es Abbott HBV Sequencing Abbott HBV Sequencing /R01 B3N033 3N03-90 Símbolos utilizados NOMBRE Abbott HBV Sequencing

Tamaño: px
Comenzar la demostración a partir de la página:

Download "es Abbott HBV Sequencing Abbott HBV Sequencing 49-8679/R01 B3N033 3N03-90 Símbolos utilizados NOMBRE Abbott HBV Sequencing"

Transcripción

1 Abbott HBV Sequencing Símbolos utilizados Fabricante Número de referencia Número de lote Producto sanitario para diagnóstico in vitro ATENCIÓN: maneje los materiales de origen humano como potencialmente infecciosos. Consulte las instrucciones de uso. (Riesgo de infección) Control positivo Control negativo Almacénese a una temperatura igual o inferior a 10 C Fecha de caducidad Consulte las instrucciones de uso Representante autorizado NOMBRE Abbott HBV Sequencing Finalidad de uso Abbott HBV Sequencing es un ensayo in vitro para realizar la secuenciación de DNA de la región de retrotranscriptasa (RT) del gen de la polimerasa (Pol) del virus de la hepatitis B (VHB). El propósito de este ensayo es ayudar en el manejo del tratamiento de pacientes con hepatitis B crónica. Resumen y explicación del ensayo Más de 400 millones de personas sufren una infección crónica por el VHB. El VHB es un virus pequeño, constituido por una molécula de DNA circular parcialmente bicatenaria de aproximadamente pares de bases de longitud. 1,2 La infección crónica puede causar cirrosis (fibrosis) hepática, cáncer hepático, insuficiencia hepática e incluso la muerte. 1,2 Las opciones de tratamiento actuales para los pacientes con infección crónica por el VHB son el interferón, el interferón pegilado y los antivíricos como lamivudina, adefovir, entecavir, telbivudina y tenofovir dirigidos frente a la polimerasa viral (Pol) del VHB. 1-3 PRINCIPIOS BIOLÓGICOS DEL PROCEDIMIENTO El ensayo Abbott HBV Sequencing se compone de 2 equipos de reactivos: Abbott HBV Sequencing Amplification Reagent Kit (equipo de reactivos de amplificación) Abbott HBV Sequencing Control Kit (equipo de controles) es Abbott HBV Sequencing 3N /R01 B3N033 El ensayo HBV Sequencing usa la PCR para amplificar la región de la polimerasa del genoma de DNA del VHB en muestras clínicas. La presencia de producto amplificado del VHB se detecta midiendo la fluorescencia de la sonda para VHB que se une a la diana en el paso de extensión/hibridación. El producto amplificado se purifica para eliminar los cebadores no usados y los desoxinucleótidos trifosfatos (dntps) utilizando el ExoSAP-IT (USB Corporation) o las columnas de centrifugación (QIAGEN). Una cantidad adecuada de producto amplificado purificado se somete a ciclos de secuenciación con el método de Sanger. Los productos de los ciclos de secuenciación son purificados con acetato de sodio/etanol o precipitado de isopropanol y se resuspenden en formamida HiDi antes de la electroforesis en un analizador genético (3130, 3130xl) de Applied Biosystems (AB). La secuencia de consenso de DNA que resulta se puede exportar y analizar mediante programas en web. Preparación de las muestras El objetivo de la preparación de la muestra es extraer y concentrar el DNA diana, para poder amplificarlo y eliminar los posibles inhibidores de la amplificación. Este proceso se realiza con los sistemas de preparación de muestras automatizados Abbott m2000sp o Abbott m24sp que utilizan micropartículas magnéticas para la purificación de los ácidos nucleicos de las muestras. Los reactivos Abbott msample Preparation System DNA (4 x 24 preparaciones) lisan el virión, capturan los ácidos nucleicos y lavan las partículas para eliminar los componentes no unidos de la muestra. En el paso de lisis se incluye la proteinasa K para digerir las proteínas asociadas con los ácidos nucleicos. 4,5 Los ácidos nucleicos unidos se eluyen y se transfieren a una placa de 96 pocillos. Los ácidos nucleicos están así listos para su amplificación. Preparación de los reactivos y del conjunto de placas de reacción El sistema Abbott m2000sp o el Abbott m24sp puede usarse para preparar muestras para el ensayo Abbott HBV Sequencing con los reactivos Abbott msample Preparation System DNA y el reactivo Abbott Proteinase K. Los componentes del reactivo de amplificación HBV Sequencing (HBV Pol PCR Mix, AmpliTaq Gold Enzyme [enzimas], Activation Reagent [reactivo de activación] y UNG) son montados manualmente por el usuario. El instrumento Abbott m2000sp dispensa la mezcla resultante en la placa de reacción óptica de 96 pocillos de Abbott junto con las muestras de ácidos nucleicos preparadas en el sistema Abbott m2000sp. El instrumento Abbott m24sp requiere que la mezcla de amplificación sea montada manualmente y que las alícuotas se transfieran a una placa de reacción óptica de 96 pocillos junto con la transferencia manual de las muestras de ácido nucleico. Tras la colocación manual de la cubierta óptica adhesiva de Abbott, la placa está lista para transferirla al sistema Abbott m2000rt o al termociclador Perkin Elmer 9700 o equivalente. Amplificación Durante la reacción de amplificación/detección, el DNA diana se amplifica por acción de la enzima AmpliTaq Gold en presencia de cebadores, la sonda marcada con Quasar, los desoxinucleótidos trifosfatos (dntp), la desoxiuridina trifosfato (dutp), la uracil-nglucosilasa (UNG) y el cloruro de magnesio. En primer lugar, los cebadores del VHB hibridan con sus dianas correspondientes y la polimerasa extiende la secuencia. Después del paso de desnaturalización, en el que la temperatura de reacción se eleva por encima del punto de fusión de la doble cadena de DNA, la cadena de DNA recién generada se desnaturaliza del DNA diana. Durante cada ciclo térmico, los productos amplificados se disocian en cadenas monocatenarias a temperaturas elevadas, lo que permite la hibridación y la extensión a medida que desciende la temperatura. 1

2 La amplificación exponencial de la diana se consigue mediante ciclos repetidos de ascenso y descenso de la temperatura, dando lugar a una amplificación de las secuencias diana de un mínimo de mil millones de veces. La secuencia diana para el ensayo HBV Sequencing incluye una región de la polimerasa y del gen del antígeno de superficie superpuesto en el genoma del VHB. Esta región es específica para el VHB y está altamente conservada. Los cebadores están diseñados para hibridar en esta región con el menor número posible de malapareamientos entre los genotipos A a H del VHB. Detección La presencia de productos de amplificación del VHB se detecta en el paso de hibridación/extensión midiendo la fluorescencia de la sonda del VHB marcada con Quasar que se une a la diana en el paso de hibridación/extensión. La sonda del VHB es un oligonucleótido de DNA monocatenario compuesto por una secuencia de sondas con un fluoróforo ligado covalentemente al extremo 5 de la sonda y un extintor de fluorescencia ligado covalentemente al extremo 3 de la sonda. En ausencia de la secuencia diana para el VHB, la sonda fluorescente se extingue. En presencia del VHB, la sonda del VHB hibrida con su secuencia complementaria. Esto separa el fluoróforo del extintor de fluorescencia, lo que permite la emisión de la fluorescencia y su detección. El ciclo de amplificación por el que el sistema Abbott m2000rt detecta una señal fluorescente es proporcional al log de la concentración de DNA del VHB presente en la muestra original. Como alternativa, si para la amplificación no se ha usado el sistema m2000rt, la detección del producto de la PCR se puede realizar con un análisis de gel. Purificación del producto de la PCR Se retira el sello de la placa de reacción óptica de 96 pocillos de Abbott y se purifican las reacciones de la PCR para eliminar los cebadores no utilizados y los componentes de la reacción que puedan interferir con las reacciones de los ciclos de secuenciación posteriores. La purificación se realiza con ExoSAP-IT, que es un reactivo formado por exonucleasa I para degradar los cebadores de cadena simple y por fosfatasa alcalina de camarón para eliminar los fosfatos de los dntp que no son funcionales. La purificación también se puede realizar con columnas de centrifugación de separación por tamaño (QIAGEN). Cuantificación y dilución La cuantificación del producto amplificado se efectúa a través de los resultados del número de ciclos (NC) del sistema m2000rt o por análisis en gel. De acuerdo con estos resultados, cada producto amplificado se diluye para asegurar que se añade la cantidad óptima de producto amplificado a las reacciones de ciclos de secuenciación. Secuenciación El producto amplificado Pol de cada muestra se analiza con cuatro reacciones diferentes de secuenciación. Cada reacción de secuenciación contiene producto amplificado, un único cebador y BigDye Terminator v.3.1 (Applied Biosystems). La mezcla de secuenciación y los productos amplificados purificados se añaden manualmente a una placa de reacción óptica de 96 pocillos de Abbott, que se sella antes de la secuenciación. En cada paso del ciclo térmico, el cebador hibrida con el producto amplificado y las enzimas de la reacción BigDye Terminator extienden en longitud el producto complementario. Una proporción menor del sustrato dntp son didesoxinucleótidos (ddntp) marcados con fluorescencia, estos van a producir la terminación de la síntesis de la cadena en el momento y lugar donde se incorporan. Cada base de ddntp (A, C, G, T) está marcada con un fluoróforo diferente. Los resultados de la terminación de la síntesis de las cadenas se diferencian en un nucleótido con respecto a las cadenas anteriores analizadas. 6 Purificación del producto de secuenciación Se retira el sello de la placa de reacción óptica de 96 pocillos de Abbott y se purifican las reacciones de secuenciación para eliminar los ddntp marcados no usados, los cebadores y otros componentes de la reacción que pueden interferir con la electroforesis capilar. La purificación se consigue con acetato de sodio/etanol o precipitado de isopropanol. El DNA purificado se resuspende en formamida HiDi. Electroforesis capilar El producto purificado de secuenciación se analiza con una analizador genético basado en electroforesis capilar. Los productos de DNA se separan en función de su tamaño, ya que los productos más pequeños se trasladan con mayor rapidez que los de mayor tamaño. Debido a que cada base de ddntp está marcada con un fluoróforo único, la secuencia de DNA diana se puede determinar según el orden en el que los productos de DNA marcados con fluorescencia pasan por la célula excitadora/detectora en el analizador genético. 6 Análisis de los datos Para cada muestra se deben realizar cuatro lecturas diferentes de cebadores (muestras). El programa SeqScape puede usarse para recopilar las cuatro lecturas y analizar los datos. La secuencia de consenso de DNA resultante se puede exportar y analizar mediante programas en web. PREVENCIÓN DE LA CONTAMINACIÓN POR ÁCIDO NUCLEICO Se ha minimizado la posibilidad de contaminación por ácido nucleico ya que: Aunque el protocolo implica la manipulación de producto amplificado, el impacto de la contaminación se minimiza añadiendo dutp/ung en el paso de la PCR. En todas las dispensaciones se utilizan puntas de pipetas con filtros. Las puntas de pipetas se desechan después de cada uso. Para realizar el ensayo Abbott HBV Sequencing se utilizan áreas separadas y específicas. Consulte el apartado PRECAUCIONES ESPECIALES en estas instrucciones de uso. REACTIVOS Abbott HBV Sequencing Amplification Reagent Kit (equipo de reactivos de amplificación) (nº de ref.: 3N03-90) AmpliTaq Gold Enzyme (enzimas) (1 vial de 0,078 ml) (5,4 unidades/µl a 5,9 unidades/µl) en una solución tamponada con estabilizantes. HBV Pol PCR Mix (1 vial de 1,55 ml) Menos del 0,1% de oligonucleótidos sintéticos (2 cebadores y 1 sonda) y menos del 0,2% de dntp en solución tamponada con un colorante de referencia. Conservantes: azida sódica y ProClin 950 al 0,15%. Activation Reagent (reactivo de activación) (1 vial de 0,778 ml) Solución tamponada de cloruro de magnesio 38 mm. Conservantes: azida sódica y ProClin 950 al 0,15%. HBV Sequencing Pol Primer A (1 vial de 0,130 ml) Menos del 0,1% de oligonucleótidos sintéticos en agua. HBV Sequencing Pol Primer B (1 vial de 0,130 ml) Menos del 0,1% de oligonucleótidos sintéticos en agua. HBV Sequencing Pol Primer C (1 vial de 0,130 ml) Menos del 0,1% de oligonucleótidos sintéticos en agua. HBV Sequencing Pol Primer D (1 vial de 0,130 ml) Menos del 0,1% de oligonucleótidos sintéticos en agua. Uracil DNA Glycosylase (1 vial de 0,060 ml) (1 U/μl). BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Mix (mezcla preparada para ciclos de secuenciación) (1 vial de 0,9 ml) Abbott HBV Sequencing Control Kit (equipo de controles) (nº de referencia: 3N03-80) Abbott HBV Sequencing Negative Control (control negativo) (4 viales de 1,3 ml cada uno) Plasma negativo humano que fue analizado y resultó ser no reactivo para el HBsAg, ni para el DNA del VHB, el RNA del VIH, el RNA del VHC, ni reactividad de anticuerpos anti-vih-1/vih-2, ni anti-vhc. Conservantes: ProClin 300 al 0,1% y ProClin 950 al 0,15%. Abbott HBV Sequencing Positive Control (control positivo) (4 viales de 1,3 ml cada uno) Plasma inactivado con calor, reactivo para el DNA del VHB en plasma negativo humano. El plasma negativo humano se analizó y no se encontró reactividad para el HBsAg, ni para el DNA del VHB, el RNA del VIH, el RNA del VHC, ni reactividad de anticuerpos anti VIH-1/VIH-2 ni anti VHC. Conservantes: ProClin 300 al 0,1% y ProClin 950 al 0,15%. ADVERTENCIAS Y PRECAUCIONES Producto sanitario para diagnóstico in vitro Para uso en diagnóstico in vitro El ensayo Abbott HBV Sequencing no debe utilizarse como análisis de cribado del VHB en donantes de sangre, plasma o tejidos, ni como ensayo de confirmación de infección por el VHB. Utilice sólo etanol con un grado USP (etanol al 95% - 100%) para preparar el reactivo de preparación de muestras mwash2 DNA. No utilice etanol que contenga desnaturalizantes. 2

3 Precauciones de seguridad Si desea obtener más información sobre las precauciones de seguridad, consulte el capítulo Riesgos de los Manuales de funcionamiento del sistema Abbott m2000sp y Abbott m2000rt. ATENCIÓN este producto contiene componentes de origen humano o potencialmente infecciosos. Para una información más detallada consulte el apartado REACTIVOS en estas instrucciones de uso. El plasma negativo humano se analizó y no se encontró reactividad para el HBsAg, ni para el DNA del VHB, el RNA del VHC, el RNA del VIH, ni reactividad de anticuerpos anti VIH-1/VIH-2 ni anti VHC. Al no existir métodos de análisis que garanticen la inocuidad de materiales de origen humano o de microorganismos inactivados, todos los materiales de origen humano se deben considerar potencialmente infecciosos. Maneje estos reactivos y las muestras de origen humano según las recomendaciones especificadas en la publicación "OSHA Standard on Bloodborne Pathogens". 7 En el caso de materiales que contengan o pudieran contener agentes infecciosos, se deben seguir las prácticas de seguridad biológica "Biosafety Level 2" 8 u otras normativas equivalentes. 9,10 Estas precauciones incluyen, entre otras, las siguientes: Use guantes al manejar las muestras o los reactivos. No pipetee con la boca. No coma, beba, fume, utilice cosméticos ni manipule lentes de contacto en áreas donde se trabaja con estos materiales. Limpie y desinfecte las salpicaduras de las muestras con un desinfectante tuberculicida como el hipoclorito de sodio al 1,0% u otro desinfectante adecuado. 11,12 Descontamine y deseche todo el material potencialmente contaminado de acuerdo a la normativa vigente. 13,14 Los controles Abbott HBV Sequencing contienen metilisotiazolonas como componentes de ProClin y están clasificados según las directivas de la Comunidad Europea (CE) como: Irritantes (Xi). A continuación se indican las frases relativas a los riesgos derivados de los peligros de la sustancia (R) y los consejos de prudencia (S). R43 Posibilidad de sensibilización en contacto con la piel. S24 Evítese el contacto con la piel. S35 Elimínense los residuos del producto y sus recipientes con todas las precauciones posibles. S37 Úsense guantes adecuados. S46 En caso de ingestión, acúdase inmediatamente al médico y muéstrele la etiqueta o el envase. Para aquellos productos que no hayan sido clasificados como peligrosos según la Directiva Europea 1999/45/EC, versión corregida, la ficha de datos de seguridad está a disposición del usuario profesional. Precauciones para la recogida y el manejo de las muestras El ensayo Abbott HBV Sequencing debe ser usado sólo con muestras de suero y plasma humanas que hayan sido manejadas y almacenadas en tubos con tapón, tal y como se describe en el apartado RECOGIDA, ALMACENAMIENTO Y TRANSPORTE DE LA MUESTRA AL LABORATORIO. Precauciones en el laboratorio Durante la preparación de las muestras, es esencial el cumplimiento de las buenas prácticas de laboratorio para minimizar el riesgo de contaminación cruzada entre las muestras, así como la introducción involuntaria de nucleasas en las muestras durante y después del procedimiento de extracción. Cuando se trabaja con DNA se deben utilizar siempre técnicas asépticas adecuadas. Las áreas de trabajo y las plataformas de instrumentos se deben considerar fuentes potenciales de contaminación. Cámbiese los guantes después de entrar en contacto con productos que puedan contaminar (tales como DNasas, muestras, eluidos y/o producto amplificado) antes de manejar los reactivos cerrados, el control negativo, el control positivo o las muestras. Si desea obtener información sobre los procedimientos de limpieza de los instrumentos, consulte los Manuales de funcionamiento de los sistemas m2000sp, m24sp y m2000rt. Use indumentaria protectora adecuada en todo momento. Use guantes sin talco. Para reducir el riesgo de contaminación por ácido nucleico debido a aerosoles formados durante el pipeteo, se deben utilizar para todos los pipeteos puntas de pipetas con filtro antiaerosol. La punta debe ser lo suficientemente larga para evitar la contaminación de la pipeta. Al pipetear, deberá tener cuidado de no introducir el filtro antiaerosol dentro del tubo de muestra o del recipiente. Se recomienda el uso de puntas de pipetas alargadas con filtro antiaerosoles. Utilice una punta de pipeta nueva con filtro antiaerosol para CADA dispensación manual de líquido. Limpie y desinfecte las salpicaduras de las muestras y los reactivos como se indica en los Manuales de funcionamiento de los sistemas m2000sp o m24sp y m2000rt. Precauciones para la contaminación Las reacciones de amplificación tales como la PCR son sensibles a la introducción accidental de productos de reacciones de amplificación previas. Se pueden obtener resultados incorrectos si se contaminan accidentalmente las muestras clínicas o los reactivos, aunque sólo sea con muy pocas moléculas de producto de amplificación. Las medidas para reducir el riesgo de contaminación en el laboratorio incluyen separar físicamente las actividades que conllevan la realización de una PCR de acuerdo con las buenas prácticas de laboratorio. Áreas de trabajo Se recomienda utilizar tres áreas específicas en el laboratorio para realizar el ensayo Abbott HBV Sequencing: el área de preparación de las muestras, el área de amplificación y el área de secuenciación. El área de preparación de las muestras se utiliza para procesar las muestras (muestras y controles Abbott HBV Sequencing) y añadir las muestras y los controles procesados a la placa de reacción óptica de 96 pocillos. El sistema Abbott m2000sp o el Abbott m24sp puede usarse para preparar las muestras para el ensayo Abbott HBV Sequencing con los reactivos Abbott msample Preparation System DNA y el reactivo Abbott Proteinase K (proteinasa K). El usuario monta manualmente los componentes de los reactivos de amplificación HBV Sequencing. El instrumento Abbott m2000sp dispensa la mezcla resultante en la placa de reacción óptica de 96 pocillos de Abbott junto con las muestras de ácidos nucleicos preparadas en el sistema Abbott m2000sp. El instrumento Abbott m24sp requiere que la mezcla de amplificación sea montada manualmente y que las alicuotas se transfieran a una placa de reacción óptica de 96 pocillos junto con la transferencia manual de las muestras de ácido nucleico. Todos los reactivos utilizados en el área de preparación de muestras deben permanecer en esta área todo el tiempo. Las batas de laboratorio, las pipetas, las puntas de pipeta y el vórtex utilizados en el área de preparación de la muestra deben permanecer en esta área y no se deben trasladar al área de amplificación. No traslade producto amplificado al área de preparación de muestras. El área de amplificación está dedicada a la amplificación de la PCR. Las batas de laboratorio y el equipo utilizado en el área de amplificación deben permanecer en esta área y no se deben trasladar al área de preparación de los reactivos ni al área de preparación de muestras. El área de secuenciación está dedicada a la realización de la electroforesis en gel, a la purificación del producto amplificado, a la reacción de secuenciación y al análisis de las secuencias. Las batas de laboratorio y el equipo utilizado en el área de secuenciación deben permanecer en esta área y no se deben trasladar a otros áreas. Las batas de laboratorio, las pipetas y las puntas de pipetas utilizadas en el área de secuenciación deben permanecer en esta área y no se deben trasladar al área de preparación de las muestras ni al área de amplificación. Los componentes del equipo deben utilizarse conjuntamente. No mezcle componentes de distintos lotes entre sí. Por ejemplo: no utilice el control negativo del equipo de controles con el nº de lote X con los controles positivos del equipo de controles con el nº de lote Y. No utilice los equipos ni los reactivos transcurrida la fecha de caducidad. Las áreas de trabajo y las plataformas de instrumentos se deben considerar fuentes potenciales de contaminación. Cámbiese los guantes después de entrar en contacto con productos que puedan contaminar (tales como muestras, eluidos y/o producto amplificado), antes de manejar los reactivos, el control negativo, los controles positivos o las muestras cerrados. Si desea obtener información sobre los procedimientos de limpieza de los instrumentos, consulte los Manuales de funcionamiento de los sistemas Abbott m2000sp o m24sp, Abbott m2000rt y el analizador genético AB correspondientes. 3

4 Si se suspende el procesamiento en el instrumento Abbott m2000sp o en el m24sp, deseche todos los productos y reactivos según lo descrito en el Manual de funcionamiento del Abbott m2000sp o m24sp. Si se suspende el protocolo de adición de la mezcla Abbott m2000sp, deseche la placa de reacción óptica de 96 pocillos en una bolsa de plástico sellable de acuerdo con el capítulo Riesgos del Manual de funcionamiento del sistema Abbott m2000sp, junto con los guantes utilizados para manejar la placa. No realice la petición de ensayo en el sistema m2000rt. Si se interrumpe o se suspende el procesamiento en el sistema Abbott m2000rt, deseche la placa de reacción óptica de 96 pocillos en una bolsa de plástico sellable de acuerdo con el Manual de funcionamiento del sistema Abbott m2000rt, junto con los guantes que haya utilizado para manejar la placa. Una vez finalizado el procesamiento de secuenciación, selle la placa de reacción óptica de 96 pocillos con una bolsa de plástico sellable y deséchela de acuerdo con el Manual de funcionamiento del sistema Abbott m2000rt junto con los guantes que haya utilizado para manejar la placa. La esterilización en autoclave de la placa de reacción sellada no degrada el producto amplificado y puede contribuir a que el producto amplificado se derrame al abrirse la placa. El laboratorio puede contaminarse con producto amplificado si los materiales de desecho no se manejan y almacenan con cuidado antes y después del procesamiento. Descontamine y deseche todas las muestras, los reactivos y demás material posiblemente contaminado de acuerdo con la normativa vigente. Todos los materiales se deben manejar de forma que se minimice la posibilidad de contaminación en el área de trabajo. INSTRUCCIONES PARA EL ALMACENAMIENTO Y EL MANEJO DE LOS REACTIVOS Abbott RealTime HBV Sequencing Amplification Reagent Kit (equipo de reactivos de amplificación) (nº de referencia: 3N03-90) El equipo de reactivos de amplificación Abbott HBV Sequencing Amplification Reagent Kit debe almacenarse a una temperatura igual o inferior a 10 C cuando no se esté utilizando. Se debe tener cuidado al separar el envase del reactivo de amplificación Abbott HBV Sequencing que se está utilizando para que no entre en contacto con muestras y controles. Los controles negativo y positivo Abbott HBV Sequencing deben almacenarse a una temperatura igual o inferior a 10 C. INDICACIONES DE INESTABILIDAD O DETERIORO DE LOS REACTIVOS Si un control positivo o negativo está fuera del intervalo esperado, puede ser indicio de deterioro de los reactivos. Los resultados de estos ensayos no son válidos y las muestras se debe analizar nuevamente. INSTRUMENTOS/MÉTODOS Antes de realizar el ensayo, se debe instalar el fichero de la aplicación Abbott HBV Sequencing en los instrumentos Abbott m2000sp y Abbott m2000rt desde el CD-ROM de aplicaciones combinadas del sistema m2000 Abbott HBV Sequencing. Para obtener información sobre la instalación de los ficheros de aplicación, consulte el capítulo Instrucciones de funcionamiento de los Manuales de funcionamiento Abbott m2000sp y m2000rt. Además, los ficheros SeqScape del ensayo HBV Sequencing pueden instalarse en el programa SeqScape. INSTRUCCIONES PARA LA RECOGIDA Y EL MANEJO DE LAS MUESTRAS Recogida y almacenamiento de las muestras Con el ensayo HBV Sequencing, se pueden usar muestras de suero y plasma humanos (recogido con ACD, EDTA y CPD). Siga las instrucciones del fabricante para el procesamiento de los tubos de recogida. El uso de muestras recogidas en tubos de suero que contienen activador del coágulo Z u otros tipos semejantes de activador rápido del coágulo, puede causar resultados inhibidos en el ensayo HBV Sequencing. Por tanto, no deben usarse tubos de recogida de suero que contengan activador del coágulo Z u otros activadores rápidos del coágulo similares. No se ha validado el uso de tubos de preparación de plasma con el ensayo HBV Sequencing. Las muestras recién recogidas (sangre) pueden conservarse a una temperatura entre 2 C y 30 C hasta 6 horas antes de la centrifugación. Después de la centrifugación, retire el suero o plasma de las células. Las muestras de suero o plasma se pueden almacenar: hasta 24 horas a una temperatura entre 15 C y 30 C hasta 3 días a una temperatura entre 2 C y 8 C a una temperatura igual o inferior a 20 C durante periodos más prolongados Evite someter las muestras a múltiples ciclos de congelación y descongelación. Si están congeladas, descongele las muestras a una temperatura entre 15 C y 30 C o entre 2 C y 8 C. Una vez descongeladas, si no va a procesar las muestras inmediatamente, se pueden almacenar a una temperatura entre 2 C y 8 C hasta 6 horas. Transporte de las muestras Transporte las muestras congeladas con nieve carbónica. Para el transporte nacional e internacional, las muestras se deben empaquetar y etiquetar de acuerdo con la normativa vigente nacional e internacional sobre el transporte de muestras clínicas, diagnósticas o biológicas. PROCEDIMIENTO DEL ENSAYO ABBOTT HBV SEQUENCING Materiales suministrados Abbott HBV Sequencing Amplification Reagent Kit (equipo de reactivos de amplificación) (nº de referencia: 3N03-90) Materiales necesarios pero no suministrados Abbott HBV Sequencing Control Kit (equipo de controles) (nº de referencia: 3N03-80) Área de preparación de muestras Abbott m2000sp o m24sp Abbott msample Preparation System DNA (sistema de preparación de muestras) (4 x 24 preparaciones) (nº de referencia: 6K12-24) Abbott Proteinase K (nº de referencia: 3L78-60) Abbott HBV Sequencing m2000 System ROW Combined Application CD-ROM (CD-ROM de aplicaciones combinadas del sistema m2000 internacional excepto para EE.UU.) (nº de referencia: 5N62) Puntas de pipetas desechables DiTi de 200 µl Puntas de pipetas desechables DiTi de 1 ml Gradillas de muestras Tubos de reacción de 5 ml Recipientes de reactivo de 200 ml Vial para realizar la mezcla Abbott 96-Well Optical Reaction Plate (placa de reacción óptica de 96 pocillos) Abbott 96-Deep Well Plate (placa de 96 pocillos profundos) Abbott Splash Free Support Base (base de soporte para placas) Abbott Optical Adhesive Cover (cubierta adhesiva óptica) Abbott Adhesive Cover Applicator (aplicador para la cubierta adhesiva óptica) Mezclador Vortex Tubos de polipropileno para centrífuga de 50 ml Centrífuga a 2 000g Pipetas de precisión calibradas para dispensar de 10 µl µl Puntas de pipeta para pipetas de precisión con filtro antiaerosol para dispensar entre 10 µl µl Pipetas serológicas Etanol con un grado USP (etanol al %). No utilice etanol que contenga desnaturalizantes. Agua grado biología molecular Tubos de microcentrífuga sin RNasas/DNasas de 1,7 ml Área de amplificación Abbott m2000rt o termociclador; Perkin Elmer 9700 o equivalente Abbott HBV Sequencing m2000 System ROW Combined Application CD-ROM (CD-ROM de aplicaciones combinadas del sistema m2000 internacional excepto para EE.UU.) (nº de referencia: 5N62) Abbott m2000rt Optical Calibration Kit (equipo de calibración óptica) (nº de referencia: 4J71-93) 4

5 Área de secuenciación Agarosa; Lonza o equivalente Marcador de peso molecular, Low DNA Mass Ladder; Invitrogen o equivalente Tampón de carga de gel: Sigma G2526 o equivalente Tampón TRIS Acetato EDTA 50X; Invitrogen o equivalente Bromuro de etidio H5041; Promega o equivalente Equipo para electroforesis en gel (incluye peine de 14 pocillos) Horizon 58; Life Technologies o equivalente Fuente de alimentación EC105; EC Apparatus Company o equivalente Gel para transiluminador ultravioleta Equipo para fotografía o lectura de gel Termociclador; Perkin Elmer 9700 o equivalente ExoSAP-IT; USB Corporation QIAGEN QIAquick (alternativa a ExoSAP-IT); QIAGEN Centrífuga Eppendorf (5417C o equivalente) para QIAGEN QIAquick Mezclador Vortex para tubos de microcentrífuga Mezclador Vortex para placas de 96 pocillos Acetato de sodio 3 M, ph 5,2; Cambrex Bio Science Rockland, Inc o equivalente Etanol al 100%; Decon Labs, Inc. (PN 2701) o equivalente Isopropanol al 100% (Isopropyl Alcohol), OmniSolve PX o equivalente Centrífuga para placas de 96 pocillos 3100 Performance Optimized Polymer (POP-7) (polímero optimizado); ABI Tampón de analizador genético 10X con EDTA; ABI Formamida HiDi ; ABI Depósito de septos; ABI o equivalente Soporte para placas de 96 pocillos; ABI o equivalente Depósito de placas de 96 pocillos; ABI o equivalente Septos para las placas de 96 pocillos ABI o equivalente Matriz de capilares para analizador genético 3130xl/3100, 50 cm; ABI o equivalente Analizador genético 3130xl, 3130 Hitachi/ABI o equivalente Otros materiales Cabina de seguridad biológica aprobada para trabajar con material infeccioso Bolsas de plástico sellables Agua sin DNasas Tubos de microcentrífuga grado biología molecular de 1,7 ml (Dot Scientific, Inc. o equivalente) Torundas con puntas de algodón (Puritan o equivalente) NOTA: estos tres componentes se utilizan en el procedimiento Seguimiento del laboratorio para comprobar la presencia de contaminación. Consulte el apartado PROCEDIMIENTOS DE CONTROL DE CALIDAD en estas instrucciones de uso. Precauciones de procedimiento Lea estas instrucciones de uso con atención antes de procesar las muestras. Los viales de los controles negativo y positivo Abbott HBV Sequencing son de un solo uso y se deben desechar después del uso. Compruebe que los tubos de muestras no tengan burbujas de aire. Si las hubiese, retírelas con una punta de pipeta esterilizada. Las burbujas en los reactivos pueden interferir en la detección correcta de los niveles de volumen de los reactivos, provocando una aspiración insuficiente del reactivo que, a su vez, puede afectar a los resultados. Debe tener cuidado y evitar la contaminación cruzada entre las muestras, para ello utilice una punta de pipeta esterilizada y nueva para cada tubo. Utilice una sola vez las puntas de pipetas con filtro antiaerosol o pipetas desechables al dispensar las muestras, los controles o los reactivos de amplificación. Para evitar la contaminación de la pipeta deberá tener cuidado de no introducir la pipeta dentro del tubo o del recipiente de la muestra Se recomienda el uso de puntas de pipetas alargadas con filtro antiaerosoles. Los procedimientos de monitorización para detectar la presencia del producto de amplificación se pueden encontrar en el apartado PROCEDIMIENTOS DE CONTROL DE CALIDAD de estas instrucciones de uso. Para reducir el riesgo de contaminación por ácido nucleico, limpie y desinfecte las salpicaduras de las muestras con un desinfectante tuberculicida, como el hipoclorito de sodio al 1,0% u otro desinfectante adecuado. El uso de los controles Abbott HBV Sequencing es esencial para el rendimiento del ensayo Abbott HBV Sequencing. Si desea más información, consulte el apartado PROCEDIMIENTOS DE CONTROL DE CALIDAD en estas instrucciones de uso. PROCEDIMIENTO DEL ENSAYO ABBOTT REALTIME HBV SEQUENCING Las instrucciones de uso del ensayo Abbott HBV Sequencing contienen dos protocolos de preparación de muestras: En el caso de muestras preparadas para la amplificación con el instrumento Abbott m24sp, proceda según el Protocolo I para la preparación de muestras. En el caso de muestras preparadas para la amplificación con el instrumento Abbott m2000sp, proceda según el Protocolo II para la preparación de muestras. Preparación de las muestras El almacenamiento y la preparación de las muestras debe llevarse a cabo en el área de preparación de muestras específica. Antes de preparar las muestras, consulte el apartado Precauciones de manejo en estas instrucciones de uso para obtener más información. Para una descripción detallada del funcionamiento de los instrumentos Abbott m2000sp, m24sp y m2000rt, consulte el capítulo Instrucciones de funcionamiento en los Manuales de funcionamiento de los sistemas Abbott m2000sp, m24sp y m2000rt. Se debe entrenar al personal de laboratorio para que pueda manejar los instrumentos Abbott m2000sp, m24sp, m2000rt, el termociclador Perkin Elmer 9700 o equivalente y los instrumentos Applied Biosystems Genetic Analyzer 3130/3130xl. El usuario debe conocer a fondo cómo procesar las aplicaciones en los instrumentos y seguir las buenas prácticas de laboratorio. Protocolo I de preparación de muestras (m24sp) 1. En cada procesamiento, se pueden analizar un total de 18 muestras. En cada procesamiento, se debe incluir un control negativo y un control positivo, por tanto, sólo es posible analizar un máximo de 16 muestras por procesamiento. El instrumento Abbott m24sp usa una gradilla de muestras de 13 mm. Compruebe el volumen de muestra. El volumen de muestra mínimo del ensayo Abbott HBV Sequencing y los requisitos de los portatubos asociados para el sistema Abbott m24sp son los siguientes: Diámetro Volumen de Portatubos del Altura del tubo muestra tubo* mínimo 13 mm 11,5 mm a 14,0 mm 75 mm a 100 mm 1,0 ml * Se refiere al diámetro exterior del tubo de muestras. Si están congelados, descongele las muestras a una temperatura entre 15 C y 30 C o entre 2 C y 8 C. Una vez descongeladas, si no va a procesar las muestras inmediatamente, almacénelas a una temperatura entre 2 C y 8 C hasta 6 horas. Antes del uso, mezcle con un vórtex las muestras tres veces durante 2 a 3 segundos. Asegúrese de que no haya burbujas ni espuma. En el caso de que las hubiera, retírelas con una punta de pipeta esterilizada y nueva para cada tubo. Antes del análisis, las muestras que presenten partículas en suspensión o turbidez, se deben aclarar por centrifugación a 2000g durante 5 minutos. Dispense una alícuota de cada muestra en tubos o viales limpios, en caso necesario. Evite tocar el interior de los tapones de los tubos al abrirlos. 2. Descongele los controles del ensayo a una temperatura entre 15 C y 30 C o entre 2 C y 8 C. Una vez descongelados, si no va a procesar los controles inmediatamente, almacénelos a una temperatura entre 2 C y 8 C hasta 24 horas. 5

6 Antes del uso, mezcle con un vórtex cada control del ensayo tres veces durante 2 a 3 segundos. Asegúrese de que no haya burbujas ni se forme espuma. En el caso de que hubiera, retírelas con una punta de pipeta esterilizada y nueva para cada tubo. Asegúrese de que el contenido de los frascos se encuentre en el fondo después de mezclar con el vórtex dando unos golpecitos al tubo sobre la mesa de trabajo para que el líquido se desplace al fondo. 3. Descongele los reactivos de amplificación a una temperatura entre 15 C y 30 C o entre 2 C y 8 C hasta que los necesite para el procedimiento de amplificación de la mezcla. Este paso se puede iniciar antes de completar el procedimiento de preparación de la muestra. Nota: no mezcle en el vórtex los envases de reactivos de amplificación. Con cada envase de reactivos de amplificación se pueden realizar hasta 48 reacciones. Una vez descongelados y antes de su uso, los reactivos de amplificación se pueden almacenar a una temperatura entre 2 C y 8 C hasta 24 horas. 4. Abra el envase del reactivo de la proteinasa K. Para preparar la solución de la proteinasa K, añada 17,15 ml de agua grado biología molecular a un tubo de centrífuga de polipropileno de 50 ml. Pipetee 2,45 ml de proteinasa K en este tubo. Invierta suavemente para mezclar el contenido entre 10 y 15 veces. Calcule el volumen de la solución de proteinasa K necesaria para el procesamiento con el m24sp: (425 μl X número de muestras) + 1,0 ml de volumen residual. Pipetee el volumen necesario en un tubo de mezcla. Las plantillas del sistema m24sp del ensayo Abbott HBV Sequencing requieren el uso de un tubo de mezcla para la solución proteinasa K. No utilice ningún otro tipo de tubo. Nota: use un frasco de la solución proteinasa K, un conjunto de reactivos del sistema Abbott msample Preparation System DNA (sistema de preparación de muestras) para llevar a cabo hasta 24 reacciones con la excepción de las micropartículas mmicroparticles DNA. Use un segundo frasco de la solución proteinasa K y de los reactivos msample DNA para llevar a cabo entre 25 y 48 reacciones, con la excepción de las micropartículas. Un frasco de mmicroparticles DNA es suficiente para llevar a cabo hasta 48 reacciones. No use más de un frasco de mmicroparticles DNA. 5. Abra el envase de reactivos Abbott msample Preparation System DNA. Si observa cristales en cualquiera de los frascos de reactivo al abrirlos, deje el reactivo a la temperatura ambiente hasta que los cristales desaparezcan. No utilice los reactivos hasta que los cristales se hayan disuelto. 6. Prepare la solución mwash2 DNA añadiendo 70 ml de etanol con un grado USP (etanol al 95% - 100%) al frasco del reactivo mwash2 DNA, tal y como se describe en la información del producto Abbott msample Preparation System DNA. No utilice etanol que contenga desnaturalizantes. Invierta el frasco para mezclar su contenido. Si va a utilizar de nuevo los reactivos del msample Preparation System DNA, marque el frasco de la solución mwash2 DNA para indicar que ya se ha añadido el etanol. 7. Cargue el control negativo, el control positivo y las muestras de paciente en las gradillas de muestras del sistema Abbott m24sp, empezando con la posición 3 de la gradilla de muestras del control interno. Coloque el tubo de mezcla que contiene la solución proteinasa K en la última posición (16) de la gradilla de muestras 2. ATENCIÓN: NO se salte ninguna posición de la gradilla de muestras, excepto las posiciones 1 y 2 de la gradilla de muestras del control interno. Cargue los controles y las muestras en las gradillas de muestras en posiciones consecutivas, empezando por la posición 3 de la gradilla de muestras del control interno. Llene todas las posiciones de la gradilla de muestras del control interno antes de cargar las muestras en la gradilla de muestras 2. Introduzca con cuidado los tubos de muestras y controles en las gradillas de muestras para evitar las salpicaduras. Asegúrese de que todos los tubos estén bien asentados en la gradilla de muestras de forma que el fondo de los tubos toque la parte inferior de la gradilla. Cargue las gradillas de muestras llenas en la mesa de trabajo, empezando por la gradilla de muestras del control interno en la Posición 1 de la mesa de trabajo. 8. Por cada muestra que se vaya a procesar, coloque un tubo de reacción de 5 ml en el bloque térmico secundario y un tubo de reacción de 1,5 ml en el soporte TeMagS del m24sp. 9. Cargue tubos de salida de 1,5 ml o una placa de 96 pocillos sobre la posición de salida de la mesa de trabajo. Cargue gradillas llenas de puntas de pipetas en los portagradillas DiTi y colóquelos en la mesa de trabajo. Coloque una gradilla de puntas vacía y limpie la placa de pocillos en la gradilla reutilizable. 10. Retire los tapones de los reactivos del msample Preparation System DNA excepto de los del frasco de micropartículas mmicroparticles DNA. Guarde los tapones en una superficie limpia y absorbente por si fuera necesario volver a tapar los frascos después del procesamiento. Coloque los frascos de los reactivos destapados en las posiciones asignadas del portagradillas de reactivos. Cargue el portagradillas de reactivos en la mesa de trabajo. 11. Antes de poner en marcha el sistema m24sp, compruebe que todas las muestras, controles y el tubo de mezcla de la solución proteinasa K estén destapados. Seleccione la plantilla correspondiente para procesar el ensayo HBV Sequencing en el sistema m24sp, teniendo en cuenta los recipientes de salida deseados: m24sp_hbv_seq_0.5ml_tube (para los tubos de 0,5 ml) m24sp_hbv_seq_0.5ml_dwp (para la placa de pocillos) 12. Inicie el protocolo de extracción de muestras del sistema Abbott m24sp según lo descrito en el capítulo Instrucciones de funcionamiento del Manual de funcionamiento del Abbott m24sp. 13. Cuando lo indique el sistema, mezcle con energía el contenido del mmicroparticles DNA hasta que las micropartículas se hayan resuspendido por completo. Destape e inmediatamente coloque el frasco de mmicroparticles DNA en el portagradillas de reactivos y continúe el procesamiento. Guarde los tapones en una superficie limpia y absorbente por si fuera necesario volver a tapar los frascos después del procesamiento. Los reactivos del msample Preparation System se pueden usar un máximo de 3 veces durante 14 días si se almacenan bien cerrados a una temperatura entre 15 C y 30 C. Nota: una vez terminado el protocolo de extracción de muestras y antes de iniciar la adición de la mezcla, las muestras procesadas pueden almacenarse en la placa de 96 pocillos o en los tubos de salida a una temperatura entre 2 C y 30 C hasta 4 horas o a una temperatura igual o inferior a 20 C hasta 7 días. Área de amplificación (m2000rt) 14. Encienda e inicie el instrumento Abbott m2000rt en el área de amplificación. El instrumento Abbott m2000rt tarda 15 minutos en calentarse. NOTA: quítese los guantes antes de volver a la zona de preparación de muestras. Área de preparación de muestras NOTA: cámbiese los guantes antes de manejar los reactivos de amplificación. 15. Una vez completada la preparación de la muestra, monte manualmente la mezcla del ensayo HBV Sequencing. Asegúrese de que los reactivos de amplificación estén completamente descongelados antes de su uso. Antes de abrir los reactivos de amplificación, asegúrese de que el contenido se encuentre en el fondo del tubo dando unos golpecitos al tubo en posición vertical sobre la mesa de trabajo. Los reactivos de amplificación no son de un solo uso y pueden usarse hasta con tres ciclos de congelación y descongelación adicionales. Nota: no mezcle en el vórtex los reactivos de amplificación. Combine los reactivos siguientes en tubos de microcentrífuga de 1,7 ml esterilizados: 6

7 Reactivo HBV Sequencing Pol PCR Mix UNG Enzima AmpliTaq Gold Volumen para 1 reacción (µl) 25,7 a 0,5 b 0,5 b Reactivo de activación 3,3 a Nota: prepare reacciones adicionales para compensar las pérdidas del pipeteo. a Nota: invierta los viales del HBV Sequencing Pol PCR Mix y del reactivo de activación 5 veces. Antes de abrirlos, golpee los viales en posición vertical sobre la mesa de trabajo. b Nota: pipetee la UNG y la enzima AmpliTaq lentamente para asegurar que se transfiere completamente. Agite con un Vórtex la mezcla (es decir, los 4 reactivos combinados de la tabla anterior) de 3 a 5 segundos. Configure la placa de la PCR manualmente: añada 30 µl de mezcla a cada pocillo en uso y 20 µl de cada muestra purificada. 16. Selle la placa de reacción óptica de 96 pocillos de Abbott tras la adición manual de la mezcla y de las muestras de acuerdo con el capítulo Instrucciones de funcionamiento del Manual de funcionamiento del sistema Abbott m24sp. 17. Coloque la placa de reacción óptica de 96 pocillos en la base soporte para placas para transferirla al instrumento Abbott m2000rt o a otro termociclador. 18. Proceda con el Protocolo II de preparación de muestras y continúe en el paso 18. Protocolo II de preparación de muestras (m2000sp) 1. En cada procesamiento, se pueden analizar un total 48 muestras. En cada procesamiento, se debe incluir un control negativo y un control positivo y, en consecuencia, sólo es posible analizar un máximo de 46 muestras por procesamiento. Nota: si se procesa una cantidad superior a 24 muestras, vacíe el contenedor de desechos sólidos antes del procesamiento y, en caso de que haya desechos, sustituya la bolsa para material biopeligroso por una nueva. Compruebe el volumen de muestra. El volumen de muestra mínimo del ensayo Abbott HBV Sequencing y los requisitos de los portatubos asociados para el sistema Abbott m2000sp son los siguientes: Volumen de Portatubos Diámetro del tubo* muestra mínimo 13 mm 11,5 mm - 14,0 mm 0,7 ml - 1,2 ml 16 mm 15,0 mm - 16,0 mm 0,8 ml - 1,4 ml * Se refiere al diámetro exterior del tubo de muestras. El volumen mínimo de muestra varía según la forma y el diámetro del tubo. Para información sobre el volumen de muestra recomendado, consulte el Manual de funcionamiento del sistema m2000sp y la guía de consulta rápida sobre volúmenes y tamaños de tubos de muestra. Si están congeladas, descongele las muestras a una temperatura de entre 15 C y 30 C o de entre 2 C y 8 C. Una vez descongeladas, si no va a procesar las muestras inmediatamente, almacénelas a una temperatura entre 2 C y 8 C hasta 6 horas. Antes del uso, mezcle con un vórtex las muestras tres veces de 2 a 3 segundos. Asegúrese de que no haya burbujas ni espuma. En el caso de que las hubiera, retírelas con una punta de pipeta esterilizada y nueva para cada tubo. Antes del análisis, las muestras que presenten partículas en suspensión o turbidez, se deben aclarar por centrifugación a 2000g durante 5 minutos. Dispense una alícuota de cada muestra en tubos o viales limpios, en caso necesario. Evite tocar el interior de los tapones de los tubos al abrirlos. Para información sobre los tamaños de los tubos, consulte el Manual de funcionamiento del Abbott m2000sp. 2. Descongele los controles del ensayo entre 15 C y 30 C o entre 2 C y 8 C. Una vez descongelados, si no va a procesar los controles inmediatamente, almacénelos a una temperatura entre 2 C y 8 C hasta 24 horas. Antes del uso, mezcle con un vórtex cada control del ensayo tres veces de 2 a 3 segundos. Asegúrese de que no haya burbujas ni se forme espuma. En el caso de que hubiera, retírelas con una punta de pipeta esterilizada y nueva para cada tubo. Asegúrese de que el contenido se encuentre en el fondo después de mezclar con el vórtex dando unos golpecitos al tubo sobre la mesa de trabajo para que el líquido se desplace al fondo. 3. Descongele los reactivos de amplificación a una temperatura de entre 15 C y 30 C o entre 2 C y 8 C hasta que los necesite para el procedimiento de amplificación de la mezcla. Este paso se puede iniciar antes de completar el procedimiento de preparación de la muestra. Nota: no mezcle en el vórtex los envases de reactivos de amplificación. Con cada envase de reactivos de amplificación se pueden realizar hasta 48 reacciones. Una vez descongelados y antes de su uso, los reactivos de amplificación se pueden almacenar a una temperatura entre 2 C y 8 C hasta 24 horas. 4. Abra el envase del reactivo de la proteinasa K. Añada 17,15 ml de agua grado biología molecular a un tubo de centrífuga de polipropileno de 50 ml. Pipetee 2,45 ml de la proteinasa K en este tubo. Invierta suavemente para mezclar el contenido entre 10 y 15 veces. Transfiera todo el contenido en un recipiente de reactivo debidamente etiquetado con el código de barras de la proteinasa K. Coloque el recipiente de reactivo en el portagradillas de reactivos nº 1, posición 2. Nota: use un frasco de la solución proteinasa K, un conjunto de reactivos del sistema msample Preparation System DNA (sistema de preparación de muestras) para llevar a cabo 24 reacciones, con la excepción de las micropartículas mmicroparticles DNA. Un frasco de mmicroparticles DNA es suficiente para llevar a cabo hasta 48 reacciones. No use más de un frasco de mmicroparticles DNA. 5. Abra el envase de reactivos del sistema Abbott msample Preparation System DNA. Si observa cristales en cualquiera de los frascos de reactivo al abrirlos, deje el reactivo a la temperatura ambiente hasta que los cristales desaparezcan. No utilice los reactivos hasta que los cristales se hayan disuelto. 6. Para preparar la solución mwash2 DNA, añada 70 ml de etanol con un grado USP (etanol al 95% - 100%) al frasco de mwash2 DNA, tal y como se describe en la información del producto msample Preparation System DNA. No utilice etanol que contenga desnaturalizantes. 7. Para asegurar que la solución sea homogénea, invierta los frascos del Abbott msample Preparation System DNA suavemente para mezclar su contenido y dispense el contenido en el recipiente de reactivo correspondiente según lo indicado en el capítulo Funcionamiento del instrumento del Manual de funcionamiento del sistema Abbott m2000sp. 8. Coloque el control negativo, el control positivo y las muestras de paciente en la gradilla de muestras del m2000sp. 9. Coloque los tubos de reacción de 5 ml en el subsistema de gradillas de 1 ml del sistema m2000sp. 10. Cargue los portagradillas con los reactivos Abbott msample Preparation System DNA y la proteinasa K y la placa de 96 pocillos, en la mesa de trabajo del Abbott m2000sp, tal y como se describe en el capítulo Instrucciones de funcionamiento del Manual de funcionamiento del Abbott m2000sp. 11. En la pantalla Run Sample Extraction (procesar extracción de muestras), seleccione el fichero de la aplicación apropiada. Inicie el protocolo Sample Extraction (extracción de muestras) que se describe en el capítulo Instrucciones de funcionamiento del Manual de funcionamiento del sistema m2000sp. Nota: una vez terminado el protocolo de extracción de muestras y antes de iniciar la adición de la mezcla, las muestras procesadas pueden almacenarse en la placa de 96 pocillos a una temperatura entre 2 C y 30 C hasta 4 horas o a una temperatura igual o inferior a 20 C hasta 7 días. 7

8 Área de amplificación (m2000rt o termociclador) 12. Encienda e inicialice el instrumento Abbott m2000rt o el termociclador en el área de amplificación. El instrumento Abbott m2000rt tarda 15 minutos en calentarse. Nota: quítese los guantes antes de volver a la zona de preparación de muestras. Área de preparación de muestras Nota: cámbiese los guantes antes de manejar los reactivos de amplificación. 13. Una vez completada la preparación de la muestra, monte manualmente la mezcla del ensayo HBV Sequencing. Asegúrese de que los reactivos de amplificación estén completamente descongelados antes de su uso. Antes de abrir los reactivos de amplificación, asegúrese de que el contenido se encuentre en el fondo del tubo dando unos golpecitos al tubo en posición vertical sobre la mesa de trabajo. Los reactivos de amplificación no son de un solo uso y pueden usarse hasta con tres ciclos de congelación y descongelación adicionales. Nota: no mezcle en el vórtex los reactivos de amplificación. Combine los reactivos siguientes en un tubo de microcentrífuga de 1,7 ml esterilizado o en tubo de mezcla: Reactivo HBV Sequencing Pol PCR Mix UNG Enzima AmpliTaq Gold Volumen para 1 reacción (µl) 25,7 a 0,5 b 0,5 b Reactivo de activación 3,3 a Nota: si utiliza el sistema m2000sp para la dispensación automática de la mezcla, prepare cinco reacciones adicionales de la mezcla para compensar las pérdidas del proceso. a Invierta el vial del HBV Sequencing Pol PCR Mix y el reactivo de amplificación 5 veces. Antes de abrirlos, golpee los viales en posición vertical sobre la mesa de trabajo. b Pipetee la UNG y la enzima AmpliTaq lentamente para asegurar que se transfieren por completo. Agite con un vórtex la mezcla (es decir, los 4 reactivos combinados de la tabla anterior) de 3 a 5 segundos. Si se ha preparado en un tubo de microcentrífuga, transfiera todo el contenido a un tubo de mezcla m2000 limpio. Cargue el tubo de mezcla destapado m2000 en la posición 1 del soporte del tubo de mezcla y coloque un envase de reactivo de ensayo vacío con el código de barras del HBV SEQ en la posición 1 del soporte del envase de reactivos de ensayo sobre la cubierta de salida del m2000sp. 14. En la pantalla Run Master Mix Addition (procesar adición de la mezcla) seleccione la placa de pocillos que corresponda al protocolo de extracción de muestras. Inicie el protocolo de adición de la mezcla del sistema Abbott m2000sp. Siga las instrucciones descritas en el capítulo Instrucciones de funcionamiento del Manual de funcionamiento del sistema Abbott m2000sp. El protocolo m2000rt (paso 18) debe iniciarse en los primeros 90 minutos de la iniciación del protocolo de adición de la mezcla (paso 14). Nota: si configura la placa de PCR manualmente, añada 30 µl de mezcla a cada pocillo en uso, y 20 µl de cada muestra purificada. 15. Selle la placa de reacción óptica de 96 pocillos según las instrucciones del capítulo Instrucciones de funcionamiento del Manual de funcionamiento del sistema Abbott m2000sp. 16. Coloque la placa de reacción óptica de 96 pocillos en la base de soporte para placas para transferirla al instrumento Abbott m2000rt. 17. Exporte todos los resultados de la placa de reacción óptica de 96 pocillos a un CD o unidad de red. Área de amplificación (m2000rt) 18. Coloque la placa de reacción óptica de 96 pocillos Abbott en el instrumento Abbott m2000rt. Si sigue las instrucciones del protocolo II de preparación de muestras (procedimiento m2000sp) importe la petición de ensayo m2000sp e inicie el protocolo Amplificación, tal y como se describe en el capítulo Instrucciones de funcionamiento del Manual de funcionamiento del Abbott m2000rt. Si sigue las instrucciones del Protocolo I de preparación de muestras (procedimiento m24sp) cree una petición de ensayo en el sistema m2000rt, en tipo de muestra, seleccione control. Después seleccione HBVSEQ_NEG para el control negativo y HBVSEQ_POS para el control positivo. Posteriormente, en tipo de muestra, seleccione paciente. Después introduzca manualmente los datos de identificación (ID) de esas muestras. Inicie el protocolo Amplificación, tal y como se describe en el capítulo Instrucciones de funcionamiento del Manual de funcionamiento del Abbott m2000rt. Si al final de la etapa 3, aparece el mensaje: 6304: PCR data acquisition complete. Run can be stopped at any time. Initiating hold. (Finalizó la adquisición de datos de PCR. Puede detener el procesamiento en cualquier momento. Iniciando espera). Ignore este mensaje hasta completar la etapa 4 y antes de detener el procesamiento, confirme que la temperatura de la muestra ha alcanzado los 4 C. Cierre la ventana emergente y detenga el procesamiento. Si el fichero del archivo o la lista de interpretaciones del m2000rt dice: Not detected See Package Insert, (no detectado, consúltense las instrucciones de uso), la muestra no ha amplificado correctamente y, por tanto, no debe seguir usándose en el proceso de ensayo. Como alternativa, el termociclado puede realizarse con un Perkin Elmer 9700 o equivalente con el siguiente perfil térmico: Segmento del ciclo Temperatura Tiempo Número de ciclos 1 50 C 10 minutos C 10 minutos C 20 segundos C 66 C 45 segundos 2 minutos 4 72 C 10 minutos C Mantener 1 Nota: si usa un termociclador Perkin Elmer 9700, confirme que el volumen de la reacción sea de 50 µl y que la velocidad de la rampa sea de modo Antes de cerrar la tapa e iniciar el programa, coloque una almohadilla de compresión en la placa de PCR. No deje la placa de reacción óptica en espera más de 24 horas. La actividad residual de UNG puede destruir el DNA amplificado. El procesamiento se considera válido si tanto el control negativo como el positivo son satisfactorios. 19. Retire la placa de reacción óptica de 96 pocillos del m2000rt o las muestras del termociclador y séllelas en una bolsa con cierre tipo zip para seguir procesándolas. Las muestras amplificadas pueden almacenarse a una temperatura igual o inferior a 10 C hasta 7 días antes de la purificación. PROCEDIMIENTOS POSTAMPLIFICACIÓN 20. Retire la placa de 96 pocillos de la mesa de trabajo y deséchela según las instrucciones del Manual de funcionamiento del Abbott m2000sp o consérvela según las instrucciones de uso del ensayo. 21. Limpie la base de soporte para placas antes de volver a utilizarla, tal y como se describe en el Manual de funcionamiento del Abbott m2000rt. 8

9 Área de secuenciación 22. Si la amplificación de PCR se realizó con el Perkin Elmer 9700 o equivalente, el éxito de la amplificación y los factores de dilución se determinan por electroforesis en gel. Para realizar la electroforesis en gel: Prepare gel de agarosa al 1% en tampón TAE a 1x con 0,5 µg/ml de bromuro de etidio. Asegúrese de que los pocillos puedan contener 6 µl de muestra. Dispense suficiente tampón TAE 1X con 0,5 µg/ml de bromuro de etidio hasta cubrir el gel. Retire el peine de gel. Descongele, en caso de estar congelado, el marcador de peso molecular de DNA y las muestras purificadas. En tubos separados, mezcle 5 µl de cada muestra y 1 µl de tampón de carga de gel. Prepare el marcador de peso molecular de DNA: Mezcle 1 µl de marcador de peso molecular de DNA, 4 µl de agua y 1 µl de tampón de carga de gel. La cantidad de fragmentos se muestra en la tabla siguiente: Cantidad de DNA (ng/ µl) Banda Tamaño del fragmento (Kb) 1 µl de marcador 1 2, , , , , ,1 2,5 Cargue el marcador de peso molecular de DNA y las muestras preparadas con 6 µl por carril. Tome nota de qué muestra se carga en cada carril. 23. Someta a electroforesis a 10 V/cm hasta que el colorante azul haya migrado al menos 5 cm de los pocillos. 24. Examine el gel con luz ultravioleta. 25. Registre la imagen con un tiempo de exposición que no sature la película y muestre las distintas intensidades de los fragmentos del marcador de peso molecular. Nota: los números de banda 4 a 6 pueden no ser visibles. 26. Examine cada resultado de muestra. Banda 1 (2,0 Kb, 50 ng) Banda 2 (1,2 Kb, 30 ng) Banda 3 (0,8 Kb, 20 ng) Banda 4 (0,4 Kb, 10 ng) Banda 5 (0,2 Kb, 5 ng) Marcador de peso molecular de DNA CN CP 1,0 Kb (1 023 bp) Si se encuentra una banda principal de producto de PCR entre la banda 2 (1,2 kb) y la banda 3 (0,8 Kb) del marcador de tamaño de DNA, se considera que la muestra se ha amplificado satisfactoriamente. También son aceptables otras bandas menores de menos intensidad. Si no se detecta ninguna banda entre 1,2 Kb y 0,8 Kb, la amplificación no ha sido satisfactoria. Validez del control negativo: no se detectan bandas entre 1,2 Kb y 0,8 Kb. Validez del control positivo: se detecta una banda principal entre 1,2 Kb y 0,8 Kb con una intensidad mayor o igual a 20 ng. Purificación del producto de la PCR: ExoSAP-IT o QIAGEN QIAquick 27. Existen dos opciones para la purificación de los productos de la PCR: ExoSAP-IT o QIAGEN QIAquick: Procedimiento con ExoSAP-IT: Programe el termociclador Perkin Elmer 9700 o equivalente con el siguiente perfil térmico: Segmento del ciclo Temperatura Tiempo Número de ciclos 1 37 C 15 minutos C 15 minutos 1 Nota: si usa un termociclador Perkin Elmer 9700, confirme que el volumen de la reacción sea de 14 µl y que la velocidad de la rampa sea de modo Deje el reactivo ExoSAP-IT a una temperatura igual o inferior a 10 C hasta su uso. No es necesario descongelar. En una placa de PCR nueva, añada 4 µl de ExoSAP-IT a tantos pocillos como muestras haya para purificar. Recordatorio: no siga procesando el control negativo o cualquier muestra que no amplifique. Transfiera 10 µl de cada muestra reactiva de la placa de PCR original a un pocillo que contenga 4 µl de ExoSAP-IT en una placa de PCR nueva. Antes de mezclar con el Vórtex de 3 a 5 segundos a rpm, selle la placa con una cubierta adhesiva óptica. Centrifugue la placa de 5 a 10 segundos a 2 000g. Coloque la placa en el termociclador e inicie el programa. Nota: si usa un termociclador Perkin Elmer 9700, antes de cerrar la tapa e iniciar el programa, coloque una almohadilla de comprensión en la placa de PCR. Proceda con la Dilución del producto de PCR purificado, paso 28. Procedimiento con QIAGEN QIAquick: Añada 250 µl de tampón PB a cada pocillo que contenga muestra. Transfiera cada mezcla a una columna de centrifugación en un tubo de recogida. Centrifugue durante 1 minuto a rpm. Elimine los desechos y coloque de nuevo la columna de centrifugación en el mismo tubo de recogida. Añada 750 µl de tampón PE (preparado con etanol según las instrucciones del etiquetado del producto) a cada columna de centrifugación en un tubo de recogida. Centrifugue durante 1 minuto a rpm. Coloque cada columna de centrifugación dentro de un tubo para microcentrífuga de 1,7 ml etiquetado. Añada 50 µl de tampón de EB a cada columna de centrifugación. Centrifugue durante 1 minuto a rpm. Retire la columna de centrifugación y tape los tubos de microcentrifugación. Tras la purificación, diluya la muestra inmediatamente o almacénela a una temperatura igual o inferior a 10 C hasta 7 días. Proceda con la Dilución del producto de PCR purificado, paso Requisito de dilución de producto de PCR purificado: Resultado del m2000rt o análisis de gel Dilución del producto de la PCR basada en el resultado del m2000rt: El archivo del fichero m2000rt o la lista de interpretaciones puede indicar Dilute 1:2 (diluya al 1:2) o Dilute 1:5 (diluya al 1:5) o Si el fichero del archivo o la lista de interpretaciones del m2000rt indica: Not detected See Package Insert, (no detectado, consúltense las instrucciones de uso), la muestra no ha amplificado correctamente y, por tanto, no debe seguir usándose en el proceso del ensayo. Dilución del producto de la PCR basado en análisis de gel: Si la intensidad de la muestra se sitúa entre las intensidades de la primera banda (50 ng) y la tercera banda (20 ng) del marcador de peso molecular de DNA, la muestra necesita ser diluida al 1:2. Si la intensidad de la banda de la muestra es mayor que la de la primera banda (50 ng) del marcador de peso molecular de DNA, la muestra necesita ser diluida al 1:5. 9

10 29. Métodos de dilución del producto de la PCR: ExoSAP-IT Purificado o QIAGEN QIAquick Purificado Método de dilución para productos de PCR purificados con ExoSAP-IT: Si la dilución es del 1:2: añada 10 µl de agua grado biología molecular al producto de PCR purificado y mézclelos con un vórtex. Si la dilución es del 1:5: añada 40 µl de agua grado biología molecular al producto de PCR purificado y mézclelos con un vórtex. Método de dilución para productos de PCR purificados con QIAGEN QIAquick: Si la dilución es del 1:2: añada 12 µl de agua grado biología molecular a 12 µl del producto de PCR purificado y mézclelos con un vórtex. Si la dilución es del 1:5: añada 40 µl de agua grado biología molecular a 10 µl del producto de PCR purificado y mézclelos con un vórtex. Secuenciación Nota: cada placa de secuenciación de 96 pocillos debe contener un replicado del control positivo. Dependiendo del número de muestras que se analicen, y del analizador genético que se use (3130 o 3130xl), puede ser necesaria la secuenciación de más de un replicado del control positivo. Estos controles positivos adicionales, si se necesitan, se preparan a partir del control positivo amplificado por PCR. Con el instrumento Applied Biosystem 3130xl, el procesamiento de 24 a 46 muestras necesitará un replicado adicional del control positivo para la segunda placa de secuenciación de 96 pocillos. Con el instrumento Applied Biosystem 3130, el procesamiento de 17 a 32 muestras necesitará una segunda placa de secuenciación. El procesamiento de 33 a 48 muestras requerirá una tercera placa de secuenciación. Cada placa adicional requiere un control positivo (CP). 30. Descongele los reactivos de secuenciación a una temperatura de entre 15 C y 30 C. Proteja el BigDye Terminator v3.1 de la luz. Una vez descongelados, use los reactivos inmediatamente. 31. Prepare las mezclas de secuenciación A a D. Antes del uso, mezcle con un Vórtex el BigDye y los cebadores de 2 a 3 segundos. Asegúrese de que no haya burbujas ni se forme espuma. En el caso de que hubiera, retírelas con una punta de pipeta esterilizada y nueva para cada tubo. Combine los siguientes reactivos en tubos de microcentrífuga etiquetados y esterilizados. Reactivo Volumen para 1 reacción (µl) BigDye Terminator v3.1 4,0 Cebador A, B, C o D 2,0 Volumen total 6,0 Nota: prepare reacciones adicionales de la mezcla para compensar las pérdidas del pipeteo. Nota: mezcle con un vórtex la mezcla de la secuenciación de 3 a 5 segundos. Nota: el BigDye Terminator v3.1 y los reactivos de los cebadores A, B, C o D no son de un solo uso y pueden usarse hasta con tres ciclos de congelación y descongelación adicionales. 32. Identifique cada placa de reacción de PCR de 96 pocillos y dispense 6 μl de la mezcla de secuenciación en los pocillos correspondientes. Consulte la Figura 1 como ejemplo de plantilla 96 reacciones. Figura 1 DIAGRAMA DE ADICIÓN DE LA MEZCLA DE SECUENCIACIÓN EN LA PLACA DE REACCIÓN DE PCR DE 96 POCILLOS A A A A A A A A A A A A A B B B B B B B B B B B B B C C C C C C C C C C C C C D D D D D D D D D D D D D E A A A A A A A A A A A A F B B B B B B B B B B B B G C C C C C C C C C C C C H D D D D D D D D D D D D Pipetee 6,0 µl de mezcla de ciclos de secuenciación A en los números de pocillos correspondientes en las filas A y E. Pipetee 6,0 µl de mezcla de ciclos de secuenciación B en los números de pocillos correspondientes en las filas B y F. Pipetee 6,0 µl de mezcla de ciclos de secuenciación C en los números de pocillos correspondientes en las filas C y G. Pipetee 6,0 µl de mezcla de ciclos de secuenciación D en los números de pocillos correspondientes en las filas D y H. 33. Transfiera 4,0 µl de muestras de producto de PCR diluido en la placa de reacción de 96 pocillos usando una punta de pipeta con filtro limpia y esterilizada por cada muestra. Consulte la Figura 2 para facilitar la adición de muestras a la placa de reacción de 96 pocillos. Figura 2 DIAGRAMA DE ADICIÓN DE LAS MUESTRAS EN LA PLACA DE REACCIÓN DE PCR DE 96 POCILLOS A CP S2 S4 S6 S8 S10 S12 S14 S16 S18 S20 S22 B CP S2 S4 S6 S8 S10 S12 S14 S16 S18 S20 S22 C CP S2 S4 S6 S8 S10 S12 S14 S16 S18 S20 S22 D CP S2 S4 S6 S8 S10 S12 S14 S16 S18 S20 S22 E S1 S3 S5 S7 S9 S11 S13 S15 S17 S19 S21 S23 F S1 S3 S5 S7 S9 S11 S13 S15 S17 S19 S21 S23 G S1 S3 S5 S7 S9 S11 S13 S15 S17 S19 S21 S23 H S1 S3 S5 S7 S9 S11 S13 S15 S17 S19 S21 S23 Nota: solo se deben secuenciar el control positivo y las muestras (reactivas) amplificadas. Ni el control negativo ni ninguna muestra que no amplifique deben someterse a los ciclos de secuenciación. 34. Selle la placa de reacción de PCR de 96 pocillos con una cubierta adhesiva óptica. Centrifugue la placa de reacción de 96 pocillos de 5 a 10 segundos a 2 000g. 35. Programe y ponga en marcha el termociclador Perkin Elmer 9700 o equivalente de acuerdo con el siguiente perfil térmico: Segmento de ciclo Temperatura Tiempo Número de ciclos 1 96 C 1 minuto C 10 segundos C 60 C 5 segundos 4 minutos 3 4 C Mantener 1 Nota: si usa un termociclador Perkin Elmer 9700, confirme que el volumen de la reacción sea de 10 µl y que la velocidad de la rampa sea de modo Antes de cerrar la tapa e iniciar el programa, coloque una almohadilla de comprensión en la placa de PCR. No almacene las muestras en el termociclador a una temperatura de 4 C durante más de 24 horas. Las muestras se pueden almacenar a una temperatura igual o inferior a 10 C hasta 3 días. 10

11 Purificación del producto de secuenciación: etanol/acetato de sodio o precipitación con isopropanol Existen dos opciones para la purificación del producto de secuenciación: el procedimiento de etanol/acetato de sodio (pasos 36 a 40) o el procedimiento de precipitación con isopropanol (pasos 41 a 44). 36. Procedimiento de etanol/acetato de sodio: combine los siguientes reactivos en un tubo de centrífuga esterilizado para la preparación de una solución en ese mismo momento: Solución de etanol/acetato de sodio Volumen para 1 reacción (µl) Acetato de sodio 3 M, ph 5,2 1,0 Etanol al 100% 25,0 Nota: prepare reacciones adicionales para compensar las pérdidas del pipeteo. Remueva o invierta suavemente para mezclar el contenido. Añada 26 µl de solución de etanol/acetato de sodio recién preparada a cada pocillo de muestra. Selle la placa de reacción de 96 pocillos con una cubierta adhesiva óptica y agite con un Vórtex la placa durante 1 minuto a rpm. Centrifugue la placa de reacción de 96 pocillos durante 20 minutos a 2000g. 37. Tan pronto como se detenga la centrífuga, retire con cuidado la cubierta adhesiva óptica sin alterar los sedimentos. Coloque inmediatamente papel absorbente en la superficie de la placa de reacción de 96 pocillos e inviértala. Coloque la placa de reacción de 96 pocillos en la centrífuga en la posición invertida, encima del papel absorbente y centrifugue durante 1 minuto a 150g. 38. Añada 75 µl de etanol al 70% en cada pocillo. Selle la placa de reacción de 96 pocillos con una cubierta adhesiva óptica. Centrifugue la placa de reacción de 96 pocillos durante 5 minutos a 2000g. Retire con cuidado la cubierta adhesiva óptica sin alterar los sedimentos. Coloque inmediatamente papel absorbente en la superficie de la placa de reacción de 96 pocillos e inviértala. Coloque la placa de reacción de 96 pocillos en la centrífuga en la posición invertida, encima del papel absorbente y centrifugue durante 1 minuto a 150g. 39. Cuando se detenga la centrífuga, retire la placa de la centrífuga y deje que se seque de 5 a 30 minutos, protegida de la luz. 40. Una vez seca, la placa se puede analizar inmediatamente. O sellarse y almacenarse en la oscuridad a una temperatura igual o inferior a 10 C hasta 7 días. 41. Procedimiento de isopropanol: combine los siguientes reactivos en un tubo de centrífuga esterilizado para la preparación de una solución en ese mismo momento: Solución de isopropanol al Volumen para 1 reacción (µl) 75% Agua desionizada 10,0 Isopropanol al 100% 30,0 Nota: prepare reacciones adicionales para compensar las pérdidas del pipeteo. Remueva o invierta suavemente para mezclar el contenido. Añada 40 µl de solución de isopropanol recién preparada a cada pocillo de muestra. Selle la placa de reacción de 96 pocillos con una cubierta adhesiva óptica y agite con un Vórtex la placa de 10 a 15 segundos a 1700 rpm. Incube las mezclas de muestras a temperatura ambiente en la oscuridad durante 15 minutos. Centrifugue la placa de reacción de 96 pocillos durante 45 minutos de 1500 a 2000g. 42. Tan pronto como se detenga la centrífuga, retire con cuidado la cubierta adhesiva óptica sin alterar los sedimentos. Coloque inmediatamente papel absorbente en la superficie de la placa de reacción de 96 pocillos e inviértala. Coloque la placa de reacción de 96 pocillos en la centrífuga en la posición invertida, encima del papel absorbente y centrifugue durante 1 minuto a 700g. 43. Cuando se detenga la centrífuga, retire la placa de la centrífuga y deje que se seque de 5 a 30 minutos, protegida de la luz. 44. Una vez seca, la placa se puede preparar inmediatamente para el análisis, o sellarse y almacenarse en la oscuridad a una temperatura igual o inferior a 10 C hasta 7 días. 11

12 Secuenciación Para obtener las instrucciones de uso, consulte las guías de los analizadores genéticos Applied Biosystems 3130/3130xl Genetic Analyzers Getting Started Guide, nº de referencia de Applied Biosystems: , Rev. B, 11/2004, o siguientes; Applied Biosystems 3130/3130xl Genetic Analyzers Maintenance, Troubleshooting y Reference Guide, nº de referencia de Applied Biosystems: , Rev. B, 11/2004 o siguientes y la versión de software 2.5 de la User Guide de SeqScape, nº de referencia de Applied Biosystems: , Rev. A o siguientes. El protocolo del análisis HBV_SEQ y los ficheros de la plantilla del proyecto HBV_SEQv2 se suministran en el CD-ROM de aplicaciones del ensayo HBV Sequencing y se pueden importar directamente a SeqScape. En las siguientes instrucciones de uso se asume que el ordenador del AB Genetic Analyzer 3130/3130xl está equipado con la versión 2.5 o superiores del software SeqScape y tiene el protocolo de análisis HBV_ SEQ y la plantilla del proyecto HBV_SEQv2 importado. En el protocolo de análisis se asume el uso de POP7, Big Dye v3.1 y matriz capilar de 50 cm. El software SeqScape HBV_SEQv2 informa sobre las siguientes variantes de aminoácidos del VHB clínicamente relevantes. Los usuarios deben crear un Grupo de resultados y un Protocolo del instrumento. Protocolo Tipo de configuración Configuración Protocolo del instrumento Run module (módulo de procesamiento) StdSeq50_POP_7_1 Conjunto de colorantes Z_BigDyeV3 Protocolo / Otros Pestaña Tipo de configuración Configuración Protocolo del Analysis Aplication (aplicación del análisis) SeqScape análisis HBV_SEQ General Name (nombre) HBV_SEQ Base-calling Base-caller (lector de nucleótidos) KB.bp (lectura de nucleótidos) DyeSet/Primer (colorante/cebador) KB_3130_POP7_BDTv3.mob Processed Data (datos procesados) True Profile (perfil verdadero) Quality Threshold (umbral de calidad) Do not assign N s to Basecalls (no asigne N s al lector de nucleótidos) Mixed Bases (mezcla de bases) Mixed Bases (mezcla de bases) Seleccione Use Mixed Base Identification (use identificación de mezcla de bases) Plantilla del proyecto Clear Range (eliminar intervalo) Filter (filtro) HBV_SEQv2 Use Quality Values (usar valores de calidad) Use Reference Trimming (usar recorte de referencia) Maximum Mixed Bases (%) (bases mixtas máximas) Call IUB if 2nd highest peak is > 30% (llamar IUB si 2º pico máximo es > 30% Seleccione Remove bases from the ends until fewer than 4 bases out of 20 have QVs < 20 (retirar bases de los extremos hasta un nº inferior a 4 bases de 20 tengan QV < 20) Select (seleccionar) Maximum Ns (%) (Ns máximo) 10.0 Minimum Clear Length (bp) (longitud clara 50 mínima) Minimum Sample Score (puntuación mínima 20 de la muestra) Reference Data Group (grupo de datos de HBV_SEQv2 referencia) Analysis Defaults (valores preprogramados del HBV_SEQ análisis) Display Settings (configuración de la pantalla) Default Display Settings for SeqScape v2.0 (configuración de la pantalla preprogramada para SeqScape v2.0) 20.0 Valores preprogramados del análisis General Analysis Defaults Name (nombre de los HBV_SEQ valores preprogramados del análisis) Project (proyecto) Gap Penalty (penalización por hueco) 30.0 Extension Penalty (penalización por longitud) 1.0 Couple the amino acid alignment to the Select (seleccionar) nucleotide alignment (asociar el alineamiento de aminoácidos con el de nucleótidos) Specimen Gap Penalty (penalizacion por hueco) 22.5 (espécimen) Extension Penalty (penalización por longitud) 8.5 Number of Library Matches (nº de 20 coincidencias) Basecall Samples (muestras asignadas) Select (seleccionar) Sample (muestra) Analysis Protocol (protocolo del análisis) HBV_SEQ Always Use this Analysis Protocol (use siempre este protocolo de análisis) Select (seleccionar) 12

13 Protocolo / Otros Pestaña Tipo de configuración Configuración Display Settings (configuración de la pantalla) Default Display Setting (configuración de la pantalla preprogramada) Default (valor preprogramado) Select (seleccionar) Reference Data Group RDG Properties (propiedades del grupo datos de referencia) General Reference Data Group Name (nombre del grupo de datos de referencia) HBV_SEQv2 Codon Table (cuadro de codones) Standard (estándar) ROI Layer Reference: National Center for Biotechnology Information (NCBI) reference genotype A: X70185 [referencia] Layer Drug Resistance (tipo de resistencia with Translation (con traslación) al fármaco) Layer Validity Range (intervalo validez) with Translation (con traslación) NT Variants (variantes) Tipo Posición NT Referencia Variante Descripción Resistencia al fármaco 238 T A 238A (Drug Resistance) Resistencia al fármaco 238 T G 238G Resistencia al fármaco 506 T C 506C Resistencia al fármaco 517 G C 517C Resistencia al fármaco 517 G T 517T Resistencia al fármaco 538 T A 538A Resistencia al fármaco 539 T G 539G Resistencia al fármaco 540 G C 540C Resistencia al fármaco 540 G T 540T Resistencia al fármaco 541 G A 541A Resistencia al fármaco 541 G T 541T Resistencia al fármaco 542 C T 542T Resistencia al fármaco 550 A C 550C Resistencia al fármaco 550 A G 550G Resistencia al fármaco 550 A T 550T Resistencia al fármaco 551 C G 551G Resistencia al fármaco 551 C T 551T Resistencia al fármaco 552 T G 552G Resistencia al fármaco 580 G A 580A Resistencia al fármaco 604 A G 604G Resistencia al fármaco 604 A T 604T Resistencia al fármaco 605 G T 605T Resistencia al fármaco 610 A G 610G Resistencia al fármaco 610 A T 610T Resistencia al fármaco 611 T C 611C Resistencia al fármaco 611 T G 611G Resistencia al fármaco 612 G A 612A Resistencia al fármaco 612 G C 612C Resistencia al fármaco 612 G T 612T Resistencia al fármaco 641 T C 641C Resistencia al fármaco 643 C T 643T Resistencia al fármaco 644 A C 644C Resistencia al fármaco 697 A G 697G Resistencia al fármaco 707 A C 707C Resistencia al fármaco 748 A C 748C Resistencia al fármaco 748 A G 748G Resistencia al fármaco 750 G A 750A Resistencia al fármaco 750 G C 750C Resistencia al fármaco 750 G T 750T 13

14 Protocolo / Otros Pestaña Tipo de configuración Configuración Reference Data Group AA Variants Tipo Posición AA Referencia Variante Descripción RDG Properties (propiedades del grupo de datos de referencia) (variantes AA) Resistencia al fármaco 80 L I 80I Resistencia al fármaco 80 L V 80V Resistencia al fármaco 169 I T 169T Resistencia al fármaco 173 V L 173L Resistencia al fármaco 180 L C 180C Resistencia al fármaco 180 L M 180M Resistencia al fármaco 181 A S 181S Resistencia al fármaco 181 A T 181T Resistencia al fármaco 181 A V 181V Resistencia al fármaco 184 T A 184A Resistencia al fármaco 184 T C 184C Resistencia al fármaco 184 T F 184F Resistencia al fármaco 184 T G 184G Resistencia al fármaco 184 T I 184I Resistencia al fármaco 184 T L 184L Resistencia al fármaco 184 T M 184M Resistencia al fármaco 184 T S 184S Resistencia al fármaco 194 A T 194T Resistencia al fármaco 202 S C 202C Resistencia al fármaco 202 S G 202G Resistencia al fármaco 202 S I 202I Resistencia al fármaco 204 M I 204I Resistencia al fármaco 204 M S 204S Resistencia al fármaco 204 M V 204V Resistencia al fármaco 214 V A 214A Resistencia al fármaco 215 Q S 215S Resistencia al fármaco 233 I V 233V Resistencia al fármaco 236 N T 236T Resistencia al fármaco 250 M I 250I Resistencia al fármaco 250 M L 250L Resistencia al fármaco 250 M V 250V Variant Style (variantes) Variant Styles (variantes) Variant Settings (configuración de las variantes) Nombre del estilo: Variantes de resistencias al fármaco: Primera opción - verde - Posible opción - rojo Variantes NT: Cambio de base conocido - Azul Inserción conocida Rojo Deleción conocida Negro Cambio de base desconocido Verde Inserción desconocida Magenta Deleción desconocida Amarillo Posición crucial Azul Variantes AA Cambio de residuo conocido - Variante resistente al fármaco Inserción conocida Rojo Deleción conocida Negro Cambio residuo desconocido Verde Inserción desconocida Magenta Deleción desconocida Amarillo Mutación silenciosa - Rojo Nota: activar Audit Trail para la captura de modificaciones manuales de secuencias, tras abrir el software SeqScape, seleccione Options (opciones) y, a continuación, seleccione Audit. En Audit Trail, seleccione Audit Trail On. 14

15 45. Para efectuar la electroforesis en el analizador genético 3130/3130xl de Applied Biosystems proceda como sigue: 46. Encienda el ordenador y acceda a Windows. 47. Pulse el botón on/off (encendido/apagado) en la parte frontal del secuenciador. Antes de encender el instrumento, verifique que la puerta de la estufa esté cerrada y con llave, y que estén cerradas las puertas del instrumento. Antes de seguir, compruebe que esté encendida la luz de estado verde y que no esté intermitente. Si no se enciende la luz verde, ponga en marcha el software Data Collection (recopilación de datos) y vea el log. 48. Seleccione el icono Data Collection en el escritorio del ordenador para iniciar el 3130/3130xl Data Collection v3.0. A medida que se activan las aplicaciones, los círculos rojos (apagado) cambian a triángulos amarillos (activando), y después cambian a cuadrados verdes (encendido) cuando están a pleno funcionamiento. 49. En Data Collection, seleccione + para despleguar las subcarpetas en el panel del árbol izquierdo. 50. Compruebe que se hayan completado las tareas de mantenimiento del analizador genético diarias, semanales, mensuales y según necesidad. Consulte el capítulo 1 de la guía Applied Biosystems 3130/3130xl Genetic Analyzers Maintenance, Troubleshooting, and Reference Guide y los capítulos 2 y 3 de la guía Applied Biosystems 3130/3130xl Genetic Analyzers Getting Started Guide. 51. Asegúrese de que la matriz capilar de 50 cm está en el instrumento. Cada capilar está diseñado para un mínimo de 100 procesamientos. El número real de procesamientos puede verse seleccionando Instrument Status (estado del instrumento) en el panel del árbol izquierdo. 52. El frasco de polímero POP-7 no debe permanecer en el instrumento durante más de 7 días. Para sustituir el frasco de polímero POP-7, seleccione Refresh Polymer Wizard (asistente de sustitución de polímero) en el menú de asistente de ayuda y siga las instrucciones de la pantalla. 53. Prepare tampón de secuenciación 1X fresco combinando 5 ml de tampón de secuenciación 10X con 45 ml de agua grado HPLC. Antes de cada procesamiento, sustituya el tampón de secuenciación 1X. Llene hasta las marcas de llenado de los recipientes del ánodo (posición 1 en la bandeja) y cátodo (próxima al frasco POP7). 54. Aclare y rellene los recipientes de agua (posiciones 2 y 4 en la bandeja) con agua grado HPLC. Posición 2 Agua Posición 1 Tampón de secuenciación 1X Posición 4 Agua Posición 3 Vacío 55. Retire las burbujas del bloque de la bomba y los conductos Si hubiera burbujas, seleccione Bubble Remove Wizard (asistente de ayuda para eliminar burbujas) en el menú de asistencia de ayuda y siga las instrucciones de la pantalla. 56. Cree un nuevo registro para la placa. En el panel del árbol del software Data Collection (recopilación de datos), seleccione Plate Manager (gestor de la placa) Seleccione New (nuevo) para visualizar en el cuadro del diálogo New Plate (placa nueva). Escriba un nombre para la placa. Describa la placa (opcional). Seleccione SeqScape_(Instrument Name) (nombre del instrumento) en la lista desplegable de aplicaciones. Seleccione 96-well (96 pocillos) en la lista desplegable de Plate Type (tipo de placa). Escriba un nombre para el propietario y el usuario. 57. Seleccione OK y abra SeqScape Plate Editor (editor de placa). En la columna Sample Name (nombre de muestra), introduzca un nombre de muestra para cada muestra. Use el formato: xxxxxxxxxx-a, xxxxxxxxxx-b, xxxxxxxxxx-c, xxxxxxxxxx-d para designar cada muestra que está siendo secuenciada por cada cebador de secuenciación. 58. La columna Priority (prioridad) puede modificarse para cambiar la prioridad de procesamiento de la muestra. Automáticamente se asigna una prioridad de 100. Para disminuir la prioridad de una muestra use un número mas bajo. 59. En la columna Comments (observaciones), introduzca las observaciones para la muestra (opcional). 60. Seleccione una celda en la columna Project (proyecto) y seleccione Create New Project (crear proyecto nuevo). Una vez que se abre la ventana Create New Project (crear proyecto nuevo), escriba el nombre del proyecto y seleccione Project Template (plantilla del proyecto) HBV_SEQv2. Seleccione OK. La plantilla del proyecto seleccionada aparecerá en la columna Project Template. 61. Seleccione una celda en la columna Specimen y seleccione Create New Specimen (crear espécimen nuevo). Cree un nuevo ID de espécimen para cada muestra. Un espécimen se compone de 4 muestras. Use el formato xxxxxxxxxx para el nombre del espécimen. Use el mismo nombre de espécimen para cada una de las cuatro muestras. Un nombre de espécimen puede constar de 1 a 10 caracteres. 62. Seleccione una celda en la columna Results Group 1 (grupo de resultados 1) y seleccione el grupo de resultados creado por el usuario. 63. Seleccione una celda en la columna del Protocolo 1 del instrumento y seleccione el protocolo del instrumento creado por el usuario) 64. Seleccione una celda en el Protocolo 1 del análisis y seleccione HBV_SEQ. 65. Rellene las celdas vacías de cada columna para completar el registro de la placa. 66. Seleccione OK para guardar, después cierre el Plate Editor (editor de placas) de SeqScape. Prepare las placas para la reacción del analizador genético 3130/3130xl 67. Añada 20 µl de formamida HiDi a cada pocillo que contenga una reacción de secuenciación. Importante: la formamida HiDi debe añadirse a todos los pocillos en los que se introducirá la matriz capilar, contengan una reacción de secuenciación o no. El analizador genético 3130xl procesa 16 muestras, organizadas en dos columnas adyacentes en la placa, simultáneamente. Si un conjunto de dos columnas (por ej. columnas 1 y 2 o columnas 7 y 8) están sólo parcialmente cargadas con muestras, el resto de pocillos vacíos dentro de esas dos columnas deben rellenarse con 20 µl de formamida HiDi para asegurar que los 16 capilares se sumergen durante el procesamiento. Nota: tras la resuspensión en formamida HiDi, las reacciones de secuenciación se mantienen estables un total de 35 horas a temperatura ambiente y protegidas de la luz. 68. Selle la placa de reacción de PCR de 96 pocillos con una cubierta adhesiva óptica y agite la placa con un vórtex de 10 a 15 segundos a 1700 rpm. 69. Centrifugue la placa de reacción de PCR de 96 pocillos de 30 a 40 segundos a 2 000g. 70. Prepare el conjunto de la placa. Retire el sello, si lo tiene, de la placa que se va a analizar. Coloque un septo plano sobre la placa. Alinee los orificios de la tira del septo con los pocillos de la placa, presione, después, hacia abajo con firmeza sobre la placa. Coloque la placa de muestras en el soporte de la placa. Cierre la placa en el soporte de la placa. Verifique que los orificios del depósito de la placa y los septos estén alineados. Si no lo están, reajuste el conjunto de la placa. 71. Cargue la placa en el cargador automático de muestras. Pulse el botón de la bandeja y espere a que el cargador automático de muestras se detenga en la posición de delante. Abra las puertas frontales. Coloque el conjunto de la placa en el cargador automático de muestras en la posición A o B. Nota: existe una única orientación para la placa, con el extremo de la muesca del soporte de la placa alejado del usuario. 15

16 Asegúrese de que el conjunto de la placa se ajusta plano en el cargador automático de muestras. Si no está ajustado, las puntas capilares pueden levantar el conjunto de la placa fuera del cargador automático de muestras. Cierre las puertas del instrumento y, antes de seguir, espere a que la luz de estado verde deje de estar intermitente. Inicie el procesamiento del análisis de secuenciación 72. En el panel del árbol del software Data Collection (recopilación de datos), seleccione Plate View (ver placa) 73. Seleccione Find All (encontrar todo). 74. Seleccione el registro de la placa apropiado que se va a procesar. 75. Seleccione el indicador sobre la posición de la placa apropiada (A o B, en amarillo) para vincular el registro de las placas con las placas de reacción en el secuenciador. El color del mapa de la placa cambiará de amarillo a verde si la vinculación ha sido satisfactoria. 76. En la barra de herramientas de la ventana del software Data Collection (recopilación de datos), seleccione la flecha verde para iniciar el procesamiento. Seleccione OK. Procedimientos de análisis postsecuenciación 77. Tras haberse completado el procesamiento del análisis, retire el conjunto de la placa del analizador genético y desmonte el soporte de la placa. Nota: la placa de reacción se puede reanalizar si así se requiere, pero el tiempo total a temperatura ambiente no debe superar las 35 horas. 78. Antes de eliminar los desechos sólidos biopeligrosos, selle la placa y los septos en una bolsa con cierre tipo zip. 79. Si fuera necesario apagar el equipo durante un periodo corto o largo, consulte el capítulo 1 de la guía de Applied Biosystems 3130/3130xl Genetic Analyzers Maintenance, Troubleshooting, and Reference Guide. 80. Copie los ficheros de procesamiento AB 3130xl a un CD-ROM. Introduzca el CD-ROM en la unidad de CD-ROM. Acceda al escritorio del ordenador. Abra las carpetas de los datos de las secuencias. Seleccione los ficheros de procesamiento aplicables de acuerdo a la fecha y la hora de procesamiento. Nota: un fichero de procesamiento 3130xl contiene datos para un máximo de 16 muestras (4 especímenes). Un procesamiento que analice 5 especímenes (20 muestras) se guardará en 2 ficheros de procesamiento. Haga clic con el botón derecho sobre los ficheros seleccionados. Acceda a Send To > (enviar a) y después seleccione DVD-RW Drive (unidad DVD-RW) en el menú desplegable. Acceda y abra la ventana de la unidad de DVD-RW en el Explorer. Deben aparecer enumerados los ficheros que se quieren copiar. En el menú CD Writing Tasks (tareas de archivo del CD) seleccione Write these files to CD (archive estos ficheros en el CD) para abrir el asistente de archivo en CD. Continue según las instrucciones indicadas y seleccione Finish (terminar) cuando se haya completado el copiado. Análisis de datos 81. Una vez que se ha completado el procesamiento, abra el software SeqScape. 82. Seleccione New Project (proyecto nuevo) y nombre el proyecto con el mismo nombre que se le dio durante la configuración del registro de la placa en Data Collection. 83. En el cuadro de proyecto nuevo, seleccione la plantilla HBV_SEQv2. Seleccione New (nuevo). 84. Seleccione Import Samples To Project (importar muestras al proyecto) en el menú de ficheros. En el cuadro de diálogo Import Samples (importar muestras), seleccione el botón con el nombre de la muestra, y acceda al archivo que contiene los ficheros de procesamiento. Selecciones los ficheros que contienen los datos de procesamiento. Seleccione Auto Add. Seleccione OK. 85. Seleccione la flecha verde en la barra de herramientas para iniciar el análisis. 86. Una vez que se completa el análisis, en la barra de menú Active Layer (nivel activo), seleccione Drug Resistance (resistencia al fármaco) y después seleccione Project Name (nombre del proyecto) (fila superior de la ventana Project Navigator [navegador del proyecto]). 87. En Analysis (análisis), seleccione Report Manager (gestor de informes) y después seleccione Specimen Statistics Report (informe estadístico de la muestra). Para cada muestra (control positivo y cada espécimen), verifique que el intervalo de referencia cubre los nucleótidos 337:909, el número de muestras es 3 o 4, y que contiene una secuencia continua (en la columna Continuous column dice Yes (sí)). Las muestras que non cumplen todos estos criterios no se consideran válidas. 88. En Reports (informes) seleccione AA Variants Report (informe de variantes AA). Compruebe para cada muestra (control positivo y cada espécimen), si la columna Description (descripción) del AA Variants Report (informe de variantes AA) contiene alguna variante de aminoácidos clínicamente relevante. Si se detecta alguna mutación de aminoácidos clínicamente relevante, se debe comprobar la exactitud de esta determinación para la muestra relevante. Seleccione la columna NT Change (cambio NT) del AA Variants Report y, en cada caso, seleccione la correspondiente Base Change (cambio de base) del Mutations Report (informe de mutaciones). Para comprobar los electroferogramas de la muestra relevante, seleccione el triángulo que precede al Specimen Name (nombre de muestra) en Project View (ventana proyecto). Si se requiere, se puede modificar la base de nucleótidos. Después de verificar y modificar, el control positivo se considera no válido si contiene aminoácidos clínicamente relevantes. 89. Para exportar las secuencias de aminoácidos o nucleótidos de todo el procesamiento, seleccione Project Name (nombre de proyecto) (fila superior de la ventana Project Navigator (navegador del proyecto), seleccione el nivel Drug Resistance (resistencia al fármaco) o Validity Range (intervalo de validez). Para exportar las secuencias de nucleótidos, seleccione Export (exportar) en el menú File (archivo) y después seleccione Project Alignment - Nucleotides (alineación de proyecto - nucleótidos). En la ventana Export Project NT Alignment (exportar proyecto de alineación NT), elija un sitio para guardar el fichero y seleccione el botón Export (exportar). Para exportar las secuencias de aminoácidos, seleccione Export (exportar) en el menú File (archivo) y después seleccione Project Alignment Amino Acid (alineación proyecto - aminoácidos). En la ventana Export Project AA Alignment (exportar proyecto alineación AA), elija un sitio para guardar el fichero y seleccione el botón Export (exportar). 90. Para exportar los informes SeqScape del procesamiento completo, seleccione el Project Name (nombre del proyecto) (fila superior de la ventana Project Navigator) y seleccione el nivel Drug Resistance. En Analysis (análisis), seleccione Report Manager (gestor de informes) y después, seleccione Specimen Statistics Report, AA Variants Report (informe estadístico de la muestra, informe de variantes AA), o Audit Trail Report (informe de pista de auditoria) (si se ha activado la pista de auditoria y se han realizado modificaciones). Seleccione Export en el menú File, y después seleccione Report (informe). En la ventana Export Report (exportar informe), elija un sitio para guardar el fichero, y seleccione el botón Export (exportar). 91. Las secuencias de consenso de los especímenes pueden enviarse a programas basados en Web para la interpretación clínica. PROCEDIMIENTOS DE POSTSECUENCIACIÓN 92. Almacene las muestras (sin procesar, post-pcr, postpurificación, etc.) tal y como se recomienda en el procedimiento. 93. Para minimizar los riesgos de salud, y la propagación potencial de producto amplificado, asegúrese de que los materiales desechables (guantes, puntas, etc.) se eliminen en bolsas selladas que después se someten a la esterilización por autoclave. PROCEDIMIENTOS DE CONTROL DE CALIDAD Calibración óptica del sistema Abbott m2000rt Si desea información sobre cómo realizar una calibración óptica en el sistema Abbott m2000rt, consulte el capítulo Procedimientos de calibración del Manual de funcionamiento del Abbott m2000rt. 16

17 Se requiere una calibración óptica del instrumento Abbott m2000rt para la medición precisa y la diferenciación entre los fluoróforos durante el procesamiento del ensayo Abbott HBV Sequencing. Las siguientes placas de calibración óptica del Abbott m2000rt se utilizan para calibrar el instrumento Abbott m2000rt para procesar el ensayo Abbott HBV Sequencing: Placa ROX (carboxi-x-rodamina) Placa Cy5 (cianina) Controles positivo y negativo En cada procesamiento se incluye un control positivo y otro negativo para evaluar la validez del procesamiento. Si un resultado de control se encuentra fuera del intervalo establecido, se visualiza un error. Para obtener información sobre las medidas correctivas de un código de error, consulte el Manual de funcionamiento del Abbott m2000rt. Si los controles positivo o negativo están fuera del intervalo, se deben volver a procesar todas las muestras y los controles de ese procesamiento desde el paso de la preparación de la muestra. No se debe detectar presencia de VHB en el control negativo. La presencia de VHB en el control negativo es indicio de contaminación por otras muestras o por producto amplificado durante la preparación de la muestra o durante la preparación de la placa de reacción óptica de 96 pocillos. Para evitar la contaminación, limpie los instrumentos Abbott m2000sp, m24sp y m2000rt y repita el procesamiento para los controles y las muestras según las Precauciones de procedimiento. Si los controles negativos son persistentemente reactivos, póngase en contacto con el Centro de Asistencia Técnica de Abbott Molecular. Tras haber completado la PCR y la electroforesis en gel opcional, sólo se debe seguir procesando el control positivo. El control positivo ayuda a determinar si el ciclo de secuenciación y la electroforesis capilar se realizaron correctamente. Si el control positivo no es válido, considere repetir los ciclos de secuenciación y la electroforesis capilar. El ensayo se correlaciona con el patrón internacional para el DNA del virus de la hepatitis B de la Organización Mundial de la Salud (OMS) (NIBSC Code 97/746). 15 Seguimiento del laboratorio para comprobar la presencia de producto amplificado Se recomienda realizar este análisis al menos una vez al mes para comprobar si se ha producido contaminación por producto amplificado en las superficies y el equipo del laboratorio. Es muy importante analizar todas las zonas de trabajo que puedan haber estado expuestas a muestras y controles procesados, calibradores y/o a producto amplificado. Esto incluye objetos de uso habitual como pipetas, las teclas de función de los sistemas Abbott m2000sp, m24sp y m2000rt, las superficies de trabajo del laboratorio, las microcentrífugas y los adaptadores de las centrífugas. 1. Añada 0,8 ml de agua grado biología molecular a un tubo de microcentrífuga de 1,7 ml libre de DNasas. 2. Empape la punta de una torunda de algodón (Puritan o equivalente) en agua grado biología molecular. 3. Con esta torunda de algodón empapada limpie con un movimiento de barrido el área que desea monitorizar. Coloque la torunda en el tubo de microcentrífuga. 4. Agite la punta en el agua grado biología molecular 10 veces y presione el aplicador en la pared del tubo de forma que el líquido se desprenda y caiga dentro de la solución en el fondo del tubo de microcentrífuga. Deseche la torunda. 5. Pipetee 0,5 ml de tampón de solución de lavado mwash 1 a un tubo limpio. 6. Añada 20 µl de tampón de solución de lavado mwash 1 en cada tubo de microcentrífuga. 7. Cierre el tubo de microcentrífuga con la tapa. 8. Analice la muestra según lo descrito en el apartado Procedimiento del ensayo en estas instrucciones de uso. 9. Transfiera el líquido del tubo de microcentrífuga a un tubo de reacción de 5 ml. 10. Añada agua grado biología molecular hasta alcanzar un volumen total de 1,5 ml. 11. La detección de VHB en las muestras de las torundas indica la presencia de contaminación. 12. Si se detecta VHB en el equipo, siga las directrices de descontaminación y limpieza indicadas en el manual de operaciones del equipo correspondiente. Si se detecta VHB en las superficies de trabajo, limpie las zonas contaminadas con solución de hipoclorito de sodio al 1,0% (v/v), seguido de etanol al 70% o agua. Nota: las soluciones de cloro pueden dejar marcas en el equipo y en el metal. Utilice cantidades suficientes o repita las aplicaciones de etanol al 70% o agua hasta que ya no sean visibles los residuos de cloro. 13. Repita el análisis de la zona contaminada siguiendo los pasos 1 a 10. RESULTADOS Abbott HBV Sequencing es un ensayo cualitativo. Para establecer la validez del procesamiento, se debe utilizar como mínimo un control negativo y un control positivo. Para más información sobre los códigos de error y las alertas en el sistema m2000, consulte los manuales de funcionamiento de los sistemas Abbott m2000sp o m2000rt. Comunicación de los resultados Se producen dos tipos de resultados: Post-PCR: estos datos se usan para determinar si las muestras se amplificaron correctamente, y en caso afirmativo, la dilución requerida del producto amplificado antes de la secuenciación. Dilución del producto de PCR basada en el resultado del m2000rt: El archivo del fichero m2000rt o la lista de interpretaciones puede indicar Dilute 1:2 (diluya al 1:2) o Dilute 1:5 (diluya al 1:5) o Si el fichero del archivo o la lista de interpretaciones del m2000rt indica: Not detected See Package Insert, (no detectado, consúltense las instrucciones de uso), la muestra no ha amplificado correctamente y por tanto, no debe seguir usándose en el proceso del ensayo. Como alternativa, en caso de que no se haya usado un instrumento m2000rt y la amplificación de PCR se haya realizado con un sistema Perkin Elmer 9700 o equivalente, el éxito de la amplificación y los requisitos de dilución se obtienen con la electroforesis en gel. Dilución del producto de la PCR basada en el análisis del gel: Si la intensidad de la muestra se sitúa entre las intensidades de la primera banda (50 ng) y la tercera banda (20 ng) del marcador de peso molecular de DNA, la muestra se debe diluir al 1:2. Si la intensidad de la banda de la muestra es mayor que la de la primera banda (50 ng) del marcador de peso molecular de DNA, la muestra se debe diluir al 1:5. Postsecuenciación: los datos de la secuencia de nucleótidos se obtienen con la electroforesis capilar. El SeqScape se usa para analizar los datos de la secuenciación del DNA. Las secuencias de las muestras pueden analizarse posteriormente en programas de la web. LIMITACIONES DEL PROCEDIMIENTO Para uso exclusivo en diagnóstico in vitro. El rendimiento óptimo de este ensayo requiere la recogida, el almacenamiento y el transporte adecuados de las muestras (consulte el apartado RECOGIDA, ALMACENAMIENTO Y TRANSPORTE DE LAS MUESTRAS AL LABORATORIO en estas instrucciones de uso). Con el ensayo HBV Sequencing, se pueden usar muestras de suero y plasma humanos (recogido con ACD, EDTA y CPD). No se ha validado el uso de otros anticoagulantes con el ensayo Abbott HBV Sequencing. Los instrumentos y los procedimientos del ensayo reducen el riesgo de contaminación por producto amplificado. Sin embargo, la contaminación por ácido nucleico de los calibradores, controles positivos o muestras se debe controlar mediante las buenas prácticas de laboratorio y siguiendo adecuadamente los procedimientos especificados en estas instrucciones de uso. En raras ocasiones, puede obtenerse un resultado positivo con una concentración baja debido a la contaminación cruzada en el procesamiento de una muestra adyacente con un número extremadamente elevado de copias. 17

18 No se puede suponer que una muestra con un resultado Not detected (No detectado) sea negativa para el DNA del VHB. Los resultados del ensayo Abbott HBV Sequencing se deben interpretar junto con otros resultados de laboratorio o clínicos. CARACTERÍSTICAS ESPECÍFICAS DEL FUNCIONAMIENTO Sensibilidad analítica Para evaluar la sensibilidad analítica (límite de detección o L D ) del ensayo HBV Sequencing se analizó un panel de 8 muestras de VHB, cada muestra del panel representaba un genotipo único (A a H). El estudio se realizó con un lote de reactivos de amplificación Abbott HBV Sequencing, Controles, Abbott Proteinase K, y reactivos Abbott msample Preparation System DNA en dos parejas de instrumentos Abbott m2000sp y m2000rt, dos termocicladores Perkin Elmer 9700 y un analizador genético 3130xl. A continuación, se resumen los resultados representativos de la sensibilidad analítica del ensayo HBV Sequencing. Límite de detección Genotipo Concentración Replicados Tasa (%) de la esperada Correctamente de muestra (UI/ml) Analizados detectados detección A B C D E F G H Especificidad Para evaluar la especificidad del ensayo Abbott HBV Sequencing se analizaron 100 muestras, de plasma (50) y de suero (50), serológicamente negativas para el VHB. Se usaron para el estudio un lote de reactivos de amplificación Abbott HBV Sequencing, Controles, Abbott Proteinase K y reactivos Abbott msample Preparation System DNA en dos parejas de instrumentos Abbott m2000sp y m2000rt. En este estudio, el ensayo Abbott HBV Sequencing interpretó todas las muestras analizadas y serológicamente negativas para el VHB, como negativas para el VHB, lo que resultó en una especificidad del 100% (100/100) (IC del 95% entre 96,38% y 100,00%). Detección de muestras infectadas con distintos genotipos del VHB La capacidad del ensayo Abbott HBV Sequencing para detectar muestras infectadas por genotipos del VHB mixtos se demostró analizando un panel de 21 muestras positivas para el VHB formado por distintas proporciones de concentraciones víricas de genotipos mixtos y a tres concentraciones diferentes de carga vírica (1 x 10 5, UI/ml y 600 UI/ml). Un replicado de cada muestra del panel 100% homogéneo y cuatro replicados de cada muestra del panel de genotipo mixto, se analizaron para un total de 22 replicados en cada una de las tres concentraciones de carga vírica. El estudio se realizó con un lote de reactivos de amplificación Abbott HBV Sequencing, Controles, Abbott Proteinase K, y reactivos Abbott msample Preparation System DNA en dos parejas de instrumentos Abbott m2000sp y m2000rt, dos termocicladores Perkin Elmer 9700 y un analizador genético 3130xl. A continuación, se resumen los resultados representativos del rendimiento del ensayo HBV Sequencing. Concentración vírica total del panel mixto Tasa de detección de la infección mixta Descripción del panel mixto Genotipo A:D Tasa de detección (%) 1 x 10 5 UI/ml 80:20 4,17 70:30 27,60 50:50 81,25 30:70 68,23 20:80 31, UI/ml 80:20 1,56 70:30 15,63 50:50 67,71 30:70 67,19 20:80 55, UI/ml 80:20 0,00 70:30 4,69 50:50 20,31 30:70 59,38 20:80 80,21 Reactividad cruzada Los siguientes virus y microorganismos que, potencialmente podrían presentar alguna reacción cruzada, se evaluaron con el ensayo Abbott HBV Sequencing. Ácidos nucleicos purificados o lisados víricos de cada microorganismo o virus se añadieron a muestras negativas para el VHB y a muestras que contenían 1 x 10 5 UI/ml de VHB. El estudio se realizó con un lote de reactivos de amplificación Abbott HBV Sequencing, Controles HBV Sequencing, Abbott Proteinase K, y reactivos Abbott msample Preparation System DNA en tres parejas de instrumentos Abbott m2000sp y m2000rt, un termociclador Perkin Elmer 9700 y un analizador genético 3130xl. Microorganismos y virus analizados que pueden presentar reactividad cruzada Virus de la inmunodeficiencia humana 1 (VIH-1) Virus de la inmunodeficiencia humana 2 (VIH-2) a Virus de la hepatitis C (VHC) Virus T-linfotrópico humano 1 (HTLV-I) Virus herpes simple 1 (HSV-1) Virus del papiloma humano 16 (VPH-16) a Lisado vírico del VIH-2 Neisseria gonorrhoeae Chlamydia trachomatis Candida albicans Staphylococcus aureus Mycobacterium smegmatis No se observó interferencia en el funcionamiento del ensayo Abbott HBV Sequencing en presencia de estos organismos con capacidad de presentar alguna reacción cruzada en las muestras positivas y negativas analizadas. Sustancias con capacidad de interferir Se evaluó la susceptibilidad del ensayo Abbott HBV Sequencing de posibles interferencias por concentraciones elevadas de sustancias endógenas. Se analizaron muestras negativas para el VHB y muestras con 1 x 10 5 UI/ml de VHB. El estudio se realizó con un lote de reactivos de amplificación Abbott HBV Sequencing, Controles HBV Sequencing, Abbott Proteinase K, y reactivos Abbott msample Preparation System DNA en tres parejas de instrumentos Abbott m2000sp y m2000rt, un termociclador Perkin Elmer 9700 y un analizador genético 3130xl. No se observó interferencia en el rendimiento del ensayo Abbott HBV Sequencing en presencia de las sustancias siguientes para todas las muestras positivas y negativas para el VHB analizadas: Hemoglobina 500 mg/dl Triglicéridos 3000 mg/dl Bilirrubina 20 mg/dl Proteínas 9 g/dl El ensayo HBV Sequencing usa reactivos y protocolos de preparación de muestras similares a los del ensayo RealTime HBV (nº de ref.: 2G34). El ensayo RealTime HBV ha demostrado su capacidad de funcionar correctamente en presencia de las siguientes mezclas de antivíricos y antibióticos en concentraciones iguales o por encima de las concentraciones pico comunicadas de suero o plasma. No se observó interferencia en el rendimiento del ensayo Abbott RealTime HBV en presencia de las siguientes mezclas de fármacos para todas las muestras positivas y negativas para el VHB analizadas: 18

19 Mezcla de fármacos Fármacos analizados 1 Zidovudina, Saquinavir, Ritonavir, Claritromicina, Interferón 2a, Interferón 2b, Didanosina 2 Sulfato de abacavir, Amprenavir, Interferón pegilado 2a, Interferón pegilado 2b, Ribavirina, Entecavir, Adefovir 3 Tenofovir, Lamivudina, Indinavir, Ganciclovir, Valganciclovir, Aciclovir, Paroxetina 4 Estavudina, Efavirenz, Lopinavir, Enfuvirtida, Ciprofloxacin, Fluoxetina 5 Zalcitabina, Nevirapina, Nelfinavir, Azitromicina, Valaciclovir, Sertralina Estudio de población La capacidad del ensayo Abbott HBV Sequencing para proporcionar un resultado de secuenciación se demostró con el análisis de 110 muestras de plasma positivas para el VHB con cargas víricas superiores o iguales al log 2,3 UI/ml. El estudio se realizó con un lote de reactivos de amplificación Abbott HBV Sequencing, Controles, Abbott Proteinase K, y reactivos Abbott msample Preparation System DNA en dos parejas de instrumentos Abbott m2000sp y m2000rt, dos termocicladores Perkin Elmer 9700 y un analizador genético 3130xl. El ensayo Abbott HBV Sequencing detectó y produjo secuencias válidas para el 96,4% (106/110) de las muestras analizadas. Estudio de comparación para uso compatible El ensayo Abbott HBV Sequencing se puede realizar con múltiples configuraciones del ensayo/instrumentos. En dos estudios representativos, un panel con muestras del VHB preparadas con una concentración diana de 1 x 10 5 UI/ml se analizaron respecto a las dos configuraciones de ensayo siguientes: Configuración del ensayo/ instrumento A B Preparación de las muestras m2000sp m24sp PCR m2000rt PE9700 a Purificación del producto de PCR ExoSAP-IT b QIAquick c Purificación del producto de secuenciación Etanol/ Acetato de sodio Isopropanol Análisis de secuencias AB 3130xl d AB 3130xl d a Termociclador Perkin Elmer 9700 b Corporación Bioquímica de los EE.UU. c QIAGEN d Analizador genético 3130xl de Applied Biosystems Los estudios se realizaron con un lote de reactivos de amplificación Abbott HBV Sequencing, Controles, Abbott Proteinase K y reactivos Abbott msample Preparation System DNA. En los estudios, el uso del ensayo Abbott HBV Sequencing logró el mismo resultado de secuencia (igualdad de secuencias superior a 98%) más del 95% del tiempo. Contaminación por arrastre Para evaluar la posible contaminación por arrastre en el ensayo Abbott HBV Sequencing se analizaron de forma alternativa muestras positivas altas para el VHB (con una concentración diana de log 7,9 UI/ml) y muestras negativas para el VHB. El estudio se realizó con un lote de reactivos de amplificación Abbott HBV Sequencing, controles HBV Sequencing, Abbott Proteinase K y reactivos Abbott msample Preparation System DNA en dos parejas de instrumentos m2000sp and m2000rt, un instrumento m24sp y tres termocicladores Perkin Elmer Los datos de 5 procesamientos, 55 replicados positivos (11 por procesamiento) intercalados con 55 replicados negativos (11 por procesamiento), se analizaron para el conjunto de instrumentos m2000sp/m2000rt. El ensayo Abbott HBV Sequencing no mostró contaminación por arrastre detectable de muestras altamente positivas a negativas en el conjunto de instrumentos m2000sp/m2000rt. Los datos de 5 procesamientos, 40 replicados positivos (8 por procesamiento) intercalados con 40 replicados negativos (8 por procesamiento), se analizaron para el conjunto de instrumentos termociclador PE9700/electroforesis en gel/m24sp. El ensayo Abbott HBV Sequencing mostró una frecuencia de contaminación por arrastre de 2,5% (1/40) de muestras altamente positivas a negativas para el conjunto de instrumentos m24sp/ termociclador PE9700/electroforesis en gel. BIBLIOGRAFÍA 1. Lai LL, Ratziu V, Yuen, M, et al. Viral hepatitis B. Lancet 2003;362: Valsamakis A. Molecular testing in the diagnosis and management of chronic hepatitis B. Clinical Microbiological Reviews 2007;20: Zoulim F. Antiviral therapy of chronic hepatitis B. Antiviral Research 2006;71: Boom R, Sol CJA, Heijtink R, et al. Rapid purification of hepatitis B virus DNA from serum. J Clin Microbiol 1991;29(9): Read SJ. Recovery efficiencies of nucleic acid extraction kits as measured by quantitative LightCycler PCR. J Clin Pathol: Mol Pathol 2001;54: Murray V. Improved double-stranded DNA sequencing using the linear polymerase chain reaction. Nucleic Acids Res 1989;17: US Department of Labor, Occupational Safety and Health Administration, 29 CFR Part , Occupational Exposure to Bloodborne Pathogens. 8. US Department of Health and Human Services. Biosafety in Microbiological and Biomedical Laboratories, Fourth Edition. Washington, DC: US Government Printing Office; May World Health Organization. Laboratory Biosafety Manual. Geneva: World Health Organization; Clinical and Laboratory Standards Institute. Protection of Laboratory Workers from Occupationally Acquired Infections: Approved Guideline-Third Edition. CLSI Document M29-A3. Wayne, PA: CLSI, Sehulster LM, Hollinger FB, Dreesman GR, et al. Immunological and biophysical alteration of hepatitis B virus antigens by sodium hypochlorite disinfection. Appl Envir Microbiol 1981;42(5): CDC. Guidelines for the prevention of human immunodeficiency virus and hepatitis B virus to health-care and public-safety workers. MMWR 1989;38(S-6):16S. 13. National Committee for Clinical Laboratory Standards. Clinical Laboratory Waste Management: Approved Guideline - Second Edition. NCCLS Document GP5-A2. Wayne, PA: NCCLS, 2002;22(3):1-23, US Environmental Protection Agency. EPA Guide for Infectious Waste Management Publication No. EPA/530-SW Washington, DC: US Environmental Protection Agency, 1986: , R1-R3, A1A Saldanha J, Gerlich W, Lelie N, et al. An International Collaborative Study to Establish a WHO International Standard for HBV DNA Nucleic Acid Amplification Technology Assay. WHO Expert Committee on Biological Standardization: Fiftieth Report, Geneva, Switzerland;1999. WHO Technical Report Series No 904;BS/ Abbott m, m2000, m24sp, m2000sp y m2000rt son marcas comerciales de Abbott Laboratories. AmpliTaq Gold es una marca comercial registrada de Roche Molecular Systems, Inc. ProClin es una marca comercial registrada de Rohm and Haas. ROX es una marca comercial de Applera Corporation o sus filiales de EE.UU. y/u otros países. Cy5 es una marca comercial registrada de GE Healthcare. Quasar es una marca comercial registrada de Biosearch Technologies. ExoSAP-IT es una marca comercial registrada de USB Corporation. SeqScape, BigDye, HiDi son marcas comerciales registradas de Applied Biosystems. 19

20 Abbott Molecular Inc. suministra este producto por medio de un acuerdo con Life Technologies Corporation y Abbott Molecular Inc., y la fabricación, uso, venta o importación de este producto está sujeto a uno o más patentes emitidas o solicitudes de patentes pendientes estadounidenses, y sus correspondientes homólogas fuera de EE.UU., propiedad de Life Technologies Corporation. La venta de este producto incluye derechos limitados, intransferibles para uso exclusivo de la cantidad de producto o componentes adquiridos por parte del comprador para secuenciar el virus de la hepatitis B (VHB) para el diagnóstico humano. No se adquieren derechos de reventa de este producto o uso de este producto para ningún otro propósito. Si desea más información sobre la adquisición de derechos de la propiedad industrial o intelectual de o controlada por Life Technologies Corporation, póngase en contacto con Out Licensing, Life Technologies Corporation, 5791 Van Allen Way, Carlsbad, CA 92008, correo electrónico: Abbott Molecular Inc. es el fabricante legal de: Abbott HBV Sequencing Amplification Reagent Kit (equipo de reactivos de amplificación) (nº de referencia: 3N03-90) y Abbott HBV Sequencing Control Kit (equipo de controles) (nº de referencia: 3N03-80) Abbott Laboratories Junio

Abbott RealTime HIV-1

Abbott RealTime HIV-1 6L18 51-605130/R1 Abbott RealTime HIV-1 Nota: consulte las modificaciones marcadas es 6L18 51-605130/R1 Símbolos utilizados Fabricante referencia lote Producto sanitario para diagnóstico in vitro Control

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Instrucciones de Uso GenDx SBTexcellerator

Instrucciones de Uso GenDx SBTexcellerator Octavo Edición Julio de 2011 Instrucciones de Uso GenDx SBTexcellerator Para Tipificación Basada en Secuenciación de HLA de alta resolución Genome Diagnostics B.V. Teléfono: +31 302 523 799 Correo electrónico:

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271.

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271.

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. Technical Manual SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. IMPRESO EN ESTADOS UNIDOS Nro. de pieza: TMD037 SwabSolution Kit Toda la bibliografía técnica está disponible en Internet,

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE MURCIA 1 GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES

Más detalles

Murex anti-hbc (total)

Murex anti-hbc (total) es 8G21-01/-02 GE65/66 Primera edición 10/2009 Murex anti-hbc (total) Enzimoinmunoanálisis para la detección de anticuerpos frente al antígeno core del virus de la hepatitis B (anti-hbc) en suero o plasma

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems INDICE I. Introducción II. Objetivo General del Manual III. Políticas de

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 REF/ PROYECTO: PROMIS 2012 NÚMERO DE LOTES: UNICO Este pliego contempla la adquisición de un sistema

Más detalles

ViroSeq CELERA. CDx. HIV-1 Genotyping System v2.0. Instrucciones de uso DRAFT

ViroSeq CELERA. CDx. HIV-1 Genotyping System v2.0. Instrucciones de uso DRAFT CELERA ViroSeq HIV-1 Genotyping System v2.0 Para utilizar con los ABI PRISM 3100/3100-Avant Genetic Analyzers (Analizadores genéticos ABI PRISM 3100/3100-Avant) y el ViroSeq HIV-1 Genotyping System Software

Más detalles

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408.

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. Technical Manual PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. IMPRESO EN ESTADOS UNIDOS PowerPlex Fusion System Toda la bibliografía técnica está disponible en Internet,

Más detalles

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Tel. 91 710 00 74 Fax 93 843 78 84 e-mail: info@biotools.eu www.biotools.eu BIOPAP Kit Kit para la detección

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

PRINCIPIO DE LA PRUEBA: USO PREVISTO:

PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente.

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente. bioelisa HCV 4.0 3000-1115 LEER CAMBIOS SOMBREADOS 96 tests 3000-1116 480 tests Test de ELISA para la detección de anticuerpos contra el virus de la hepatitis C (HCV) en suero o plasma humano para ser

Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 Instrucciones de uso Wipe test Control de Contaminación Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 40 Reacciones 1. Descripción del Producto El uso de la

Más detalles

Maxwell 16 Blood DNA Purification System

Maxwell 16 Blood DNA Purification System Manual técnico Maxwell 16 Blood DNA Purification System Precaución: Maneje los cartuchos con cuidado, los bordes del sistema de sellado podrían estar afilados. 2800 Woods Hollow Rd. Madison, WI USA Dispositivo

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 -

CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 - CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 - CLART ENTHERPEX Extracción 24 determinaciones Ref: AT-0908-24 48 determinaciones

Más detalles

Guía de referencia del ensayo de secuenciación clínica de la fibrosis quística MiSeqDx

Guía de referencia del ensayo de secuenciación clínica de la fibrosis quística MiSeqDx Guía de referencia del ensayo de secuenciación clínica de la fibrosis quística MiSeqDx PARA USO DIAGNÓSTICO IN VITRO Introducción 3 Primeros pasos 7 Flujo de trabajo del ensayo 21 Preparación de la hoja

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS

PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

BIOSEGURIDAD EN MICROBIOLOGIA: NUEVOS Y VIEJOS RETOS

BIOSEGURIDAD EN MICROBIOLOGIA: NUEVOS Y VIEJOS RETOS BIOSEGURIDAD EN MICROBIOLOGIA: NUEVOS Y VIEJOS RETOS JUAN CARLOS RODRÍGUEZ S. MICROBIOLOGÍA HOSPITAL GENERAL UNIVERSITARIO DE ALICANTE E-MAIL: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

ZONA GRIS: IMPORTANCIA DE LA FASE PREANALITICA EN BIOLOGÍA MOLECULAR.

ZONA GRIS: IMPORTANCIA DE LA FASE PREANALITICA EN BIOLOGÍA MOLECULAR. ZONA GRIS: IMPORTANCIA DE LA FASE PREANALITICA EN BIOLOGÍA MOLECULAR. Autores: Dª. Sonia Vidal Rico. D. Fernando Grossón García. D. Carlos Pascual Ferrer. Dª. Elena Vidal Rico. Dª. Concepción Tuset Ruiz.

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

FICHA DE DATOS DE SEGURIDAD (MSDS) KIT CLART CMA KRAS BRAF PI3K

FICHA DE DATOS DE SEGURIDAD (MSDS) KIT CLART CMA KRAS BRAF PI3K 1. Identificación de la sustancia y proveedor Nombre comercial CLART CMA KRAS BRAF PI3K Referencias: Amplificación KRAS 8 determinaciones Ref.: CS-0412-8 24 determinaciones Ref.: CS-0412-24 Amplificación

Más detalles

Manual del GPHF-Minilab

Manual del GPHF-Minilab Una Guía Concisa de Control de Calidad de Drogas Esenciales y otros Medicamentos Manual del GPHF-Minilab Tercer Suplemento del Volumen II Cromatografía de Capa Fina Extensión 2003 Antiretrovirales Una

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido Guía Práctica 9 Micelio de hongos Producción de micelio en medio líquido para extracción de ADN Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

PARA DIAGNÓSTICO IN VITRO.

PARA DIAGNÓSTICO IN VITRO. COBAS AmpliPrep/COBAS TaqMan CMV Test PARA DIAGNÓSTICO IN VITRO. COBAS AmpliPrep/COBAS TaqMan 72 Tests P/N: 04902068 190 CMV Test COBAS AmpliPrep/COBAS TaqMan CMVCAP PG WR 5.1 Liters P/N: 03587797 190

Más detalles

MEMORIA DE PRÁCTICAS

MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

QIAGEN Gaithersburg, Inc. 1201 Clopper Road Gaithersburg, MD 20878 USA 96

QIAGEN Gaithersburg, Inc. 1201 Clopper Road Gaithersburg, MD 20878 USA 96 Instrucciones de uso digene HC2 CT-ID DNA Test Ensayo de hibridación de ácidos nucleicos in vitro mediante amplificación de la señal y uso de quimioluminiscencia en microplaca para la detección cualitativa

Más detalles

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD Artículo 1. Este Reglamento es complementario del Reglamento de Higiene y Seguridad de la Facultad de Química de la

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS

GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS Procedimientos para la gestión de residuos 1 GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS 1. Preámbulo 2. Gestión de residuos biológicos 2.1. Clasificación 2.2. Procedimientos de eliminación 2.2.1. Residuos

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar.

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar. bioelisa HIV-1+2 (rec) 3000-1143 LEER CAMBIOS SOMBREADOS 96 tests 3000-1144 480 tests Test de ELISA para la detección de anticuerpos contra HIV-1 y HIV-2 en suero o plasma humano. Sumario Como es conocido

Más detalles

GEBRAX DIVISION DIAGNÓSTICA

GEBRAX DIVISION DIAGNÓSTICA GEBRAX T h e r a p e u t i c s & D i a g n o s t i c s DIVISION DIAGNÓSTICA Se recomienda que el prospecto deba ser leído antes de comenzar el procedimiento de prueba. Aunque el ensayo está diseñado para

Más detalles

Contenido. Bioseguridad Chile Ltda., Septiembre 2014i www.bioseguridadchile.cl nfo@bioseguridadchile.cl 1

Contenido. Bioseguridad Chile Ltda., Septiembre 2014i www.bioseguridadchile.cl nfo@bioseguridadchile.cl 1 Contenido Control de Infecciones, Recolección y Manejo de Muestras... 2 Recomendaciones para la evaluación de los riesgos para el personal... 2 Recomendaciones para la recogida de muestras por parte del

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Servicio Prevención de Riesgos Laborales

Servicio Prevención de Riesgos Laborales NORMAS DE TRABAJO SEGURO. PREPARACIÓN DE CITOSTÁTICOS. Nº 15 (Art. 18 Ley 31/1995 de Prevención de Riesgos Laborales. Deber de información) Los riesgos más comunes para la seguridad y salud así como las

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

FTA-1 Aspirador con soporte para frascos

FTA-1 Aspirador con soporte para frascos FTA-1 Aspirador con soporte para frascos Manual de funcionamiento Certificado para la versión V.4AW Contenidos 1. Precauciones de seguridad 2. Información general 3. Cómo empezar 4. Funcionamiento 5. Especificaciones

Más detalles

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 28 de abril de 2009 Revisión 1 (30 de abril e 2009) El Centro Colaborador para la Influenza de la

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

Seguridad en el laboratorio químico

Seguridad en el laboratorio químico Seguridad en el laboratorio químico A) Prevención del riesgo en el laboratorio. Cualquier operación del laboratorio en la que se manipulen productos químicos presenta siempre unos riesgos. Para eliminarlos

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La prueba de Demanda Química de Oxígeno (DQO) se basa en la oxidación química de la materia orgánica e inorgánica, presente en las muestras de agua, con dicromato de potasio

Más detalles

INTRODUCCIÓN AL CULTIVO CELULAR

INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU

UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU La Unidad de secuenciación del Hospital Universitario Sant Joan de Déu, es una unidad de reciente creación que nace con el objetivo de prestar

Más detalles

Aprobados por el Consejo Interno el 9 de marzo de 2010

Aprobados por el Consejo Interno el 9 de marzo de 2010 Lineamientos para el uso del Laboratorio de Código de Barras de ADN (Sistemática Molecular 1) en el Departamento de Zoología, Instituto de Biología de la UNAM Aprobados por el Consejo Interno el 9 de marzo

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

CLASIFICACIÓN Y GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS

CLASIFICACIÓN Y GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS CLASIFICACIÓN Y GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS La clasificación y gestión de los residuos tóxicos y peligrosos generados en CABIMER se realiza de acuerdo con la normativa vigente (Ley 10/1998,

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS Ref. 4755 2014/04 CALIBRADORES Hb A1c CAPILAR Aplicación Los Calibradores Hb A1c CAPILAR están destinados a la calibración y al control de migración

Más detalles

cobas EGFR Mutation Test v2

cobas EGFR Mutation Test v2 cobas EGFR Mutation Test Para diagnóstico in vitro cobas DNA Sample Preparation Kit 24 Tests P/N: 05985536190 cobas cfdna Sample Preparation Kit 24 Tests P/N: 07247737190 cobas EGFR Mutation Test 24 Tests

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

PROTOCOLO DE LIMPIEZA Y DESINFECCIÒN MATERIAL DE VIDRIO DE LABORATORIO CLÌNICO

PROTOCOLO DE LIMPIEZA Y DESINFECCIÒN MATERIAL DE VIDRIO DE LABORATORIO CLÌNICO Página 1 de 11 CDS IDM 2.5 06 ABRIL 2014 Página 2 de 11 CDS IDM 2.5 06 OBJETIVO Establecer el procedimiento de limpieza, desinfección efectiva y completa para el material utilizado en el laboratorio, que

Más detalles

Sistema PowerPlex 18D System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC1802 Y DC1808.

Sistema PowerPlex 18D System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC1802 Y DC1808. Technical Manual Sistema PowerPlex 18D System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC1802 Y DC1808. IMPRESO EN ESTADOS UNIDOS Sistema PowerPlex 18D System Toda la bibliografía técnica está disponible

Más detalles

1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS.

1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS. Página 1 de 5 CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain.

Más detalles

MANUAL DE SEGURIDAD Y SALUD EN EL LABORATORIO

MANUAL DE SEGURIDAD Y SALUD EN EL LABORATORIO MANUAL DE SEGURIDAD Y SALUD EN EL LABORATORIO - 1 - CONTENIDO INTRODUCCIÓN NORMAS DE SEGURIDAD EN EL LABORATORIO 1. NORMAS PERSONALES Y PROTECCIÓN PERSONAL 2. NORMAS CON RESPECTO A LOS PROCEDIMIENTOS 3.

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

ETIQUETADO DE SUSTANCIAS Y PREPARADOS PELIGROSOS

ETIQUETADO DE SUSTANCIAS Y PREPARADOS PELIGROSOS ETIQUETADO DE SUSTANCIAS Y PREPARADOS PELIGROSOS Los riesgos que presentan las sustancias y preparados químicos peligrosos pueden variar de acuerdo con las condiciones de uso o manipulación. Un punto clave

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles