Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 DANAGENE RNA PURIFICATION KIT REF EXTRACCIONES REF EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales, bacterias, levaduras, fluidos biológicos y mezcla de reacciones utilizando para ello columnas con una membrana de sílica. Las células son lisadas por incubación en una solución que contiene agentes caotrópicos que inactivan inmediatamente las RNasas (las cuales están presentes en todos los materiales biológicos) y a la vez crean las condiciones de unión apropiadas que favorecen la absorción del ARN en la membrana de sílica. Después de la lisis, se realiza una homogenización y filtración con un filtro que se provee con el kit. El ADN contaminante unido a la membrana de sílica puede ser eliminado con una solución de DNasa (no suministrada con el kit) bien aplicada directamente en la membrana, o bien, una vez eluido el ARN total. Las sales, metabolitos y componentes celulares son eliminados por lavados con dos tampones diferentes. El ARN total es eluido con agua libre de nucleasas. El ARN total preparado con el DANAGENE RNA PURIFICATION KIT es útil para aplicaciones como RT-PCR, Northern, primer extension, tecnología de arrays y ensayos de protección de la RNasa. 1. COMPONENTES DEL KIT Tampón de Lisis ARN 45 ml RT Tampón RW1 45 ml RT Tampón de Lavado (añadir etanol) 25 ml RT Agua Libre Nucleasas 10 ml RT Columnas de Filtración 100 unid. RT Columnas ARN 100 unid. RT Tubos de Recolección 200 unid. RT

2 El Tampón de lisis ARN y el Tampón RW1 contiene guanidinio de isotiacianato que es un potente irritante, llevar guantes y gafas protectoras. Ambos tampones pueden formar componentes reactivos peligrosos cuando se combinan con lejía. Equipos y reactivos necesarios y no provistos con el kit Etanol 100 % Etanol 70 % Microcentrifuga. Microtubos de 1. 5 ml y 2.0 ml. Homogenizadores generales para homogenizar tejidos animales y de plantas. Nitrógeno líquido. -mercaptoetanol. 3. PROTOCOLO GENERAL 3.1 Consideraciones preliminares 1. Tamaño muestra: Hasta 5 x 10 6 Células Hasta 25 mg tejido Hasta 1 x 10 9 bacterias Hasta 5 x 10 7 levaduras 2. Promedio ARN obtenido: Hasta 70 µg 3. Volumen Elución: µl 4. Capacidad de Unión: 100 µg 5. Tiempo/ preparación < 30 minutos / 6 prep Es posible obtener hasta 70 µg de ARN total, cuando como muestra se utiliza 5 x 10 6 células o 25 mg de tejido. El ARN obtenido puede ser utilizado para RT-PCR. Generalmente, entre 1-10% del total del ARN obtenido a partir de 1 x 10 6 células o 10 mg de tejido es suficiente para ser utilizado en RTPCR. El ARN obtenido a partir de muestras iniciales pueden presentar trazas de ADN en la preparación. Es por ello que si se ha de utilizar en RT-PCR recomendamos utilizar bajas cantidades de muestra inicial y un tratamiento con DNasa I en la columna o una vez eluido el 3.2 Preparaciones preliminares Añadir 100 ml de alcohol 100 % a la solución de lavado concentrada, marcar la fecha. Debido a la omnipresencia de RNasas es absolutamente esencial que todo el material inicial sea congelado en Ni Líquido y conservado a 70 C. Añadir las soluciones de lisis lo antes posible, una vez añadida la solución de lisis, el lisado puede ser conservado a 70 C durante meses. El ARN no está protegido hasta que el material es congelado en Ni líquido o lisado en presencia de agentes desnaturalizantes. Por tanto, es importante que las muestras sean congeladas en Ni líquido, inmediatamente y conservadas a 70 C, también puede utilizarse DANAGENE PROTECT SOLUTION o ser procesadas inmediatamente. Las muestras pueden ser conservadas en la solución de lisis después de la homogenización a 70 C durante 1 año, a 4 C durante 24 horas y hasta varias horas a temperatura ambiente. El uso de -mercaptoetanol en la lisis es altamente recomendado para tejidos animales, particularmente en aquellos que se sabe que tienen un alto contenido en RNAsas (ejem.páncreas), al igual que en tejidos de plantas. También se recomienda para aquellos usuarios que quieren aislar RNA para aplicaciones muy sensibles o enriquecimiento de microrna. Alternativamente, la Solución de Lisis RNA puede ser utilizada tal y como es suministrada.

3 3.3 Protocolo para purificación de ARN a partir de tejido animal 1. Añadir 400 l de Tampón de Lisis ARN l de -mercaptoetanol al tejido pulverizado con Ni líquido. Homogenizar con homogenizador eléctrico manual. Homogenización de la muestra: homogenizar hasta 25 mg de tejido congelado y pulverizarlo con nitrógeno líquido. IMPORTANTE: Es esencial para una eficiente preparación de ARN que todo el ARN que contiene la muestra sea liberado de las células por la homogenización con un homogenizador mecánico (tipo Polytron), tener cuidado en mantener el rotor sumergido para evitar formar mucha espuma. Para los tejidos frescos y blandos utilizar el homogenizador; para los tejidos frescos duros o ricos en RNasas pulverizar con Ni líquido; para los tejidos congelados blandos o pequeñas piezas utilizar el homogenizador; para todos los demás tejidos congelados pulverizar con Ni líquido. 2. Centrifugar 2 minutos a máxima velocidad. Pasar el sobrenadante a una columna de filtración. 3. Reducir la viscosidad y limpiar el lisado por filtración a través de una columna de filtración. Colocar la 4. Añadir 400 l de Etanol 70 % al filtrado resultante del paso 3 y mezclar por vortex o pipeteo. Después de precipitado en la columna. Si después del paso 2 y 3 el volumen del lisado es menor de 400 l, añadir 1 5. Coger una columna de unión ARN más su tubo de recolección y añadir el lisado. Centrifugar a x g ( rpm)durante 60 segundos. Colocar la columna en un nuevo tubo de recolección. La capacidad máxima de la columna es de 750 l. Repetir el proceso si mayores volúmenes son utilizados 6. Añadir 400 l de Tampón de RW1 y centrifugar a máxima velocidad( x g) durante 1 7. Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante º Lavado: Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante 1 9. Centrifugar durante 3 minutos adicionales para eliminar todo el etanol residual. Eliminar el tubo de 10. Colocar la columna en un microtubo nuevo de 1.5 ml ( no suministrado con el kit) para eluir el ARN total. 11. Eluir el ARN en l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante Eluir el ARN con otros l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante 1

4 3.4 Protocolo de extracción de ARN total a partir de células animales en cultivo Nota: La máxima cantidad recomendada de células es 3 x Pellets de células pueden ser conservados a -70ºC para un uso posterior (determinar el número de células antes de congelar). Los pellets congelados no deberán ser conservados más de 2 semanas para asegurar que la integridad del ARN no se verá comprometida. El Tampón de lisis RNA se añadirá directamente sobre los pellets congelados sin dejar que alcancen la temperatura ambiente. 1.A) Extracción ARN total de células creciendo en monocapa 1. Aspirar el medio y lavar las células con una cantidad apropiada de PBS.Aspirar el PBS. 2. Añadir directamente 400 l de Solución de Lisis RNA l de -mercaptoetanol directamente a la placa de cultivo. 3. Lisar las células, tapar la placa y agitar el tampón alrededor de la superficie de la placa durante 5 minutos. 4. Pasar el lisado a un microtubo y homogenizar con un homogenizador eléctrico manual. 5. Centrifugar 2 minutos a máxima velocidad. Pasar el sobrenadante a una columna de filtración. 6. Reducir la viscosidad y limpiar el lisado por filtración a través de una columna de filtración. Colocar la 7. Añadir 400 l de Etanol 70 % al filtrado resultante del paso 6 y mezclar por vortex o pipeteo. Después de precipitado en la columna. Si después del paso 6 el volumen del lisado es menor de 400 l, añadir 1 8. Coger una columna de unión ARN más su tubo de recolección y añadir el lisado. Centrifugar a x g ( rpm)durante 60 segundos. Colocar la columna en un nuevo tubo de recolección.la capacidad máxima de la columna es de 750 l. Repetir el proceso si mayores volúmenes son utilizados 9. Añadir 400 l de Tampón de RW1 y centrifugar a máxima velocidad( x g) durante Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante º Lavado: Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante Centrifugar durante 3 minutos adicionales para eliminar todo el etanol residual. Eliminar el tubo de 13. Colocar la columna en un microtubo nuevo de 1.5 ml ( no suministrado con el kit) para eluir el ARN total. 14. Eluir el ARN en l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante Eluir el ARN con otros l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante 1

5 1.B) Extracción de ARN total de células creciendo en solución 1. Transferir la suspensión celular a un tubo libre de RNAsas (no suministrado) y centrifugar a no más de 200x g (aprox rpm) durante 10 minutos para pellet las células. 2. Cuidadosamente eliminar el sobrenadante. 3. Añadir 400 l de Solución de Lisis RNA l de -mercaptoetanol al pellet. Lisar las células por vortex durante 15 segundos. Asegurarse que todo el pellet está disuelto antes de proceder con el siguiente paso 4. Centrifugar 2 minutos a máxima velocidad. Pasar el sobrenadante a una columna de filtración. 5. Reducir la viscosidad y limpiar el lisado por filtración a través de una columna de filtración. Colocar la 6. Añadir 400 l de Etanol 70 % al filtrado resultante del paso 5 y mezclar por vortex o pipeteo. Después de precipitado en la columna. Si después del paso 5 el volumen del lisado es menor de 400 l, añadir 1 7. Coger una columna de unión ARN más su tubo de recolección y añadir el lisado. Centrifugar a x g ( rpm)durante 60 segundos. Colocar la columna en un nuevo tubo de recolección. La capacidad máxima de la columna es de 750 l. Repetir el proceso si mayores volúmenes son utilizados 8. Añadir 400 l de Tampón de RW1 y centrifugar a máxima velocidad( x g) durante 1 9. Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante º Lavado: Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante Centrifugar durante 3 minutos adicionales para eliminar todo el etanol residual. Eliminar el tubo de 12. Colocar la columna en un microtubo nuevo de 1.5 ml ( no suministrado con el kit) para eluir el ARN total. 13. Eluir el ARN en l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante Eluir el ARN con otros l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante 1

6 3.5 Protocolo de extracción de ARN total a partir de bacterias. Nota: Se recomienda no utilizar más de 1 x 10 9 células /ml, el crecimiento bacteriano puede ser medido por un espectrofotómetro, como regla general, un cultivo de E.coli de 1 x 10 9 células /ml tiene una DO 600 de 1.0. Preparar una cantidad apropiada de TE conteniendo lisozima, esta solución se preparará con TE libre de RNAsas y conservado en hielo hasta su uso. Para Gram-negativos la concentración de lisozima será de 1 mg/ml y Grampositivos la concentración de lisozima será de 3 mg/ml. 1. Pellet las células por centrifugación (aprox rpm) durante 1 2. Eliminar el sobrenadante y resuspender por vortex el pellet en 100 l del TE con la cantidad apropiada de lisozima.incubar a temperatura ambiente durante 10 minutos. 3. Añadir 300 l de Solución de Lisis RNA. Lisar las células por vortex durante 15 segundos. Asegurarse que todo el pellet está disuelto antes de proceder con el siguiente paso 4. Reducir la viscosidad y limpiar el lisado por filtración a través de una columna de filtración. Colocar la 5. Añadir 400 l de Etanol 70 % al filtrado resultante del paso 4 y mezclar por vortex o pipeteo. Después de precipitado en la columna. Si después del paso 4 el volumen del lisado es menor de 400 l, añadir 1 6. Coger una columna de unión ARN más su tubo de recolección y añadir el lisado. Centrifugar a x g ( rpm) durante 60 segundos. Colocar la columna en un nuevo tubo de recolección. La capacidad máxima de la columna es de 750 l. Repetir el proceso si mayores volúmenes son utilizados 7. Añadir 400 l de Tampón de RW1 y centrifugar a máxima velocidad( x g) durante 1 8. Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante º Lavado: Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante Centrifugar durante 3 minutos adicionales para eliminar todo el etanol residual. Eliminar el tubo de 11. Colocar la columna en un microtubo nuevo de 1.5 ml ( no suministrado con el kit) para eluir el ARN total. 12. Eluir el ARN en l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante Eluir el ARN con otros l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante 1

7 3.6 Protocolo de extracción de ARN total a partir de levaduras Nota: Se recomienda no utilizar más de 10 7 células de levadura o 1ml de cultivo. Preparar una cantidad apropiada de Tampón de Resuspensión que contenga liticasa : 50mM tris, ph 7.5, 10 mm EDTA, 1M Sorbitol, 0.10 % -mercaptoetanol y 1 unidad / l de liticasa. Esta solución debería prepararse con reactivos estériles y libres de RNAsas y mantenida en hielo hasta ser utilizada. 1. Pellet las levaduras por centrifugación (aprox rpm) durante 1 2. Eliminar el sobrenadante y resuspender por vortex el pellet en 100 l del Tampón de Resuspensión con la cantidad apropiada de liticasa.incubar a 37ºC durante 10 minutos. 3. Añadir 300 l de Tampón de Lisis RNA y vortex durante 15 segundos. Asegurarse que todo el pellet está disuelto antes de proceder con el siguiente paso 4. Reducir la viscosidad y limpiar el lisado por filtración a través de una columna de filtración. Colocar la 5. Añadir 400 l de Etanol 70 % al filtrado resultante del paso 4 y mezclar por vortex o pipeteo. Después de precipitado en la columna. Si después del paso 4 el volumen del lisado es menor de 400 l, añadir 1 6. Coger una columna de unión ARN más su tubo de recolección y añadir el lisado. Centrifugar a x g ( rpm)durante 60 segundos. Colocar la columna en un nuevo tubo de recolección.la capacidad máxima de la columna es de 750 l. Repetir el proceso si mayores volúmenes son utilizados 7. Añadir 400 l de Tampón de RW1 y centrifugar a máxima velocidad( x g) durante 1 8. Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante º Lavado: Añadir 500 l de Tampón de Lavado y centrifugar a máxima velocidad( x g) durante Centrifugar durante 3 minutos adicionales para eliminar todo el etanol residual. Eliminar el tubo de 11. Colocar la columna en un microtubo nuevo de 1.5 ml ( no suministrado con el kit) para eluir el ARN total. 12. Eluir el ARN en l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante Eluir el ARN con otros l de Agua libre de Nucleasas (suministrada).incubar 2 minutos y centrifugar a máxima velocidad ( x g) durante 1 4. GUIA DE PROBLEMAS Y SOLUCIONES Dado el amplio número de muestras que pueden ser tratadas para extraer ARN total utilizando este kit, es difícil hacer una generalización de problemas, recomendamos ponerse en contacto con el servicio técnico de DANAGEN- BIOTED para cualquier consulta adicional respecto a los protocolos de trabajo o problemas que puedan surgir durante el trabajo.

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles


AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

MANUAL Kit S QuickGene de extracción de ARN en Células en Cultivo (RC-S)

MANUAL Kit S QuickGene de extracción de ARN en Células en Cultivo (RC-S) MANUAL Kit S QuickGene de extracción de ARN en Células en Cultivo (RC-S) Para aislamiento de ARN total de muestras en células en cultivo 1 ÍNDICE 1 Introducción...3 2 Componentes del kit...3 3 Condiciones

Más detalles



Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido Guía Práctica 9 Micelio de hongos Producción de micelio en medio líquido para extracción de ADN Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles


DANAGENE BLOOD DNA KIT Ref. 0601 100 ml Ref. 0602 200 ml DANAGENE BLOOD DNA KIT 1.INTRODUCCION DANAGENE BLOOD DNA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de sangre total o médula ósea.

Más detalles


1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS. Página 1 de 5 CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain.

Más detalles



Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles


INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles



Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles


REAL TOTAL RNA FROM BACTERIA AND YEAST KIT REAL TOTAL RNA FROM BACTERIA AND YEAST KIT Ref. 1. INTRODUCCIÓN 1. INTRODUCTION Este kit permite la obtención de ARN total a partir de diferentes cultivos de bacterias y levaduras, sin la utilización de

Más detalles



Más detalles

Documentos de la Red Nacional de Biobancos. Guía de protocolos utilizados para la obtención de ácidos nucléicos en biobancos

Documentos de la Red Nacional de Biobancos. Guía de protocolos utilizados para la obtención de ácidos nucléicos en biobancos Documentos de la Red Nacional de Biobancos Guía de protocolos utilizados para la obtención de ácidos nucléicos en biobancos Septiembre 2012 Este documento ha sido elaborado con la participación de las

Más detalles

Extracción de DNA por el Método Adaptado de Drábek.

Extracción de DNA por el Método Adaptado de Drábek. Extracción de DNA por el Método Adaptado de Drábek. El aislamiento de DNA constituye un paso esencial para la realización de estudios de tamizaje genético, análisis de polimorfismos genéticos, estudios

Más detalles


EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS Los hongos poseen un genoma complejo consistente en: ADN nuclear (n ADN) ADN mitocondrial (mt ADN) en algunos casos ADN plasmídico EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles



Más detalles

Hibridación In Situ en secciones gruesas de vibratomo

Hibridación In Situ en secciones gruesas de vibratomo Hibridación In Situ en secciones gruesas de vibratomo (Vicente Herranz Pérez, Unitat de Genetica Molecular, IBV) (Se va trabajar con ARN, por lo que se ha de ser muy estricto y cuidadoso para evitar las

Más detalles

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua destilada utilizando Dióxido de Titanio dopado con Nitrógeno,

Más detalles


REAL TOTAL RNA SPIN BLOOD KIT REAL TOTAL RNA SPIN BLOOD KIT Ref. 50 Preps. 1. INTRODUCCIÓN 1. INTRODUCTION Sistema de producción certificado bajo norma ISO Este kit permite la obtención de ARN total libre de ADN directamente de sangre

Más detalles

Purificación de RNA IG 2010

Purificación de RNA IG 2010 Purificación de RNA IG 2010 1 Purificación de RNA Para qué sirve? Cómo se trabaja con RNA? Pasos generales: Homogeneizar células Purificar el RNA (total o no total, ej mrna) Cuantificar el RNA purificado

Más detalles

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación.

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación. 23 de agosto 2007 Se comenzó la elaboración de la bitácora Medio LB Broth, Billar (Luria-Bertani) 25gr/litro Se preparó 500 mililitros agregando 12.5 gramos Se diluyó y esterilizó por autoclave Medio LB

Más detalles


CROMATOGRAFÍA DE FILTRACIÓN EN GEL 1.- FUNDAMENTO TEÓRICO CROMATOGRAFÍA DE FILTRACIÓN EN GEL Filtración en gel - 1 (Farmacia) La cromatografía de exclusión o filtración en gel es una clase de cromatografía sólido-líquido que permite la

Más detalles


DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles


DANAGENE GENOMIC DNA KIT Ref. 0603.1 Ref. 0603.2 Ref. 0603.3 DANAGENE GENOMIC DNA KIT 1.INTRODUCCION 1.1 Descripción del producto Este kit está designado para la extracción de ADN genómico de alta calidad a partir de una amplia

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

Extracción y purificación de los ácidos nucleicos

Extracción y purificación de los ácidos nucleicos Extracción y purificación de los ácidos nucleicos Todos los tipos de macromoléculas biológicas tienen una característica en común que va a permitir el desarrollo de un método de separación especifico para

Más detalles

Mezclado y Combinado. Molienda y Pulverizado. Tejido Homogeneización Lisis de la Célula. Agitación Vertical Única

Mezclado y Combinado. Molienda y Pulverizado. Tejido Homogeneización Lisis de la Célula. Agitación Vertical Única Mezclado y Combinado Molienda y Pulverizado Tejido Homogeneización Lisis de la Célula Agitación Vertical Única Manipulación de Múltiples muestras desde 96 pocillos hasta tubos para centrífuga de 50 ml

Más detalles

METODOLOGIA. A. Colección de muestras de agua:

METODOLOGIA. A. Colección de muestras de agua: CUARTA PARTE BIOMASA FOTOTROFOS: CLOROFILAS LA BIOMASA DE FITOPLANCTON puede ser estimada determinando la concentración de pigmentos fotosintéticos en una muestra de agua. Midiendo la concentración de

Más detalles

Biología Celular y Molecular. Guía de TP Nro. 2. Mantenimiento de líneas celulares.

Biología Celular y Molecular. Guía de TP Nro. 2. Mantenimiento de líneas celulares. Biología Celular y Molecular. Guía de TP Nro. 2 Mantenimiento de líneas celulares. Introducción Una de las formas de crecimiento in vitro es el cultivo en monocapa. Cuando las células requieren la adhesión

Más detalles


TEMA 6. PURIFICACIÓN DE PROTEÍNAS TEMA 6. PURIFICACIÓN DE PROTEÍNAS 1. Introducción 2. Métodos de rotura celular y extracción de proteínas 3. Métodos cromatográficos 4. Métodos electroforéticos 1. Introducción La mayor parte de las investigaciones

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles



Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles



Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles


REAL TOTAL RNA FROM TISSUES AND CELLS STAR KIT 10/10 RBMER02 REAL TOTAL RNA FROM TISSUES AND CELLS STAR KIT Ref. RBMER02 1. INTRODUCCIÓN 1. INTRODUCTION Este kit permite la obtención de ARN total a partir de muestras de tejidos y células, sin la utilización

Más detalles

FTA-1 Aspirador con soporte para frascos

FTA-1 Aspirador con soporte para frascos FTA-1 Aspirador con soporte para frascos Manual de funcionamiento Certificado para la versión V.4AW Contenidos 1. Precauciones de seguridad 2. Información general 3. Cómo empezar 4. Funcionamiento 5. Especificaciones

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Guías Didácticas para el desarrollo de experimentos

Guías Didácticas para el desarrollo de experimentos Guías Didácticas para el desarrollo de experimentos 1) Obtención y cuantificación de tu propio ADN El ácido desoxirribonucleico, abreviado como ADN, es un tipo de ácido nucleico, una molécula que forma

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles


TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos I. INTRODUCCION Para poder llevar a cabo una fermentación con éxito es imprescindible y obligatorio tener en todas las etapas cultivos libres de contaminantes,

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles



Más detalles

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo ANEXO I Inmunofenotipificación Celular por Citometría de Flujo Reactivos Anticuerpos monoclonales fluoromarcados (BD Bioscience Pharmingen) Medio DMEM con 0.02% de azida de sodio Paraformaldehido (PFA)

Más detalles



Más detalles


EXTRACCIÓN DE ADN (2) EXTRACCIÓN DE ADN (2) PROCEDIMIENTO BÁSICO Muchos estudios de Biología Molecular comienzan con la extracción de ácidos nucleicos. La lisis celular libera las moléculas en una fase acuosa que es separada

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles



Más detalles

Quinta parte. Las herramientas moleculares

Quinta parte. Las herramientas moleculares Quinta parte Las herramientas moleculares Extracción de ácidos nucleotidos 499 Capítulo 16 Extracción de ácidos nucleicos Luisa I. Falcón y Aldo Valera Los ácidos desoxiribonucleico (ADN) y ribonucleico

Más detalles


1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles


EXTRACCIÓN DE ADN (3) EXTRACCIÓN DE ADN (3) PROCEDIMIENTO BÁSICO PARA FUENTES ALTERNATIVAS Muchos estudios de Biología Molecular comienzan con la extracción de ácidos nucleicos. La lisis celular libera las moléculas en una

Más detalles


ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

Protocolo de Fertilización in vitro

Protocolo de Fertilización in vitro Protocolo de Fertilización in vitro modificado del protocolo del laboratorio de P. J. Hansen http://www.animal.ufl.edu/hansen/ivf/default.htm Adriana Fernandez Instituto de Reproducción Animal e Inseminación

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La prueba de Demanda Química de Oxígeno (DQO) se basa en la oxidación química de la materia orgánica e inorgánica, presente en las muestras de agua, con dicromato de potasio

Más detalles


OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles

RapidFinder STEC Detection Workflow

RapidFinder STEC Detection Workflow QUICK REFERENCE RapidFinder STEC Detection Workflow Aislamiento automático de ADN y detección de la PCR en tiempo real de E. coli O157:H7 y cepas "Big 6" de STEC no O157 Número de catálogo 4480466, 4428176,

Más detalles



Más detalles

Proyecto Fin de Carrera

Proyecto Fin de Carrera Proyecto Fin de Carrera DESARROLLO DE PROTOCOLO DE CONFINAMIENTO DE HIDROGELES PARA CULTIVO CELULAR 3D EN SISTEMAS MICROFLUÍDICOS Marco Alejandro Moreno Mínguez Director: José María Ayuso Ponente: Luis

Más detalles



Más detalles


REAL MINIPREP TURBO KIT REAL MINIPREP TURBO KIT Ref. 500 Preps. 1. INTRODUCCIÓN 1. INTRODUCTION Este kit provee un método para una rápida, sencilla y eficiente extracción de DNA plasmídico a partir de cultivos de E.coli de 1.5-3.0

Más detalles


DNA IQ Casework Pro Kit for Maxwell 16 INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS AS1240 Y DC6745. Technical Manual DNA IQ Casework Pro Kit for Maxwell 16 INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS AS1240 Y DC6745. IMPRESO EN ESTADOS UNIDOS. Revisado el 11/11 DNA IQ Casework Pro Kit for Maxwell 16 Toda

Más detalles



Más detalles

37. Purificación de ácidos nucleicos

37. Purificación de ácidos nucleicos 37. Purificación de ácidos nucleicos Mª José Prieto Álamo, Juan López Barea, Carmen Pueyo de la Cuesta Departamento de Bioquímica y Biología Molecular, Campus Universitario de Rabanales, Edificio Severo

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles


SOLUBILIDAD DE LAS PROTEINAS: EFECTO DE LA FUERZA IONICA SOLUBILIDAD DE LAS PROTEINAS: EFECTO DE LA FUERZA IONICA La solubilidad de una proteína está influenciada por los siguientes factores: (a) su composición en aminoácidos (una proteína rica en aminoácidos

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

Preparación de medios de cultivo

Preparación de medios de cultivo Objetivos Preparación de medios de cultivo Curso: Métodos en fitopatología 24 de abril de 2009 Dr. Pedro Mondino Conocer a que denominamos medio de cultivo en el laboratorio de Fitopatología. Reconocer

Más detalles


CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

Cómo llevar a cabo una reacción química desde el punto de vista experimental

Cómo llevar a cabo una reacción química desde el punto de vista experimental Cómo llevar a cabo una reacción química desde el punto de vista experimental Para obtener un compuesto se pueden utilizar varias técnicas, que incluyen el aislamiento y la purificación del mismo. Pero

Más detalles


INTERFERÓN BETA-1A BIOFARMACO, SOLUCIÓN CONCENTRADA MONOGRAFÍA NUEVA Con fundamento en el numeral 4.11.1 de la Norma Oficial Mexicana NOM-001-SSA1-2010, se publica el presente proyecto a efecto de que los interesados, a partir del 1º de agosto y hasta el

Más detalles

Experimento con reactivos de la vida cotidiana!

Experimento con reactivos de la vida cotidiana! Experimento con reactivos de la vida cotidiana Laura Martínez Martín- 1º Grado Genética - UAB Abril de 2015 1 Índice Introducción 3 Objetivos 3 Material. 3 Procedimiento 4 Explicaciones científicas del

Más detalles


LABNOVA DISTRIBUCIONES, S.L. Productos químicos de uso alimentario. Análisis instrumental. Consumibles para técnicas instrumentales. Papel de filtro para laboratorio. Membranas filtrantes. Sistemas de filtración. Fungible para biología

Más detalles

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 249 794 1 Int. Cl. 7 : C12N 9/02 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9766.6 86 Fecha de presentación

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

Medidas de Seguridad Biológica en la Preparación de Componente Sanguíneo: Colirio de Suero Autólogo

Medidas de Seguridad Biológica en la Preparación de Componente Sanguíneo: Colirio de Suero Autólogo Medidas de Seguridad Biológica en la Preparación de Componente Sanguíneo: Colirio de Suero Autólogo Centro de Transfusión Sanguínea de Jaén Servicio Andaluz de Salud Introducción El objetivo del Centro

Más detalles

Instrucciones de Uso GenDx SBTexcellerator

Instrucciones de Uso GenDx SBTexcellerator Octavo Edición Julio de 2011 Instrucciones de Uso GenDx SBTexcellerator Para Tipificación Basada en Secuenciación de HLA de alta resolución Genome Diagnostics B.V. Teléfono: +31 302 523 799 Correo electrónico:

Más detalles


V MATERIALES Y MÉTODOS V MATERIALES Y MÉTODOS 5.1 Aislamiento de bacterias e identificación 5.1.1 Cepas tomadas del cepario de la Universidad de las Américas-Puebla En el cepario del Departamento de Química y Biología hay algunas

Más detalles



Más detalles


LABORATORIO NACIONAL DE VIALIDAD HORNO IGNICION Y CENTRIFUGA LABORATORIO NACIONAL DE VIALIDAD HORNO IGNICION Y CENTRIFUGA Rodrigo Uribe Olivares Jefe Área de Asfalto Curso de Capacitación 8 Junio 2015 a).- Ensaye: Extracción 8.302.36 (LNV 11) : Método para determinar

Más detalles



Más detalles



Más detalles


ÁCIDO L-ASCÓRBICO (L-ASCORBATO) ÁCIDO L-ASCÓRBICO (L-ASCORBATO) PROCEDIMIENTO DE ENSAYO K-ASCO 11/05 (40 Ensayos por Kit) Este folleto se puede conseguir en www.megazyme.com en los siguientes idiomas: Inglés-Francés-Alemán-Italiano-Portugués

Más detalles



Más detalles

Prueba experimental intercolegial 24 de junio de 2011

Prueba experimental intercolegial 24 de junio de 2011 Prueba experimental intercolegial 24 de junio de 2011 Nombre y Apellido DNI Fecha de nacimiento Escuela Provincia Nombre y Apellido DNI Fecha de nacimiento Escuela Provincia No completar LEE ATENTAMENTE!

Más detalles

ADN y RNA caracterización y métodos de estudio

ADN y RNA caracterización y métodos de estudio ADN y RNA caracterización y métodos de estudio Separación por centrifugación de equilibrio en gradiente de densidad de en CsCl Separación por centrifugación de equilibrio en gradiente de densidad de en

Más detalles

y desinfección. Medios de cultivo. Objetivos Métodos de esterilización Definiciones Calor seco Calor seco MECÁNICOS FISICOS: QUIMICOS

y desinfección. Medios de cultivo. Objetivos Métodos de esterilización Definiciones Calor seco Calor seco MECÁNICOS FISICOS: QUIMICOS Métodos de esterilización y desinfección. n. Medios de cultivo. Curso: Diagnósticos en Fitopatología 17 de setiembre de 2015 Ing. Agr. MSc. Vivienne Gepp Objetivos Familiarizarse con los procesos de desinfección

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles