1. OBJETO DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE MATERIALES Y REACTIVOS.

Tamaño: px
Comenzar la demostración a partir de la página:

Download "1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS."

Transcripción

1 Página 1 de 5 CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain. Contacto Dr. Carmina Gallardo Virginia Pelayo CONTENIDO 1. OBJETO. 2. ALCANCE. 3. REFERENCIAS DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 4. GENERALIDADES. 5. REALIZACIÓN MATERIALES Y REACTIVOS. PNT CISA/PPA/ EXTRACCIÓN ADN /1 PROCEDIMIENTO NORMALIZADO DE TRABAJO PARA LA EXTRACCIÓN DEL ADN DEL VIRUS DE LA PESTE PORCINA AFRICANA PARA SU DETECCIÓN MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) 5.2. PREPARACIÓN REALIZACIÓN DE LA TÉCNICA. 5.4 PUNTOS CRÍTICOS 5.5 MEDIDAS DE SEGURIDAD.

2 Página 2 de 5 1. OBJETO. El objeto del presente procedimiento es describir el método a seguir para la extracción específica de ADN del virus de la peste porcina africana (VPPA) en material clínico utilizando el kit de extracción de ácidos nucleicos High Pure PCR Template Preparation Kit [Ref (ROCHE)] para su posterior amplificación mediante la técnica de PCR. Esta técnica se encuentra incluida en el Manual de la OIE (capítulo del Manual de las Pruebas de Diagnóstico y de las Vacunas para los Animales Terrestres de la edición del 2012). 2. ALCANCE. Este procedimiento es de aplicación a los siguientes tipos de muestras de origen porcino; suero, sangre (con EDTA) y homogeneizados de tejidos. También se palica a homogeneizados de garrapatas género Ornithodoros. Se recomienda, en el caso de muestras de sangre-edta, analizarlas siempre sin diluir, y, en el caso de homogeneizados de tejidos, analizarlos por duplicado sin diluir y en una dilución 1/ REFERENCIAS DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 1. AFRICAN SWINE FEVER. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (mammals, birds and bees). CHAPTER OIE, 2012 [http://www.oie.int/fileadmin/home/eng/health_standards/tahm/ _asf.pdf] 2. Protocol High Pure PCR Template Preparation Kit: Commercial nucleic acid ROCHE [http://www.roche-applied-science.com/proddata/gpip/3_6_8_48_1_1.html] 3. Agüero M, Fernández J, Romero LJ, Zamora MJ, Sánchez C, Belák S, Arias M, Sánchez-Vizcaíno JM. A highly sensitive and specific gel-based multiplex RT-PCR assay for the simultaneous and differential diagnosis of African swine fever and Classical swine fever in clinical samples. Vet Res Sep-Oct;35(5): M. Agüero, J. Fernández, L. Romero, C. Sánchez, M. Arias, J.M. Sánchez-Vizcaíno Highly Sensitive PCR Assay for Routine Diagnosis of African Swine Fever Virus in Clinical Samples. J. Clin. Microbiol., vol. 41, no. 9, p PPA REVISIONES: 1. Arias, M., Sánchez-Vizcaíno, J.M. (2012). African swine fever. In: Zimmerman, J., Karriker, L.A., Ramirez, A., Schwartz, K.J, Stevenson, G.W. (Eds), Diseases of swine, 10th Edition. John Wiley and Sons, United States of America, pp Arias, M.; Sánchez, C.; González, M.A.; Carrasco, L. y Sánchez-Vizcaíno, J.M. (2002). Peste porcina Africana In Curso digital de enfermedades infecciosas porcinas. [http://www.sanidadanimal.info/cursos/curso/7/7-ppa.htm] on line, July, Food and Agriculture Organization of the United Nations (FAO). RECOGNIZING AFRICAN SWINE FEVER. A FIELD MANUAL Edition. [ DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. PREPARACIÓN DE MUESTRAS PARA EL DIAGNÓSTICO DE LA PESTE PORCINA AFRICANA (PNT/CISA/PPA/MUESTRAS/1). DETECCIÓN DEL GENOMA DEL VIRUS DE LA PESTE PORCINA AFRICANA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL (PNT/CISA/PPA/PCR/1) DETECCIÓN DEL GENOMA DEL VIRUS DE LA PESTE PORCINA AFRICANA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) EN TIEMPO REAL (PNT/CISA/PPA/PCR/2) 4. GENERALIDADES ABREVIATURAS. ADN: ácido desoxirribonucleico. E+: Control positivo de extracción.

3 Página 3 de 5 E-: Control negativo de extracción. PPA: Peste Porcina Africana. PCR: Reacción en cadena de la polimerasa. r.p.m.: revoluciones por minuto. VPPA: Virus de la peste porcina africana 4.2. PRINCIPIO. El proceso de extracción de ácidos nucleicos utilizando el kit comercial High Pure PCR Template Preparation Kit se basa en la adsorción y desorción de los ácidos nucleicos en presencia de sales caotrópicas. Las células son inicialmente lisadas durante una corta incubación con proteinasa K en presencia de una sal caotrópica (HCl-guanidina), que inmediatamente inactiva todas las nucleasas. Los ácidos nucleicos se unen o adsorben selectivamente al filtro de fibra de vidrio (sílica) en un tubo de centrífuga especial. Los ácidos nucleicos permanecen unidos al filtro durante los siguientes pasos de lavado y centrifugado, donde se eliminan las moléculas celulares contaminantes, sales y proteínas. Posteriormente, los ácidos nucleicos se eluyen de la membrana de sílica mediante tampones de elución con baja concentración de sales (ligeramente alcalinos) o simplemente agua, ya que permiten recuperar la capa hidratante de los ácidos nucleicos, liberándolos así de la membrana. 5. REALIZACIÓN MATERIALES Y REACTIVOS. MATERIAL Congelador de <-10ºC. Congelador -70ºC. Gradillas tubos eppendorff od e características similares. Microcentrífuga de mesa. Micropipetas automáticas monocanal de 1-10 µl. Micropipetas automáticas monocanal de µl. Micropipetas automáticas monocanal de µl. Nevera de 4±3ºC. Papel absorbente. phmetro (0,01 UpH). Pipeteador automático Pipetboy acu o equivalente. Pipetas de vidrio o plástico, estériles, para descargar 1-25 ml. Puntas de micropipeta con filtros resistentes a aerosoles de rangos 1 10, 2-20, y µl, estériles. Puntas de pipetas desechables de 1-20, and l. Reloj cronómetro. Tubos eppendorf (o equivalentes) de 0,5 ml, 1,5 ml y 2 ml. Termobloque (72±2ºC). Vórtex. REACTIVOS INCLUIDOS EN EL KIT: Conservación: temperatura ambiente. Binding Buffer (20 ml) [6 M guaninidina HCl, 10 mm urea, 10 mm Tris-HCl, 20% Triton X-100 (v/v), ph 4,4]. Proteinase K, recombinant PCR grade 20 mg/ml (liofilizada). Inhibitor Removal Buffer (33 ml) [5 M guanidine-hcl, 20 mm Tris-HCl, ph 6.6]. Wash Buffer (20 ml) [20 mm NaCl, 2 mm Tris-HCl, ph 7.5]. High Pure Filter Tubes: 2 bolsas con 50 tubos de polipropileno con dos capas de lana de fibra de vidrio hasta 700ml de volumen de muestra. Collection Tubes: 2 bolsas con 50 tubos de polipropileno (2ml) REACTIVOS NO INCLUIDOS EN EL KIT: Etanol absoluto [Ref.: (Merck) o características similares]. H 2 O destilada grado de PCR. Isopropanol ( 99%) [Ref.: I9516 (Sigma) or o características similares]. Controles del proceso de extracción: E+ Muestra positiva al VPPA empleada como control positivo durante el proceso de extracción del ADN: muestra positiva

4 Página 4 de 5 (suero,sangre con EDTA, tejido homogeneizado en dilución 1/10 o sobrenadante de cultivo) diluidos en muestra negativa. Es recomendable que el positivo de extracción se encuentre en el límite de detección de la técnica para asegurar el rendimiento del proceso de extracción del ADN. Conservar a <-10ºC en alicuotas. Fecha de caducidad: 6 meses E- Muestra negativa utilizada como control negativo en el proceso de extracción: Agua destilada grado PCR incluida en proceso de extracción para excluir posibles contaminaciones 5.2. PREPARACIÓN PREPARACIÓN DE LAS MUESTRAS. La preparación de las muestras a analizar se realizará según se describe en el procedimiento de preparación de muestras para el diagnóstico de la peste porcina africana [PNT/CISA/PPA/MUESTRAS/1] PREPARACIÓN DE LOS REACTIVOS: Proteinasa K liofilizada: resuspender la proteinasa K en 4,5 ml de agua destilada estéril y alicuotar en volúmenes de 500 l. Conservación: <-10ºC hasta su uso. Inhibitor Removal Buffer: añadir 20 ml de etanol absoluto al vial original. Etiquetar y marcar la fecha en la botella. Conservar a temperatura ambiente Wash Buffer: añadir 80 ml de etanol absoluto al vial original. Etiquetar y marcar la fecha en la botella. Conservar a temperatura ambiente REALIZACIÓN DE LA TÉCNICA. 1. Pipetear 200 l de Binding Buffer y 40 l de Proteinasa K en un tubo de microcentrífuga de 1,5ml. 2. Añadir 200 l de muestra. Incluir en cada proceso de extracción E+ y E- (200 l H 2 O). 3. Mezclar invirtiendo los tubos e incubar 10 min a 72±2ºC. Centrifugar unos segundos, un pulso de centrífuga, para eliminar restos de muestra en la tapa. 4. Añadir 100 l de isopropanol. 5. Mezclar agitando en vórtex. Centrifugar unos segundos, un pulso de centrífuga, para eliminar restos de muestra en la tapa. 6. Pasar la mezcla al High Pure filter tube colocado sobre un tubo colector. Centrifugar 1 min a g (con muestras de sangre, repetir el paso de centrifugación si queda muestra sobre el filtro). 7. Descartar el tubo colector y colocar el tubo columna sobre un nuevo tubo colector 8. Añadir 500 l Inhibitor Removal Buffer. Centrifugar 1 min a g. 9. Descartar el tubo colector y colocar el tubo columna sobre un nuevo tubo colector. 10. Añadir 450 l de Wash Buffer. Centrifugar 1 min a g. 11. Descartar el tubo colector y colocar el tubo columna sobre un nuevo tubo colector. 12. Repetir el paso de lavado. 13. Centrifugar sobre un tubo vacío a g 10 seg. 14. Colocar la columna sobre un tubo de 1,5 ml con tapa. 15. Añadir 50 l de agua destilada estéril, precalentada a 72±2ºC, asegurando que cubre totalmente el filtro. Centrifugar 1 min a g. 16. Recoger el eluido conteniendo el ADN y guardar a <-10ºC hasta su uso (fecha de caducidad: 12 meses) o a 4±3ºC si se va a emplear en 1-2 h desde su obtención.

5 Página 5 de PUNTOS CRÍTICOS 5.5. MEDIDAS DE SEGURIDAD. El punto crítico durante todo el proceso de análisis es el riesgo de contaminación de las muestras y, por tanto, los posibles falsos positivos que en este caso se obtendrían. La contaminación puede deberse al propio VPPA presente en las muestras que puedan ser positivas o en los controles positivos empleados en el proceso de extracción. Por ello, es imprescindible seguir y cumplir unas estrictas normas de trabajo para minimizar el riesgo de contaminación intrínseco a la técnica de PCR: Todos los pasos que implican el análisis de muestras por PCR se realizarán en espacios diferenciados, con equipamiento y material específicos para cada uno: preparación de muestras, extracción de ADN, montaje de mezcla de PCR, análisis por electroforesis de los productos de PCR. Trabajar siempre con guantes de látex o nitrilo limpios en el laboratorio de PCR. Cada vez que el técnico que esté realizando el análisis acceda a una zona de PCR diferente, deberá cambiarse los guantes desechando los que tenía puestos. El material será de uso exclusivo para el paso del procedimiento para el que esté destinado por su situación/identificación. Utilizar una punta de pipeta diferente cada vez que se pipetee en un tubo conteniendo alguna muestra o ADN. Leer y seguir cuidadosamente el protocolo. Conservar los reactivos a la temperatura indicada antes y después de su utilización. No mezclar reactivos ni instrucciones de diferentes kits. Evitar cualquier contaminación de los reactivos. No utilizar los reactivos una vez superada la fecha de caducidad. No comer, beber ni fumar en el laboratorio. No pipetear los reactivos con la boca. Utilizar siempre guantes de látex o nitrilo. El Binding Buffer, el Inhibitor Removal Buffer y el Wash Buffer incluidos en el kit de extracción de ADN contienen derivados de guanidina que son irritantes, por lo que deben ser manipulados con precaución. En caso de contacto con piel, mucosas y/u ojos, lavar inmediatamente con agua abundante. Si ocurre un vertido accidental, diluir con agua antes de limpia

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO.

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO. Página 1 de 7 CONTENIDO CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130,

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

1. OBJETO. 2. ALCANCE. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS.

1. OBJETO. 2. ALCANCE. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS. Página 1 de 9 1. OBJETO. CONTENIDO CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos

Más detalles

1. OBJETO. 2. ALCANCE. 3. REFERENCIAS. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE.

1. OBJETO. 2. ALCANCE. 3. REFERENCIAS. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. Página 1 de 9 CONTENIDO CENTRO DE INVESTIGACIÓN EN SANIDAD ANIMAL (CISA-INIA) European Union Reference Laboratory for ASF, (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130,

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

SANIDAD ANIMAL (CISA INIA)

SANIDAD ANIMAL (CISA INIA) Hoja 1 de 10 CENTRO DE PROCEDIMIENTO PARA LA DETECCIÓN DEL VIRUS DE LA PESTE PORCINA AFRICANA (VPPA) MEDIANTE REACCIÓN EN CADENA DE LA Fecha de entrada en vigor: Diciembre 2008 REV. FECHA EPÍGRAFE/S CAUSA

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido Guía Práctica 9 Micelio de hongos Producción de micelio en medio líquido para extracción de ADN Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 -

CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 - CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 - CLART ENTHERPEX Extracción 24 determinaciones Ref: AT-0908-24 48 determinaciones

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA)

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Extracción de DNA por el Método Adaptado de Drábek.

Extracción de DNA por el Método Adaptado de Drábek. Extracción de DNA por el Método Adaptado de Drábek. El aislamiento de DNA constituye un paso esencial para la realización de estudios de tamizaje genético, análisis de polimorfismos genéticos, estudios

Más detalles

Mercodia Ultrasensitive C-peptide ELISA

Mercodia Ultrasensitive C-peptide ELISA Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso 10-1141-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La prueba de Demanda Química de Oxígeno (DQO) se basa en la oxidación química de la materia orgánica e inorgánica, presente en las muestras de agua, con dicromato de potasio

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

INTRODUCCIÓN AL CULTIVO CELULAR

INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

SUIDAE PESTE PORCINA AFRICANA

SUIDAE PESTE PORCINA AFRICANA SECCIÓN 2.8. SUIDAE CAPÍTULO 2.8.1. PESTE PORCINA AFRICANA RESUMEN La peste porcina africana (PPA) es una enfermedad infecciosa de los cerdos domésticos y salvajes de todas las razas y edades causada por

Más detalles

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS Ref. 4755 2014/04 CALIBRADORES Hb A1c CAPILAR Aplicación Los Calibradores Hb A1c CAPILAR están destinados a la calibración y al control de migración

Más detalles

FICHA DE DATOS DE SEGURIDAD (MSDS) KIT CLART CMA KRAS BRAF PI3K

FICHA DE DATOS DE SEGURIDAD (MSDS) KIT CLART CMA KRAS BRAF PI3K 1. Identificación de la sustancia y proveedor Nombre comercial CLART CMA KRAS BRAF PI3K Referencias: Amplificación KRAS 8 determinaciones Ref.: CS-0412-8 24 determinaciones Ref.: CS-0412-24 Amplificación

Más detalles

Guías Didácticas para el desarrollo de experimentos

Guías Didácticas para el desarrollo de experimentos Guías Didácticas para el desarrollo de experimentos 1) Obtención y cuantificación de tu propio ADN El ácido desoxirribonucleico, abreviado como ADN, es un tipo de ácido nucleico, una molécula que forma

Más detalles

EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS

EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS Los hongos poseen un genoma complejo consistente en: ADN nuclear (n ADN) ADN mitocondrial (mt ADN) en algunos casos ADN plasmídico EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS

Más detalles

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA.

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. El estudio INMA lleva asociado la toma de una serie de muestras biológicas según el momento o fase del estudio. Coincidiendo con el parto se recoge una muestra

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

FICHA DE DATOS DE SEGURIDAD (MSDS) CLART SeptiBac +

FICHA DE DATOS DE SEGURIDAD (MSDS) CLART SeptiBac + Página 1 de 5 1. Identificación de la sustancia y proveedor Nombre comercial CLART SeptiBac + Referencias: Amplificación 48 determinaciones Ref.: CS-0311-48 Detección 48 determinaciones Ref.: CS-0411-48

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 REF/ PROYECTO: PROMIS 2012 NÚMERO DE LOTES: UNICO Este pliego contempla la adquisición de un sistema

Más detalles

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN 25. Perfil lipídico Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 1 Departamento de Bioquímica y Biología Molecular, Avda. Menéndez Pidal s/n, 14071- Córdoba, 2 Campus de Rabanales, Edif. Severo Ochoa 14071-Córdoba

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

Servicio Prevención de Riesgos Laborales

Servicio Prevención de Riesgos Laborales NORMAS DE TRABAJO SEGURO. PREPARACIÓN DE CITOSTÁTICOS. Nº 15 (Art. 18 Ley 31/1995 de Prevención de Riesgos Laborales. Deber de información) Los riesgos más comunes para la seguridad y salud así como las

Más detalles

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE MURCIA 1 GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente.

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente. bioelisa HCV 4.0 3000-1115 LEER CAMBIOS SOMBREADOS 96 tests 3000-1116 480 tests Test de ELISA para la detección de anticuerpos contra el virus de la hepatitis C (HCV) en suero o plasma humano para ser

Más detalles

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Tel. 91 710 00 74 Fax 93 843 78 84 e-mail: info@biotools.eu www.biotools.eu BIOPAP Kit Kit para la detección

Más detalles

CLASIFICACIÓN Y GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS

CLASIFICACIÓN Y GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS CLASIFICACIÓN Y GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS La clasificación y gestión de los residuos tóxicos y peligrosos generados en CABIMER se realiza de acuerdo con la normativa vigente (Ley 10/1998,

Más detalles

MANUAL Kit S QuickGene de extracción de ARN en Células en Cultivo (RC-S)

MANUAL Kit S QuickGene de extracción de ARN en Células en Cultivo (RC-S) MANUAL Kit S QuickGene de extracción de ARN en Células en Cultivo (RC-S) Para aislamiento de ARN total de muestras en células en cultivo 1 ÍNDICE 1 Introducción...3 2 Componentes del kit...3 3 Condiciones

Más detalles

EXTRACCIÓN DE ADN (3)

EXTRACCIÓN DE ADN (3) EXTRACCIÓN DE ADN (3) PROCEDIMIENTO BÁSICO PARA FUENTES ALTERNATIVAS Muchos estudios de Biología Molecular comienzan con la extracción de ácidos nucleicos. La lisis celular libera las moléculas en una

Más detalles

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 28 de abril de 2009 Revisión 1 (30 de abril e 2009) El Centro Colaborador para la Influenza de la

Más detalles

OBTENCIÓN DE MUTANTES

OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles

Contenido. Bioseguridad Chile Ltda., Septiembre 2014i www.bioseguridadchile.cl nfo@bioseguridadchile.cl 1

Contenido. Bioseguridad Chile Ltda., Septiembre 2014i www.bioseguridadchile.cl nfo@bioseguridadchile.cl 1 Contenido Control de Infecciones, Recolección y Manejo de Muestras... 2 Recomendaciones para la evaluación de los riesgos para el personal... 2 Recomendaciones para la recogida de muestras por parte del

Más detalles

LABNOVA DISTRIBUCIONES, S.L.

LABNOVA DISTRIBUCIONES, S.L. Productos químicos de uso alimentario. Análisis instrumental. Consumibles para técnicas instrumentales. Papel de filtro para laboratorio. Membranas filtrantes. Sistemas de filtración. Fungible para biología

Más detalles

CROMATOGRAFÍA DE FILTRACIÓN EN GEL

CROMATOGRAFÍA DE FILTRACIÓN EN GEL 1.- FUNDAMENTO TEÓRICO CROMATOGRAFÍA DE FILTRACIÓN EN GEL Filtración en gel - 1 (Farmacia) La cromatografía de exclusión o filtración en gel es una clase de cromatografía sólido-líquido que permite la

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

RapidFinder STEC Detection Workflow

RapidFinder STEC Detection Workflow QUICK REFERENCE RapidFinder STEC Detection Workflow Aislamiento automático de ADN y detección de la PCR en tiempo real de E. coli O157:H7 y cepas "Big 6" de STEC no O157 Número de catálogo 4480466, 4428176,

Más detalles

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems INDICE I. Introducción II. Objetivo General del Manual III. Políticas de

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

PRINCIPIO DE LA PRUEBA: USO PREVISTO:

PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

Laboratorio General de Química I. Indicadores ácido-base en disoluciones amortiguadoras

Laboratorio General de Química I. Indicadores ácido-base en disoluciones amortiguadoras Laboratorio General de Química I Indicadores ácido-base en disoluciones amortiguadoras 1. OBJETIVOS: Extracción de un indicador natural de ph a partir de la col lombarda y elaboración de disoluciones amortiguadoras

Más detalles

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 Instrucciones de uso Wipe test Control de Contaminación Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 40 Reacciones 1. Descripción del Producto El uso de la

Más detalles

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD Artículo 1. Este Reglamento es complementario del Reglamento de Higiene y Seguridad de la Facultad de Química de la

Más detalles

Documentos de la Red Nacional de Biobancos. Guía de protocolos utilizados para la obtención de ácidos nucléicos en biobancos

Documentos de la Red Nacional de Biobancos. Guía de protocolos utilizados para la obtención de ácidos nucléicos en biobancos Documentos de la Red Nacional de Biobancos Guía de protocolos utilizados para la obtención de ácidos nucléicos en biobancos Septiembre 2012 Este documento ha sido elaborado con la participación de las

Más detalles

cobas EGFR Mutation Test v2

cobas EGFR Mutation Test v2 cobas EGFR Mutation Test Para diagnóstico in vitro cobas DNA Sample Preparation Kit 24 Tests P/N: 05985536190 cobas cfdna Sample Preparation Kit 24 Tests P/N: 07247737190 cobas EGFR Mutation Test 24 Tests

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

DETECCIÓN, CARACTERIZACIÓN Y TITULACIÓN DE ISOHEMAGLUTININAS

DETECCIÓN, CARACTERIZACIÓN Y TITULACIÓN DE ISOHEMAGLUTININAS Área de Inmunología. Prácticas de Inmunología Clínica Autor: Gonzalo Rubio Pedraza grubio@um.es DETECCIÓN, CARACTERIZACIÓN Y TITULACIÓN DE ISOHEMAGLUTININAS Al finalizar la práctica, el alumno debe ser

Más detalles

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx)

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

Hibridación In Situ en secciones gruesas de vibratomo

Hibridación In Situ en secciones gruesas de vibratomo Hibridación In Situ en secciones gruesas de vibratomo (Vicente Herranz Pérez, Unitat de Genetica Molecular, IBV) (Se va trabajar con ARN, por lo que se ha de ser muy estricto y cuidadoso para evitar las

Más detalles

BIOSEGURIDAD EN MICROBIOLOGIA: NUEVOS Y VIEJOS RETOS

BIOSEGURIDAD EN MICROBIOLOGIA: NUEVOS Y VIEJOS RETOS BIOSEGURIDAD EN MICROBIOLOGIA: NUEVOS Y VIEJOS RETOS JUAN CARLOS RODRÍGUEZ S. MICROBIOLOGÍA HOSPITAL GENERAL UNIVERSITARIO DE ALICANTE E-MAIL: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Laboratorio Biología Molecular: EPSH. Universidad de Zaragoza

Laboratorio Biología Molecular: EPSH. Universidad de Zaragoza GEL DE POLIACRILAMIDA A) Preparación del soporte del gel: Para hacer el gel se utilizan dos láminas de vidrio (cristal en "U" y cristal recto) unidas con cinta adhesiva. Estas láminas son diferentes, se

Más detalles

PNT/CISA/PPA/TIRAS-IB/1

PNT/CISA/PPA/TIRAS-IB/1 Revision 2013 Página 1 of 12 CENTRO DE INVESTIGACION EN (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain.

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La medición de nitratos en aguas residuales se hace en mg/l. El método es conocido usualmente con el nombre de Reducción de Cadmio, que es donde los iones de nitrito reaccionan

Más detalles

METODOLOGIA. A. Colección de muestras de agua:

METODOLOGIA. A. Colección de muestras de agua: CUARTA PARTE BIOMASA FOTOTROFOS: CLOROFILAS LA BIOMASA DE FITOPLANCTON puede ser estimada determinando la concentración de pigmentos fotosintéticos en una muestra de agua. Midiendo la concentración de

Más detalles

Extracción y purificación de los ácidos nucleicos

Extracción y purificación de los ácidos nucleicos Extracción y purificación de los ácidos nucleicos Todos los tipos de macromoléculas biológicas tienen una característica en común que va a permitir el desarrollo de un método de separación especifico para

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

ACTIVIDADES DE LABORATORIOS DE REFERENCIA

ACTIVIDADES DE LABORATORIOS DE REFERENCIA ACTIVIDADES DE LABORATORIOS DE REFERENCIA Madrid, 27 29 de junio de 2011 VALIDACIÓN DE TÉCNICAS ANALITICAS. TRANSFERENCIA A LOS LABORATORIOS REGIONALES. Elena San Miguel. Dpto. PCR LABORATORIO CENTRAL

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

CLART CMA KRAS BRAF PI3K

CLART CMA KRAS BRAF PI3K CLART CMA KRAS BRAF PI3K DETECCIÓN E IDENTIFICACIÓN GENÉTICA DE MUTACIONES PUNTUALES EN TRES DE LOS GENES PERTENECIENTES A LA RUTA DEL EGFR ASOCIADOS A CÁNCER COLORRECTAL KRAS, BRAF y PI3K- PARA DIAGNÓSTICO

Más detalles

RESOLUCIÓN OIV-OENO 521-2013 MÉTODO DE DETECCIÓN DE FTALATOS EN LAS BEBIDAS ESPIRITUOSAS POR CROMATOGRAFÍA DE GASES/ESPECTROMETRÍA DE MASAS

RESOLUCIÓN OIV-OENO 521-2013 MÉTODO DE DETECCIÓN DE FTALATOS EN LAS BEBIDAS ESPIRITUOSAS POR CROMATOGRAFÍA DE GASES/ESPECTROMETRÍA DE MASAS RESOLUCIÓN OIV-OENO 521-2013 MÉTODO DE DETECCIÓN DE FTALATOS EN LAS BEBIDAS ESPIRITUOSAS POR CROMATOGRAFÍA DE GASES/ESPECTROMETRÍA DE MASAS LA ASAMBLEA GENERAL, Visto el artículo 2 párrafo 2 iv del acuerdo

Más detalles

Procedimientos Sección Virus Respiratorios

Procedimientos Sección Virus Respiratorios 0 Página 1 de 23 ÍNDICE PROCEDIMIENTOS SECCIÓN VIRUS RESPIRATORIOS 1.- OBJETIVO 2 2.- CAMPO DE APLICACIÓN Y ALCANCE 2 3.- RECEPCIÓN DE MUESTRA 2 4.- DEFINICIONES 3 5.- FUNDAMENTOS 4 6.- MATERIALES, INSUMOS

Más detalles

NORMAS DE UTILIZACION Y CONSERVACION DE LOS DESINFECTANTES.

NORMAS DE UTILIZACION Y CONSERVACION DE LOS DESINFECTANTES. 1 NORMAS DE UTILIZACION Y CONSERVACION DE LOS DESINFECTANTES. Desinfectante: sustancia química que destruye los microorganismos y que se aplica sobre material inerte sin alterarlo de forma sensible. Niveles

Más detalles

Alimentación & Bebidas con Eppendorf

Alimentación & Bebidas con Eppendorf Alimentación & Bebidas con Eppendorf 27 de Noviembre, 2014 > Eppendorf Un resumen > Alimentos & Bebidas con Eppendorf > Importancia de los consumibles en el análisis alimentario > Ventajas de la automarización

Más detalles

Detección de IgE específica.

Detección de IgE específica. Detección de IgE específica. Una forma de identificar los alérgenos responsables de los síntomas alérgicos es la detección de anticuerpos IgE específicos frente a dichos alérgenos. Estos anticuerpos están

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles