón Distribuciónfilogeográficabiendefinida Desventajas: Poderdediscriminaciónrelativamentebajo,secomparteporvía paterna,posiblesproblemasdeestructuradepoblaciones

13 SNPsdelADNmitocondrial Conceptos Fuentedevariación: Sólomutación Ventajas: Mayoresprobabilidadesintegridad Distribuciónfilogeográficabiendefinida Desventajas: Heteroplasmia,Poderdediscriminaciónrelativamentebajo,se comparteporvíamaterna,posiblesproblemasdeestructurade poblaciones Región Haplogrupos África L0,L1,L2,L3. Europa H,I,J,N1b,T,U,V,W,X Asia A,B,C,D,G,Y,Z América A,B,C,D,X

14 Variaciónenelgenomahumano Conceptos Nuestrassecuenciassonidénticasenun99.9%(especie joven ). Enelgenomahumanohaymásde10millonesdeSNPsy decenasdemilesdestrsentreotrospolimorfismos Estavariaciónseestructuraenbloquescromosómicos(haplotipos) de5a200kbp 85a90%delavariacióngenéticaneutralseatribuyeadiferencias entreindividuosdentrodelaspoblaciones Elrestante10a15%sedistribuyeentregrupos Estavariaciónesmodestaperoinfluencialasdiferenciasque existenentrelaspoblacionesrespectoacaracterísticasfenotípicas

15 PCR Conceptos 1920s 1950sotros polimorfismosde grupossanguíneos yproteínas(mnss, Rhesus,Lewis,Kell, haptoglobinas...) Primer polimorfismo genético,abo (Landsteiner) Pm Primerkit forense comercial HLA DQA UsodemtDNA yy STRsen UKNational casosforenses DNADatabase MultilocusDNA fingerprint, minisatélites (Jeffreys) Primeros STRspara identificación humana Primercaso dedesastre masivo (WacoTexas) Determinación deperfiles genéticosa partirdel contactocon objetos < pocosloci pocopolimórficos altaprobabilidaddecoincidencia Primerkit comercialde STRsforenses muchosloci muypolimórficos muybajaprobabilidad decoincidencia JoblingMAyGillP.2004.Encodedevidence:DNAinforensicanalysis.NatureReviewsGenetics.5:

16 Conceptos Identificaciónindividualyparentesco CaracterísticasdeX Basesdedatospoblacionales Ejemplos

17 Sistemadeidentificaciónmásusado: ó n Identificaci CombinedDNAIndexSystem STRbasehttp://

18 ó n Identificaci THO1 Multiplexde2individuos

19 ó n Identificaci STRbasehttp://

20 CaracterísticasdelosSTRsseleccionadosparaid Identificaci ó n Altatasademutación Grannúmerodealelosencada población Altaheterocigosidad Herenciaindependiente(noligados) Buenosmarcadoresindividuales,no suelensermarcadoresdeancestría Neutralesensumayoría Tetranucleótidos,fácilesdeamplificar Altopoderdediscriminación Probabilidadmuybajadecoincidencia aleatoria(match) Muchasbasesdedatos! STRbasehttp://

21 ó n Identificaci Fuentesdeevidencia Sangre Semen Saliva Orina Cabello Diente Hueso Tejido Uñas Objetosxcontacto J.M.Butler.2005.ForensicDNATyping,2ndEdition.ElsevierAcademicPress

22 Pruebadeidentificación Identificaci? Muestradeescenadel delitooinvestigaciónde paternidad(dubitada) ó n Extracción ADN Biología Cuantificacióndel ADN Amplificacióndemúltiples marcadores Tecnología Separaciónydeteccióndelos productosdepcr Determinacióndelos genotiposdelamuestra Genética Comparacióndelperfil genéticoconotros resultados(muestrasde referencia,indubitadas) Generacióndeunreportede casoconlaprobabilidadde coincidenciaalazar(match) Sisedaunacoincidencia, comparaciónconbasesdedatos poblacionales J.M.Butler.2005.ForensicDNATyping,2ndEdition.ElsevierAcademicPress

23 Match Losperfilesgenéticoscoinciden.Sereportala significanciaestadística. ó n Identificaci Resultadosposiblesdelaprueba Exclusión(Non match) Lacomparacióndegenotipos muestrandiferenciasenelperfilgenético. Noconcluyente Losdatosnopermitenllegarauna conclusión(desacuerdoentrelosexpertos,faltadedatos,etc). J.M.Butler.2005.ForensicDNATyping,2ndEdition.ElsevierAcademicPress

24 Laprobabilidaddequedosindividuosnorelacionados compartanunperfildedna Secalculaconlaregladelproductoparalaprobabilidad conjuntadequeocurraunperfilgenéticodeterminadoenuna poblacióndeterminada Puedeaumentarenlossiguientescasos: PerfildeADNparcialpordegradaciónyreduccióndel númerodelociinformativos Sielsospechosoyelculpablerealtienenparentescoosi seoriginandelamismasubpoblación ó n Identificaci Probabilidaddematch(Pm)

25 ParaunacorrectavaloraciónestadísticadelapruebadeADNes necesariodisponerdeunabasededatoslomásextensa posible(n>200)quesearepresentativadelapoblaciónala quepertenecenlosindividuosquesehananalizado. ó n Identificaci Basesdedatospoblacionales Enelcasodequeexistansubgruposdepoblaciónclaramente diferenciadosesimportantequeesténincluidosenlabasede datos

26 Generardatosdelapoblaciónolaspoblaciones deseadas(encasodepoblacionesmultiétnicas)n>100 Determinarlasfrecuenciasalélicasparacadalocus ó n Identificaci Usarlafrecuenciaalélicaparaestimarlararezadeun perfilgenéticoparticular Homocigotos(p2),Heterocigotos(2pq) Usarlaregladelproductocombinadaenvariosloci J.M.Butler.2005.ForensicDNATyping,2ndEdition.ElsevierAcademicPress

27 Tablasdefrecuenciasalélicas Butleretal.(2003) JFS48(4): D3S1358 Caucasian Allele 11 African American Caucasian N=7,636 African American N=258 N=7, * * Allele * * * * * * 15.2 N=302 Einumetal.(2004) JFS49(6) 20 ButlerJ.M.2005.ForensicDNATyping,2ndEdition 2005ElsevierAcademicPress

28 Frecuenciadelperfilgenéticoconlos13lociSTRCODIS AmpFlSTR Identifiler (AppliedBiosystems) Perfil 16,17 17,18 21,22 12,14 28,30 14,16 12,13 11,14 9,9 9,11 6,6 8,8 10,10 TH01 D19 D3 D8 AMEL D5 Locus D3S1358 allele 16 VWA D21 value TPOX D13 D7 D16 FGA allele 17 CSF D18 value in 9.17 VWA FGA D8S D21S11 D18S51 D5S818 D13S317 D7S820 D16S539 THO1 TPOX CSF1PO D2 Combined 9.17 P 81 R O D 16,364 U 185,073 C 4,845,217 T ,818, x x x x x x1014 Probabilidaddecoincidenciaalazarparaesteperfilenlapoblación eurodescendienteeeua:1en837trillones R U L E

29 Aplicacionesdelgenotipadoparaidentificación ó n Identificaci ocasosforenses obasesdedatosdeadn odesastresmasivos odesaparecidos opruebasdeparentesco ogenealogíasycasoshistóricos oidentidaddelíneascelulareshumanas odeteccióndequimerasgenéticas omonitoreodetrasplantes odeteccióndetumores omapeodeenfermedades oestudiodeladiversidadhumana Otros Identificacióndeespecies(conservación) Identificacióndeanimalesdomésticos STRbasehttp://

30 ocantidadeintegridaddelmaterialgenético ocontaminación(mezcladeperfilesgenéticos,inhibiciónpcr) obasesdedatosdereferencia( estimaciónprobabilística) omuestrasdereferenciaparaelcaso(familiares,sospechosos...) o$ ó n Identificaci Límitesdelastécnicasgenéticas Aspectosbásicos otomademuestraadecuada ocadenadecustodia oextracciónexitosadelmaterialgenético ocontroldecalidaddetodoslosprocesosdellaboratorio Laboratorioscertificados

31 Conceptos Identificaciónindividualyparentesco Característicasde? Basesdedatospoblacionales Ejemplos

32 Cuandoelperfilgenéticodeunaescenadelcrimennocoincide conningúnperfildelasbasesdedatos,cualquierinformación quesepuedaobtenerseráútil: ísticas Caracter Características Deduccióndelorigen(ancestría) STRsdeusoforensenosonmarcadoresdeancestríaindividual Porelcontrario,mtDNAycrYhansidoexcelentesmarcadores defilogeografía,sinembargosuusoseríaproblemáticoen poblacionesmestizas Informaciónfenotípica STRsdeusoforensenoaportanningunainformación fenotípica. USAROTRASVARIABLESGENÉTICAS?

33 Marcadoresparaestimarancestría Caracter AncestryInformativeMarkers ísticas LosAIMsseseleccionanparamaximizarlasdiferencias absolutasenlasfrecuenciasalélicasentredospoblaciones ancestrales.elaimidealestáfijadoenunapoblaciónyes muyabundanteenotra(>60%). Permitenrealizarestimacionesdeancestríaindividual Sóloel2%delosSNPsautosómicostienevalores>60% entrelas3grandesagrupacionescontinentales.

34 VLMartinez Marignac,etal2007.AdmixtureinMexicoCity:implicationsforadmixture mappingoftype2diabetesgeneticriskfactors.humgenet,120(6):

35 ElcasoexcepcionaldeD9S11209ARenamerindios WangS,etal.2007.GeneticVariationandPopulationStructureinNativeAmericans.PLoSGenet3(11):e185.

36 ísticas Caracter

37 ísticas Caracter Marcadoresasociadosavariaciones fenotípicas Nosehabíandescritopolimorfismosinequívocamente asociadosparalagranmayoríadelascaracterísticas fenotípicasquepodríanserdeinterésparadescribiral culpabledeuncrimen(estatura,colordepiel...) Recientementesehanidentificadoalelosasociadosa fenotiposqueeventualmentepodríanserusadosestimar algunascaracterísticas.

38

39

40

41

42 Conceptos Identificaciónindividualyparentesco CaracterísticasdeX Basesdedatospoblacionales Ejemplos

43 JoblingMAyGillP.2004.Encodedevidence:DNAinforensicanalysis.NatureReviewsGenetics.5:

44 Basesdedatos Basesdedatospoblacionales ENFSIDNAWGPopulationDatabase EuropeanNetworkofForensicScienceInstitutes STRBase ShortTandemRepeatDNAInternetDataBase CreatedbyJohnM.ButlerandDennisJ.Reeder (NISTBiochemicalScienceDivision) Revistasespecializadas: ForensicScienceInternationalGenetics JournalofForensicSciences

45

46 TsarNicholasIIprofile

47

48

49

50

51

52 Basesdedatos

53

54

55 Basesdedatos

56 Basesdedatos AutosomalSNPs 70Loci(Valloneetal.2005ForensicSci.Int.149: ) U.S.Caucasian(N=74) AfricanAmerican(N=71) U.S.Hispanic(N=44)

57

58 ASTMandAmericanAcademy offorensicsciences ElsevierScience Springer Verlag ElsevierScience J.M.Butler.2005.ForensicDNATyping,2ndEdition 2005ElsevierAcademicPress

59 Conceptos Identificaciónindividualyparentesco CaracterísticasdeX Basesdedatospoblacionales Ejemplos

60 Ejemplos

61 QuédatosestándisponiblesenMéxico?

62 Ejemplos AmericanJournalofHumanBiology Volume20,Issue5,Date:September/October2008,Pages:

63

64

65

66

67

68

69

70 IntheearlymorninghoursofJuly17,1918theroyalfamilyand theirstaffwereledtothecellaroftheipatievhousewherethey werebeingheldandexecuted. Inthelate1970s,alocalgeologist,Dr.AlexanderAvdoninwas abletolocatethemassgravecontainingtheremainsoffiveof thesevenmembersoftheroyalfamilyandtheirfourservants. Inthesummerof2007,agroupofamateurarcheologists discoveredafewbonefragmentsapproximately70metersfrom thefirstgrave.followinganofficialarcheologicalexcavation conductedbydr.sergeipogorelov,deputydirectorofthe SverdlovskRegion'sArchaeologicalInstitute,asetof44bone fragmentsandteethwerecarefullyrecoveredfromthesite.

71

72

73

74

75 (..)thelrofthehypothesis(h1)thatsamples146.1and147arethe childrenoftsarnicholasiiandtsarinaalexandra(andsiblingsof thethreeprincessesfromgraveone)comparedtothealternative hypothesisthatthesesamplesareindividualscompletelyunrelated totheromanovfamily(h2),wefoundthatthednaevidenceis4.36 trilliontimesmorelikelyifsample147isadaughteroftsar NicholasIIandTsarinaAlexandra,andover80trilliontimes morelikelyifsample146.1isasonoftsarnicholasiiand TsarinaAlexandrathanifthesesampleswerefromtwo unrelatedindividuals.

76 the little things are infinitely the most important Sherlock Holmes

Biología Forense. Dra. Ana María López Parra. Laboratorio de Genética Forense

Biología Forense. Dra. Ana María López Parra. Laboratorio de Genética Forense Dra. Ana María López Parra Laboratorio de Genética Forense Departamento de Toxicología y Legislación Sanitaria. Facultad de Medicina. Universidad Complutense de Madrid (UCM) Ventajas del análisis de ADN

Más detalles

El cuerpo humano está formado por un conjunto de células y dentro de ellas se encuentra el ADN (Acido Desoxirribonucleico).

El cuerpo humano está formado por un conjunto de células y dentro de ellas se encuentra el ADN (Acido Desoxirribonucleico). El cuerpo humano está formado por un conjunto de células y dentro de ellas se encuentra el ADN (Acido Desoxirribonucleico). Es una sustancia química determinada por la técnica de PCR Reacción en Cadena

Más detalles

INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD

INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD T. 976 22 11 33 WWW.BIOSALUD.ORG RESIDENCIAL PARAÍSO, 9 50006 ZARAGOZA -SPAIN- INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD Han sido remitidas al Centro de Análisis

Más detalles

DNANÁLISE LABORATÓRIO ABRIL

DNANÁLISE LABORATÓRIO ABRIL RESULTADOS Ejercicio de Control de Calidad entre laboratorios 20-2013 DNANÁLISE LABORATÓRIO ABRIL / 2013 (FLORIANÓPOLIS/BRASIL) Ejercicio de Control de Calidad entre laboratorios 20-2013 DETERMINACION

Más detalles

Programa de Ejercicios de Intercomparación ESTUDIO DE POLIMORFISMOS DE ADN EN MANCHAS DE SANGRE Y OTRAS MUESTRAS BIOLÓGICAS

Programa de Ejercicios de Intercomparación ESTUDIO DE POLIMORFISMOS DE ADN EN MANCHAS DE SANGRE Y OTRAS MUESTRAS BIOLÓGICAS Programa de Ejercicios de Intercomparación ESTUDIO DE POLIMORFISMOS DE ADN EN MANCHAS DE SANGRE Y OTRAS MUESTRAS BIOLÓGICAS 1. ALCANCE E ÍTEMS El alcance de ensayo cubierto en el Programa de Ejercicios

Más detalles

EL MATERIAL GENÉTICO:

EL MATERIAL GENÉTICO: LA HUELLA GENÉTICA: PRUEBAS DE PATERNIDAD E IDENTIFICACIÓN INTRODUCCIÓN: En éstos últimos años, se ha popularizado a través de los medios de comunicación la expresión: identificación través de pruebas

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

ADN: LA GENÉTICA FORENSE Y SUS APLICACIONES EN INVESTIGACIÓN CRIMINAL. Instituto de Ciencias Forenses. Universidad de Santiago de Compostela

ADN: LA GENÉTICA FORENSE Y SUS APLICACIONES EN INVESTIGACIÓN CRIMINAL. Instituto de Ciencias Forenses. Universidad de Santiago de Compostela ADN: LA GENÉTICA FORENSE Y SUS APLICACIONES EN INVESTIGACIÓN CRIMINAL. Angel Carracedo Instituto de Ciencias Forenses. Universidad de Santiago de Compostela Resumen El análisis de la variación del ADN

Más detalles

Conceptos básicos sobre el estudio de paternidad

Conceptos básicos sobre el estudio de paternidad LABORATORIO CLÍNICO Conceptos básicos sobre el estudio de paternidad Marcela Lagos L. 1, Helena Poggi M. 1,a, Cecilia Mellado S. 2 1 Departamento de Laboratorios Clínicos. 2 Departamento de Pediatría.

Más detalles

XI Jornadas de Genética Forense Madrid, 1-2 Junio de 2006. Dep. de Toxicología y Legislación Sanitaria Universidad Complutense de Madrid España

XI Jornadas de Genética Forense Madrid, 1-2 Junio de 2006. Dep. de Toxicología y Legislación Sanitaria Universidad Complutense de Madrid España XI Jornadas de Genética Forense Madrid, -2 Junio de 2006 Organizado por: Dep. de Toxicología y Legislación Sanitaria Universidad Complutense de Madrid España INDICE. Resumen del Ejercicio de Polimorfismos

Más detalles

Sociedad Argentina de Genética Forense Curso Familial testing and mixtures 25-27 de Noviembre de 2015

Sociedad Argentina de Genética Forense Curso Familial testing and mixtures 25-27 de Noviembre de 2015 Lourdes Prieto Instituto de Ciencias Forenses Universidad de Santiago de Compostela Valoración de la prueba de ADN: métodos básicos Sociedad Argentina de Genética Forense Curso Familial testing and mixtures

Más detalles

3.- Metodología de PCR Página 1 de 14

3.- Metodología de PCR Página 1 de 14 3.- Metodología de PCR Página 1 de 14 3.- Metodología de PCR 3.1.- Metodología de Kits Multiplex (Tabla 3 A) Multiplex Precinto Marcar (si utilizado) Detección CTT 507554 SI D01 507573 SI D01 507604 SI

Más detalles

El ADN como evidencia legal*

El ADN como evidencia legal* El ADN como evidencia legal* Tipos de pruebas de ADN y preservación de las evidencias Por Andrea F. Puppio y Silvia Benasayag 1. Introducción Los grandes avances en la tecnología del ácido desoxirribonucleico

Más detalles

X Jornadas de Genética Forense Azores, 12-13 Setiembre de 2005. Organizado por:

X Jornadas de Genética Forense Azores, 12-13 Setiembre de 2005. Organizado por: X Jornadas de Genética Forense Azores, 2-3 Setiembre de 25 Organizado por: INDICE. Resumen del Ejercicio de Polimorfismos de ADN del año 25 Julia García-Hirschfeld Unidad Garantía Calidad, Instituto de

Más detalles

Problema 1: Southern Blot. Problema 2: Paternidad.

Problema 1: Southern Blot. Problema 2: Paternidad. Problema 1: Southern Blot. En el análisis de DNA Fingerprint mediante la técnica de "Southern" Blot: A- El RNA celular es separado electroforéticamente y transferido a una membrana. Luego la membrana se

Más detalles

Pasantía en Genética Forense

Pasantía en Genética Forense Pasantía en Genética Forense El ADN, tu propio Juez Natalia Yael Sandberg Lacasa Proyecto Pasantía Laboratorio biológico de Policía Técnica Jefa Tutora: Dra. Sinthia Pagano Licenciatura en biología Profundización

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008 . Genética. Gen.

Más detalles

Prueba de paternidad de ADN de 16 regiones: 99.9% de precisión.

Prueba de paternidad de ADN de 16 regiones: 99.9% de precisión. NUESTROS SERVICIOS PRUEBA DE PATERNIDAD: Las pruebas de paternidad por ADN son utilizadas para conocer la identidad del padre biológico de un determinado hijo o hijos. A diferencia de otros métodos anticuados,

Más detalles

Notas Genética forense

Notas Genética forense Notas Genética forense Cristina Rodriguez Carlin, Beatriz Rodarte Murguía, Montserrat Monter Rosales, Aída Cristina Coss Rojas, América Castañeda Sortibrán y Rosario Rodríguez Arnaiz. Los programas de

Más detalles

GENÉTICA FORENSE. 1. GENETICA FORENSE: De los grupos sanguíneos al ADN

GENÉTICA FORENSE. 1. GENETICA FORENSE: De los grupos sanguíneos al ADN GENÉTICA FORENSE 1. GENETICA FORENSE: De los grupos sanguíneos al ADN La Genética forense es una especialidad de la Genética que incluye un conjunto de conocimientos de Genética necesarios para resolver

Más detalles

GENÉTICA FORENSE: CRIMEN E IDENTIDAD

GENÉTICA FORENSE: CRIMEN E IDENTIDAD JOSÉ ANTONIO CANO FERNÁNDEZ Teniente de la Guardia Civil. Director Téc. del Dpto. Biología Laboratorio ADN del Servicio de Criminalística de la Guardia Civil. BLANCA ARCE ANTÓN Especialista del Programa

Más detalles

ESTUDIO DE QUIMERISMO POST TRASPLANTE DE MÉDULA ÓSEA POR ANÁLISIS DE FRAGMENTOS

ESTUDIO DE QUIMERISMO POST TRASPLANTE DE MÉDULA ÓSEA POR ANÁLISIS DE FRAGMENTOS ESTUDIO DE QUIMERISMO POST TRASPLANTE DE MÉDULA ÓSEA POR ANÁLISIS DE FRAGMENTOS Luis Sáenz Mateos R4 Análisis Clínicos- Hospital General Universitario de Ciudad Real Rotación Externa Hospital Morales Meseguer-Hospital

Más detalles

Maestría de Medina Molecular Curso de Genética molecular Forense. 21 DE JUNIO de 2008 Instituto Leloir

Maestría de Medina Molecular Curso de Genética molecular Forense. 21 DE JUNIO de 2008 Instituto Leloir Maestría de Medina Molecular Curso de Genética molecular Forense 21 DE JUNIO de 2008 Instituto Leloir Dr. Daniel Corach Servicio de huellas digitales genéticas Facultad de Farmacia y Bioquímica UNIVERSIDAD

Más detalles

LA IDENTIFICACIÓN GENÉTICA DE VÍCTIMAS DE LA GUERRA CIVIL ESPAÑOLA: LA EXPERIENCIA DEL INSTITUTO NACIONAL DE TOXICOLOGÍA Y CIENCIAS FORENSES.

LA IDENTIFICACIÓN GENÉTICA DE VÍCTIMAS DE LA GUERRA CIVIL ESPAÑOLA: LA EXPERIENCIA DEL INSTITUTO NACIONAL DE TOXICOLOGÍA Y CIENCIAS FORENSES. LA IDENTIFICACIÓN GENÉTICA DE VÍCTIMAS DE LA GUERRA CIVIL ESPAÑOLA: LA EXPERIENCIA DEL INSTITUTO NACIONAL DE TOXICOLOGÍA Y CIENCIAS FORENSES. 1 1 1 1 1 1 ALONSO A, MARTÍN P, ALBARRÁN C, GARCÍA P, AGUIRRE

Más detalles

Modelo drop-out & drop-in INTERPRETACIÓN DE PERFILES COMPLEJOS: EL MODELO DROP-OUT & DROP-IN. Introducción: concepto de LR. Introducción 15/09/2013

Modelo drop-out & drop-in INTERPRETACIÓN DE PERFILES COMPLEJOS: EL MODELO DROP-OUT & DROP-IN. Introducción: concepto de LR. Introducción 15/09/2013 INTERPRETACIÓN DE PERFILES COMPLEJOS: EL MODELO DROP-OUT & DROP-IN Lourdes Prieto Comisaría General de Policía Científica Laboratorio de ADN, Madrid, España Valor del LR e integración con otros medios

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Su clínica local: www.aegh.org/docs/encuesta-aegh-2005-centros-y-personasde-contacto.pdf Herencia Ligada al Cromosoma X www.aegh.org/docs/encue sta-aegh-2005-servicios-degenetica-clinica.pdf Elaborado

Más detalles

DIRECCIÓN DE BIOLOGÍA MOLECULAR Y ESPECIALIDADES CRIMINALÍSTICAS. DEPTO. DE GENÉTICA FORENSE FOLIO NO. 16703 ASUNTO: DICTAMEN

DIRECCIÓN DE BIOLOGÍA MOLECULAR Y ESPECIALIDADES CRIMINALÍSTICAS. DEPTO. DE GENÉTICA FORENSE FOLIO NO. 16703 ASUNTO: DICTAMEN Licenciado T. MANUEL SABINA SILVA Subprocurador General de Justicia de la Zona Norte del Estado de. P r e s e n t e COORDINACIÓN DE PLANEACIÓN, DESARROLLO E INNOVACIÓN INSTITUCIONAL. DIRECCIÓN GENERAL

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Herencia Ligada al Cromosoma X Elaborado a partir de folletos originales de Guy s and St Thomas Hospital, Londres y London IDEAS Genetic Knowledge Park. Enero de 2008 Este trabajo se ha realizado bajo

Más detalles

CONCEPTOS BÁSICOS DE ADN FORENSE

CONCEPTOS BÁSICOS DE ADN FORENSE Antonio Alonso Alonso Instituto Nacional de Toxicología y Ciencias Forenses. Servicio de Biología. Madrid. SUMARIO: 1. INTRODUCCIÓN. 2. ALGUNOS PRINCIPIOS BÁSICOS EN IDEN- TIFICACIÓN GENÉTICA. 3. LOS GENOMAS

Más detalles

Programa Oficial de Posgrado Máster y Doctorado Interuniversitario UAM-UCM-UAH en ANTROPOLOGÍA FÍSICA: EVOLUCIÓN Y BIODIVERSIDAD HUMANA.

Programa Oficial de Posgrado Máster y Doctorado Interuniversitario UAM-UCM-UAH en ANTROPOLOGÍA FÍSICA: EVOLUCIÓN Y BIODIVERSIDAD HUMANA. Programa Oficial de Posgrado Máster y Doctorado Interuniversitario UAM-UCM-UAH en ANTROPOLOGÍA FÍSICA: EVOLUCIÓN Y BIODIVERSIDAD HUMANA Curso 2012/13 Asignatura: Antropología Genética Profesora: Dra. Rosario

Más detalles

Utlización n de plataforma HEA- BeadChipTM en la detección n de quimerismo específico de grupo sanguineos después s del transplante

Utlización n de plataforma HEA- BeadChipTM en la detección n de quimerismo específico de grupo sanguineos después s del transplante Utlización n de plataforma HEA- BeadChipTM en la detección n de quimerismo específico de grupo sanguineos después s del transplante de médula m ósea alogénica Mariza Mota Hospital Israelita Albert Einstein

Más detalles

EL ADN EN LAS CIENCIAS FORENSES LA GENETICA FORENSE THE DNA IN FORENSIC... FORENSIC GENETICS

EL ADN EN LAS CIENCIAS FORENSES LA GENETICA FORENSE THE DNA IN FORENSIC... FORENSIC GENETICS EL ADN EN LAS CIENCIAS FORENSES LA GENETICA FORENSE THE DNA IN FORENSIC... FORENSIC GENETICS Iliana Maritza López García * Sumario. I. Introducción. II. La susceptibilidad del material biológico para ser

Más detalles

Muestra humanas de origen único Marcadores autosómicos

Muestra humanas de origen único Marcadores autosómicos XVIII Jornadas del GHEP-ISFG Sevilla, 18-20 septiembre 2013 GRUPO DE HABLA ESPAÑOL A Y PORTUGUESA DE LA ISFG GRUPO DE LÍNGUAS ESPANHOLA E PORTUGUESA DA ISFG Muestra humanas de origen único Marcadores autosómicos

Más detalles

Información y características del curso on line INSCRÍBETE HOY MISMO. INSCRÍBETE EN: www.genforen.com

Información y características del curso on line INSCRÍBETE HOY MISMO. INSCRÍBETE EN: www.genforen.com Laboratorio de Genética Forense y Genética de Poblaciones Dpto. Toxicología y Legislación Sanitaria Facultad de Medicina 32 horas de formación 46 vídeos didácticos Foros 8 Tests de evaluación INSCRÍBETE

Más detalles

Una prueba de paternidad es aquella que tiene como objeto probar que un hombre es el padre biológico de un niño/a.

Una prueba de paternidad es aquella que tiene como objeto probar que un hombre es el padre biológico de un niño/a. Categoría: Sección: GACETAS 2008 04 de Sep, 2008 Prueba de Paternidad Una prueba de paternidad es aquella que tiene como objeto probar que un hombre es el padre biológico de un niño/a. Qué es una prueba

Más detalles

La variabilidad genética de los micro y minisatélites y su aplicación en medicina legal

La variabilidad genética de los micro y minisatélites y su aplicación en medicina legal La variabilidad genética de los micro y minisatélites y su aplicación en medicina legal Ángel Carracedo Instituto de Medicina Legal Universidad de Santiago de Compostela. l. Introducción La Medicina Legal

Más detalles

Taller de Análisis Forense de ADN

Taller de Análisis Forense de ADN Taller de Análisis Forense de ADN John M. Butler, PhD Instituto Nacional de Estándares y Tecnología de E.U. Contorno de Presentación Análisis de ADN y STRs Butler, J.M. (2006) Genetics and genomics of

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Aproximadamente 1 de cada 500 bebés nace con pérdida auditiva o pierde la audición durante la primera infancia.

Aproximadamente 1 de cada 500 bebés nace con pérdida auditiva o pierde la audición durante la primera infancia. Aproximadamente 1 de cada 500 bebés nace con pérdida auditiva o pierde la audición durante la primera infancia. Las causas de la pérdida auditiva pueden ser muchas: algunas son ambientales (por ejemplo,

Más detalles

Cuando el padre o la madre se niega a aceptar legalmente a su hijo o hija y. decide no reconocerlo a través del registro civil de nacimiento.

Cuando el padre o la madre se niega a aceptar legalmente a su hijo o hija y. decide no reconocerlo a través del registro civil de nacimiento. Cuándo se vulnera el derecho a la filiación? Cuando el padre o la madre se niega a aceptar legalmente a su hijo o hija y decide no reconocerlo a través del registro civil de nacimiento. Si a un niño o

Más detalles

Estructura y contenido del Ejercicio NIVEL BÁSICO

Estructura y contenido del Ejercicio NIVEL BÁSICO EJERCICIO 2014 ghep-isfg GRUPO DE HABLA ESPAÑOLA Y PORTUGUESA GRUPO ESPANHOL E PORTUGUÊS DA ISFG ESTUDIO DE POLIMORFISMOS DE ADN EN MANCHAS DE SANGRE Y OTRAS MUESTRAS BIOLÓGICAS KORO FERNÁNDEZ OLIVA COORDINADORA

Más detalles

ADN & LAS VICTIMAS DE DELITOS:

ADN & LAS VICTIMAS DE DELITOS: ADN & LAS VICTIMAS DE DELITOS: Lo que las víctimas necesitan saber ADN & LAS VICTIMAS DE DELITOS: Lo que las víctimas necesitan saber El uso cada vez mayor de evidencia ADN en los casos penales da a las

Más detalles

Tema 3: Toxicología y Rastros Biológicos

Tema 3: Toxicología y Rastros Biológicos Tema 3: y Rastros Biológicos Presentación 1. ANÁLISIS DE MUESTRAS BIOLÓGICAS 2. ALCOHOL-DROGAS 3. LA QUÍMICA DE LOS VENENOS 4. CASOS PRÁCTICOS Introducción a los restos biológicos Resto biológico es todo

Más detalles

Padre con enfermedad. 50% con enfermedad

Padre con enfermedad. 50% con enfermedad a. Autosómica dominante: Padre con 50% con Se presenta cuando la copia del gen alterado es dominante sobre el normal y basta una sola copia para que se exprese la. El gen se encuentra en uno de los 22

Más detalles

LABORATORIO DE GENÉTICA MÉDICA UNIVERSIDAD TECNOLÓGICA DE PEREIRA

LABORATORIO DE GENÉTICA MÉDICA UNIVERSIDAD TECNOLÓGICA DE PEREIRA LABORATORIO DE GENÉTICA MÉDICA UNIVERSIDAD TECNOLÓGICA DE PEREIRA QUIENES SOMOS El laboratorio de Genética Médica hace parte de la actividad académica, de investigación y extensión de la Universidad Tecnológica

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

GENETICA MENDELIANA Y GENETICA DE POBLACIONES

GENETICA MENDELIANA Y GENETICA DE POBLACIONES Práctica #7 I. Objetivos 45 GENETICA MENDELIANA Y GENETICA DE POBLACIONES * Conocer conceptos básicos de la genética mendeliana y cómo se transmiten las características de generación en generación. * Determinar

Más detalles

Estudio de los microsatélites y ministrs del cromosoma X de aplicación forense

Estudio de los microsatélites y ministrs del cromosoma X de aplicación forense Universidad de Cantabria Facultad de Medicina Departamento de Fisiología y Farmacología Medicina legal Estudio de los microsatélites y ministrs del cromosoma X de aplicación forense María Castañeda Fernández

Más detalles

ACTUALIZACION EN ESTUDIOS DE PATERNIDAD POR ANALISIS DE ADN

ACTUALIZACION EN ESTUDIOS DE PATERNIDAD POR ANALISIS DE ADN Informedica 2002: Preparando el Camino para la e-salud Global 2do Congreso Virtual Iberoamericano de Informática Médica Nov. 4 - Nov. 30, 2002 en Internet ACTUALIZACION EN ESTUDIOS DE PATERNIDAD POR ANALISIS

Más detalles

TALLER DE GENÉTICA 3 PRUEBAS DE DIAGNÓSTICO MOLECULAR

TALLER DE GENÉTICA 3 PRUEBAS DE DIAGNÓSTICO MOLECULAR TALLER DE GENÉTICA 3 PRUEBAS DE DIAGNÓSTICO MOLECULAR Guía de actividades 2012 1 Taller de Genética III: Pruebas de diagnóstico molecular Para resolver los problemas de este Taller se recomienda estudiar

Más detalles

GRACE ALEXANDRA TERREROS IBÁÑEZ

GRACE ALEXANDRA TERREROS IBÁÑEZ DETERMINACIÓN DE LA VARIACIÓN DE LAS SECUENCIAS DE LAS REGIONES HVI Y HVII DE LA REGIÓN CONTROL DEL DNA MITOCONDRIAL EN UNA MUESTRA DE LA POBLACIÓN CARIBE COLOMBIANA GRACE ALEXANDRA TERREROS IBÁÑEZ PONTIFICIA

Más detalles

Rt::CIBIDO : J"~~I.1' r.'ifl!ii..,,,,

Rt::CIBIDO : J~~I.1' r.'ifl!ii..,,,, 2B ABR Z009 Eberth Castañón Torres, mexicano, nacido el 26 de diciembre de 1981, en Chihuahua. Chihuahua, casado. Quimico Bacteriólogo Parasitólogo y Maestro en Ciencias en Biotecnologfa, con residencia

Más detalles

PERSONAS DESAPARECIDAS, ANÁLISIS FORENSE DE ADN E IDENTIFICACIÓN DE RESTOS HUMANOS

PERSONAS DESAPARECIDAS, ANÁLISIS FORENSE DE ADN E IDENTIFICACIÓN DE RESTOS HUMANOS PERSONAS DESAPARECIDAS, ANÁLISIS FORENSE DE ADN E IDENTIFICACIÓN DE RESTOS HUMANOS Guía sobre prácticas idóneas en caso de conflicto armado y de otras situaciones de violencia armada Segunda edición, 2009

Más detalles

4Genética forense 1. QUÉ ES LA GENÉTICA FORENSE? tema

4Genética forense 1. QUÉ ES LA GENÉTICA FORENSE? tema tema 4Genética forense 1. QUÉ ES LA GENÉTICA FORENSE? Con la denominación de genética forense se define el uso de ciertas técnicas empleadas en genética para la identificación de los individuos en base

Más detalles

1. Introducción clonación del ADN hibridación molecular Clonación del ADN en células Clonación del ADN en sistemas libres de células PCR

1. Introducción clonación del ADN hibridación molecular Clonación del ADN en células Clonación del ADN en sistemas libres de células PCR REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Principios básicos de la manipulación genética. INGENIERÍA GENÉTICA Programa de Formación del Profesorado UNED Mayo de 2000 2 Índice 1. Introducción 2. Reacción

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles

INSTRUCTIVO PARA TOMA Y CONSERVACIÓN DE MUESTRAS PARA ESTUDIO DEL POLIMORFISMO DEL ADN

INSTRUCTIVO PARA TOMA Y CONSERVACIÓN DE MUESTRAS PARA ESTUDIO DEL POLIMORFISMO DEL ADN INSTRUCTIVO PARA TOMA Y CONSERVACIÓN DE MUESTRAS PARA ESTUDIO DEL POLIMORFISMO DEL ADN ÍNDICE 1. SOLICITUD DE PRÁCTICA... 3 2. INSTRUCCIONES PARA LA TOMA Y CONSERVACIÓN DE MATERIAL BIOLÓGICO DE PERSONAS

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Genética para andar por casa... y 3 Murcia, 17 de diciembre de 2012. Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos.

Más detalles

Un centro de biotecnología al servicio de la salud

Un centro de biotecnología al servicio de la salud Tecnologías para la Vida S. de R.L. de C.V. En búsqueda del bienestar humano Un centro de biotecnología al servicio de la salud Mexicali, Baja California, México Septiembre de 2012 Tecnologías para la

Más detalles

CAPÍTULO IV LA PRUEBA GENÉTICA PARA LA DETERMINACIÓN DE LA FILIACIÓN

CAPÍTULO IV LA PRUEBA GENÉTICA PARA LA DETERMINACIÓN DE LA FILIACIÓN CAPÍTULO IV LA PRUEBA GENÉTICA PARA LA DETERMINACIÓN DE LA FILIACIÓN 4.1. EL ADN, GENERALIDADES. El análisis de ADN consiste en obtener el mapa genético de la persona y compararlo con el del supuesto hijo;

Más detalles

Y después de la secuencia, qué?

Y después de la secuencia, qué? Y después de la secuencia, qué? Nuestros genomas no son iguales Persona 1 Persona 2 = Variaciones en el ADN Qué tipo de variaciones? Secuencia estándar Variaciones: Cambios de una base por otra: Polimorfismos

Más detalles

PROPUESTA DE EXHUMACIÓN DE RESTOS MORTUARIOS PAR LAS ASOCIACIONES DE SOS-BEBÉS-ROBADOS

PROPUESTA DE EXHUMACIÓN DE RESTOS MORTUARIOS PAR LAS ASOCIACIONES DE SOS-BEBÉS-ROBADOS LLEIDA, a 21 de junio 2011 PROPUESTA DE EXHUMACIÓN DE RESTOS MORTUARIOS PAR LAS ASOCIACIONES DE SOS-BEBÉS-ROBADOS NEODIAGNOSTICA S.L., siguiendo su política de máxima transparencia e intentando dar la

Más detalles

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R.

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R. República Bolivariana de Venezuela U. E. Colegio Cruz Vitale É Prof. Francisco Herrera R. LA GENÉTICA es la ciencia que estudia los genes, la herencia, la variación de los organismos. El término Genética

Más detalles

DOCUMENTO GUÍA PRUEBAS DE ADN PARA INVESTIGACIÓN DE PATERNIDAD Y/O MATERNIDAD (Versión actualizada - Enero - 2015)

DOCUMENTO GUÍA PRUEBAS DE ADN PARA INVESTIGACIÓN DE PATERNIDAD Y/O MATERNIDAD (Versión actualizada - Enero - 2015) DOCUMENTO GUÍA PRUEBAS DE ADN PARA INVESTIGACIÓN DE PATERNIDAD Y/O MATERNIDAD (Versión actualizada - Enero - ) INSTITUTO COLOMBIANO DE BIENESTAR FAMILIAR Dirección de Protección Elaboró: Janeth Ortega

Más detalles

1. En relación con las aportaciones de Mendel al estudio de la herencia: (mod 05 A4)

1. En relación con las aportaciones de Mendel al estudio de la herencia: (mod 05 A4) LA BASE DE LA HERENCIA. ASPECTOS QUÍMICOS Y GENÉTICA MOLECULAR 15. GENÉTICA MENDELIANA 1. En relación con las aportaciones de Mendel al estudio de la herencia: (mod 05 A4) a) Defina qué es un retrocruzamiento.

Más detalles

2 ADN: ácido desoxirribonucleico, también conocido como DNA por sus

2 ADN: ácido desoxirribonucleico, también conocido como DNA por sus ARTICULO DE REVISIÓN LA PRUEBA DE PATERNIDAD CON ADN Una descripción para abogados, laboratorios clínicos y público en general Dr. en C. Héctor Rangel Villalobos 1 Resumen La facilidad para obtener perfiles

Más detalles

Identificación de fluidos Ejercicio de intercomparación Estudio de polimorfismos de ADN en manchas de sangre y otras muestras biológicas 2014

Identificación de fluidos Ejercicio de intercomparación Estudio de polimorfismos de ADN en manchas de sangre y otras muestras biológicas 2014 Identificación de fluidos Ejercicio de intercomparación Estudio de polimorfismos de ADN en manchas de sangre y otras muestras biológicas 2014 Quito (Ecuador), 11/09/2014 María José Farfán Espuny mariajose.farfan@justicia.es

Más detalles

IX Jornadas de Genética Forense Manaos, 2-4 de Junio de 2004 Organizado por:

IX Jornadas de Genética Forense Manaos, 2-4 de Junio de 2004 Organizado por: IX Jornadas de Genética Forense Manaos, 2-4 de Junio de 2004 Organizado por: Genomic Engenharia Molecular Ltda. Rua Itapeva 500, cj 5 AB Sao Paulo (Brasil) INDICE 1. Resumen del Ejercicio de Polimorfismos

Más detalles

Resultado positivo de trisomía 18

Resultado positivo de trisomía 18 Programa de Detección Prenatal de California Los resultados de la prueba inicial del segundo trimestre Prueba inicial de marcador cuádruple o Prueba inicial integrada del suero o Prueba inicial integrada

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

PROYECTO: BASES GENÉTICAS DE LA ENFERMEDAD DE BEHÇET. Norberto Ortego Centeno

PROYECTO: BASES GENÉTICAS DE LA ENFERMEDAD DE BEHÇET. Norberto Ortego Centeno PROYECTO: BASES GENÉTICAS DE LA ENFERMEDAD DE BEHÇET Norberto Ortego Centeno La herencia en las enfermedades Son enfermedades hereditarias las que se transmiten de padres a hijos La información viaja en

Más detalles

ANEXO TÉCNICO ACREDITACIÓN Nº 665/LE1398. Entidad: ERTZAINTZA - POLICÍA AUTÓNOMA DEL PAÍS VASCO. UNIDAD DE POLICÍA CIENTÍFICA

ANEXO TÉCNICO ACREDITACIÓN Nº 665/LE1398. Entidad: ERTZAINTZA - POLICÍA AUTÓNOMA DEL PAÍS VASCO. UNIDAD DE POLICÍA CIENTÍFICA Hoja 1 de 3 ANEXO TÉCNICO ACREDITACIÓN Nº 665/LE1398 Entidad: ERTZAINTZA - POLICÍA AUTÓNOMA DEL PAÍS VASCO. UNIDAD DE POLICÍA CIENTÍFICA Dirección: C/ Larrauri Mendotxe Bidea, 18; 48950 Erandio (VIZCAYA)

Más detalles

Bases moleculares y estudios genéticos

Bases moleculares y estudios genéticos II Jornada Genética Clínica para Médicos de Familia Bases moleculares y estudios genéticos María García-Barcina Unidad de Genética del H. Universitario de Basurto Osakidetza Sede SVMFIC Valencia, 2 de

Más detalles

EL DIAGNOSTICO DE LA PATERNIDAD BIOLOGICA: AVANCES INTRODUCIDOS APLICANDO LA TECNOLOGIA DEL DNA

EL DIAGNOSTICO DE LA PATERNIDAD BIOLOGICA: AVANCES INTRODUCIDOS APLICANDO LA TECNOLOGIA DEL DNA EL DIAGNOSTICO DE LA PATERNIDAD BIOLOGICA: AVANCES INTRODUCIDOS APLICANDO LA TECNOLOGIA DEL DNA Marian M. de Pancorbo Santos Alonso Azucena Castro Isabel Fernández Marta Gómez de Cedrón Germán Tamayo Africa

Más detalles

CONCLUSIONES. Conclusiones CONCLUSIONES METODOLÓGICAS. Diseño experimental

CONCLUSIONES. Conclusiones CONCLUSIONES METODOLÓGICAS. Diseño experimental Conclusiones Conclusiones CONCLUSIONES CONCLUSIONES METODOLÓGICAS Diseño experimental 1. Los protocolos experimentales de extracción, amplificación y secuenciación de DNA antiguo deben adecuarse a la

Más detalles

OBJETIVO. Conocer que existe un método biológico genético valioso para la identificación personal de interés criminalístico.

OBJETIVO. Conocer que existe un método biológico genético valioso para la identificación personal de interés criminalístico. SUB-TEMA 16: IDENTIFICACIÓN BIOLOGICA GENÉTICA OBJETIVO Conocer que existe un método biológico genético valioso para la identificación personal de interés criminalístico. CONTENIDO El examen del ADN o

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

FOJA 1. Muellerstra e 44, A-6020 Innsbruck, Austria Teléfono: ++43 512 9003 70600, Fax: ++ 43 512 9003 73600

FOJA 1. Muellerstra e 44, A-6020 Innsbruck, Austria Teléfono: ++43 512 9003 70600, Fax: ++ 43 512 9003 73600 FOJA 1 Muellerstra e 44, A-6020 Innsbruck, Austria Teléfono: ++43 512 9003 70600, Fax: ++ 43 512 9003 73600 Procuraduría General de la República Sara Monica Medina Alegría, QFI Coordinadora General de

Más detalles

El valor de la prueba prenatal no invasiva (non-invasive prenatal testing, NIPT). Apéndice para la carpeta del asesor en genética

El valor de la prueba prenatal no invasiva (non-invasive prenatal testing, NIPT). Apéndice para la carpeta del asesor en genética El valor de la prueba prenatal no invasiva (non-invasive prenatal testing, NIPT). Apéndice para la carpeta del asesor en genética Las NIPT usan ADN libre de células. Muestra de sangre de la madre ADN libre

Más detalles

FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA

FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA Departamento de Biología Ambiental y Salud Pública FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA INTRODUCCIÓN. Genes y ambiente. Las cualidades heredadas y los efectos de la experiencia. El sustrato

Más detalles

Traducción e Informe de Investigación

Traducción e Informe de Investigación Universidad Nacional Facultad de Filosofía y Letras Sistema de Estudios de Posgrado Escuela de Literatura y Ciencias del Lenguaje Maestría Profesional en Traducción Inglés-Español Traducción e Informe

Más detalles

NeoTyping. Informe de Resultados. (Muestra: 2015-XXXX)

NeoTyping. Informe de Resultados. (Muestra: 2015-XXXX) NeoTyping Informe de Resultados (Muestra: 2015-XXXX) DIAGNÓSTICO PREVENTIVO DATOS SOLICITUD Nombre: Especialidad: Centro: Teléfono: Dirección: Ciudad: Código Postal: FORMA ENVIO RESULTADOS Vía email: (En

Más detalles

Paralelismo entre cromosomas y la teoria de Mendel

Paralelismo entre cromosomas y la teoria de Mendel Paralelismo entre cromosomas y la teoria de Mendel Cromosomas sexuales Autosomas Herencia ligada al sexo Cromosomas heteromorfos Nettie Stevens, 1909 Estudios en Drosophila, mosca del vinagre Thomas Hunt

Más detalles

TIPOS DE DIABETES MELLITUS. En la actualidad, según el comité de expertos de la ADA y la OMS, se distinguen los siguientes tipos de diabetes mellitus:

TIPOS DE DIABETES MELLITUS. En la actualidad, según el comité de expertos de la ADA y la OMS, se distinguen los siguientes tipos de diabetes mellitus: TIPOS DE DIABETES MELLITUS En la actualidad, según el comité de expertos de la ADA y la OMS, se distinguen los siguientes tipos de diabetes mellitus: DIABETES MELLITUS DIABETES TIPO 1 O Diabetes de origen

Más detalles

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA ACTIVIDADES FINALES: GENÉTICA HUMANA 1.- Un varón de ojos azules, cuyos padres tenían ojos oscuros, se casa con una mujer de ojos oscuros, cuyo padre tenía ojos azules. Esta mujer tiene un hermano de ojos

Más detalles

Test de Cribado Prenatal No Invasivo en sangre materna

Test de Cribado Prenatal No Invasivo en sangre materna Test de Cribado Prenatal No Invasivo en sangre materna Detecta las trisomías fetales de los cromosomas 21, 13 y 18 Detecta síndromes de microdeleción Informa del sexo fetal y de las aneuploidías de cromosomas

Más detalles

Clasificación de las enfermedades genéticas

Clasificación de las enfermedades genéticas Clasificación de las enfermedades genéticas Enfermedades Monogénicas (1%) Dominantes: Osteogénesis imperfecta, Corea de Huntington, Hipercolesterolemia familiar. Recesivas: Fenilcetonuria, Anemia de Células

Más detalles

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares MSc. Juan Agapito Panta Laboratorio de Genómica y Biología Molecular Instituto Peruano de Energía Nuclear

Más detalles

Test de Cribado Prenatal No Invasivo en sangre materna

Test de Cribado Prenatal No Invasivo en sangre materna Test de Cribado Prenatal No Invasivo en sangre materna Software de resultados BGI con marcado CE para la trisomía 21 Detecta las trisomías fetales de los cromosomas 21, 13 y 18 Informa de 3 síndromes de

Más detalles

Definición: cariotipo y características

Definición: cariotipo y características Prof. Oswaldo Javier Loreto Marzo 2014 Definición: cariotipo y características El cariotipo es el ordenamiento de los cromosomas de una célula metafásica de acuerdo a su morfología, tales como el tamaño,

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Dieta genética para prevenir enfermedades? La clonación, el ADN y otras cosas Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética

Más detalles

Enfermedades asociadas a mutaciones estructurales

Enfermedades asociadas a mutaciones estructurales Enfermedades asociadas a mutaciones estructurales El cariotipo humano A partir de un cultivo de sangre periférica, y posterior tratamiento con Giemsa para obtener un bandeo G, puede obtenerse el cariotipo

Más detalles

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes:

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes: TEMA 4: AVANCES BIOMÉDICOS 1.- TRASPLANTES DE ÓRGANOS Trasplante o injerto en medicina es un tratamiento médico complejo que consiste en trasladar órganos, tejidos o células de una persona a otra. El órgano

Más detalles

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

CONCEPTOS GENERALES EN GENÉTICA

CONCEPTOS GENERALES EN GENÉTICA CONCEPTOS GENERALES EN GENÉTICA 1. Genetica clásica Genética molecular 1.1. La genética clásica o formal parte del estudio del fenotipo (de lo que observamos) y deduce el genotipo (gen o genes que determinan

Más detalles

1. CONCEPTOS BÁSICOS EN GENÉTICA CLÁSICA

1. CONCEPTOS BÁSICOS EN GENÉTICA CLÁSICA GENÉTICA MENDELIANA La genética mendeliana o clásica es la ciencia que establece las leyes que explican la herencia biológica, es decir, la forma en que los caracteres de los progenitores aparecen en sus

Más detalles

UNIVERSIDAD DE CHILE FACULTAD DE DERECHO Departamento de Derecho Privado ANALISIS DE LA LEY 19.970, QUE CREA EL SISTEMA NACIONAL DE REGISTROS DE ADN.

UNIVERSIDAD DE CHILE FACULTAD DE DERECHO Departamento de Derecho Privado ANALISIS DE LA LEY 19.970, QUE CREA EL SISTEMA NACIONAL DE REGISTROS DE ADN. UNIVERSIDAD DE CHILE FACULTAD DE DERECHO Departamento de Derecho Privado ANALISIS DE LA LEY 19.970, QUE CREA EL SISTEMA NACIONAL DE REGISTROS DE ADN. RICARDO ERNESTO ALAMOS SANTA CRUZ DANIEL ROLANDO CONTRERAS

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

LA PRUEBA DEL ADN, UNA HERRAMIENTA CONTUNDENTE EN EL ESCLARECIMIENTO DE LOS DELITOS DE VIOLACION

LA PRUEBA DEL ADN, UNA HERRAMIENTA CONTUNDENTE EN EL ESCLARECIMIENTO DE LOS DELITOS DE VIOLACION LA PRUEBA DEL ADN, UNA HERRAMIENTA CONTUNDENTE EN EL ESCLARECIMIENTO DE LOS DELITOS DE VIOLACION Laura Hernández Gómez Apartado: 632-2010 Zapote, San José, Costa Rica licda_hernandez@hotmail.com RESUMEN

Más detalles