Int. Cl.: 74 Agente: Tomás Gil, Tesifonte-Enrique

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Int. Cl.: 74 Agente: Tomás Gil, Tesifonte-Enrique"

Transcripción

1 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: Int. Cl.: C12N 9/44 (06.01) C12P 19/16 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: Fecha de presentación : Número de publicación de la solicitud: Fecha de publicación de la solicitud: Título: Proceso de conversión del almidón usando isoamilasas termoestables de sulfolobus. Prioridad: DK 787/97 73 Titular/es: Novozymes A/S Krogshoejvej Bagsvaerd, DK 4 Fecha de publicación de la mención BOPI: Inventor/es: Tsutsumi, Noriko; Bisgard-Frantzen, Henrik y Svendsen, Allan 4 Fecha de la publicación del folleto de la patente: Agente: Tomás Gil, Tesifonte-Enrique ES T3 Aviso: En el plazo de nueve meses a contar desde la fecha de publicación en el Boletín europeo de patentes, de la mención de concesión de la patente europea, cualquier persona podrá oponerse ante la Oficina Europea de Patentes a la patente concedida. La oposición deberá formularse por escrito y estar motivada; sólo se considerará como formulada una vez que se haya realizado el pago de la tasa de oposición (art del Convenio sobre concesión de Patentes Europeas). Venta de fascículos: Oficina Española de Patentes y Marcas. Pº de la Castellana, Madrid

2 DESCRIPCIÓN Proceso de conversión del almidón usando isoamilasas termoestables de sulfolobus. 1 Campo de la invención La invención se refiere a una isoamilasa aislada, a secuencias de ADN clonadas que codifican isoamilasas, a vectores de expresión que comprenden dicha secuencia de ADN, a células huéspedes que comprenden tales vectores de expresión, y finalmente a métodos para producir dichas isoamilasas. Antecedentes de la invención Almidones tales como maíz, patata, trigo, mandioca y almidón de arroz son usados como el material precursor en la producción a gran escala comercial de azúcares, tales como jarabe rico en fructosa, jarabe rico en maltosa, maltodextrinas amilosa, trehalosa, G2-G8 oligosacáridos (incluso oligosacáridos funcionales) y otros productos glúcidos tales como los sustituyentes de grasa. Degradación del almidón 2 El almidón normalmente consiste en aproximadamente el 80% de amilopectina y el % de amilosa. La amilopectina es un polisacárido ramificado donde cadenas lineales de residuos de α-1,4 D-glucosa son unidos por enlaces α-1,6-glucosídicos. La amilopectina es parcialmente degradada por α-amilasa que hidroliza los enlaces 1,4-α-glucosídicos en oligosacáridos ramificados y lineales. La degradación prolongada de amilopectina por α-amilasa ocasiona la formación de las llamadas dextrinas α-límite que no son susceptibles de hidrólisis adicional por la α-amilasa. Los oligosacáridos ramificados pueden ser hidrolizados en oligosacáridos lineales por una enzima desramificante. Los oligosacáridos ramificados restantes pueden ser lentamente despolimerizados a D-glucosa por glucoamilasa. La glucoamilasa hidroliza rápidamente los oligosacáridos lineales en D-glucosa. La amilosa es un polisacárido lineal formado por unidades de D-glucopiranosa enlazadas entre sí por enlaces α- 1,4 glucosídicos. La amilosa está degradada en oligosacáridos lineales por la α-amilasa que son despolimerizados rápidamente en D-glucosa por la glucoamilasa. Enzimas 3 4 α-amilasa La α-amilasa (E.C ) con el nombre sistemático de 1,4-α-D-glucan glucanohidrolasa es capaz de hidrolizar almidón y otros oligo y polisacáridos 1,4-glucosídicos lineales y ramificados. La α-amilasa actúa en el sustrato de una manera aleatoria. Los grupos de reducción están liberados en la α-configuración. Enzimas desramificantes Las enzimas desramificantes, que pueden atacar amilopectina están divididas en dos clases: Isoamilasas (E.C ) y pululanasas (E.C ), respectivamente. La isoamilasa hidroliza enlaces ramificados α-1,-6-d-glucosídicos en amilopectina y dextrinas β-límite y puede ser distinguida de las pululanasas por la incapacidad de la isoamilasa de atacar pululano, y por la acción limitada en dextrinas α-límite. Glucoamilasa 0 6 Glucoamilasa o glucan 1,4-α-glucosidasa (E.C ) hidroliza los residuos terminales enlazados en 1,4 de α-dglucosa sucesivamente de las extremidades sin reducir de las cadenas con liberación de β-d-glucosa. La enzima puede también hidrolizar lentamente enlaces 1,6-α-D-glucosídicos en isomaltosa, panosa y oligosacáridos relacionados. Conversión del almidón Un proceso de conversión de almidón tradicional degradando almidón en componentes glúcidos de peso molecular bajo tales como azúcares o sustituyentes de grasa incluye una fase desramificante. Almidón para conversión de azúcar En el caso de convertir el almidón en un azúcar el almidón será despolimerizado. Este proceso de despolimerización consiste en una fase de pretratamiento y dos o tres fases de proceso consecutivo, es decir, un proceso de licuefacción, un proceso de sacarificación y, dependiendo del producto final deseado, opcionalmente un proceso de isomerización. Pretratamiento de almidón natural El almidón natural consiste en gránulos microscópicos que son insolubles a la temperatura ambiente del agua. Cuando una pasta de almidón acuoso se calienta, los gránulos se hinchan y con el tiempo estallan, dispersando las 2

3 1 2 moléculas de almidón en la solución. Durante este proceso de gelatinización hay un aumento espectacular de la viscosidad. Puesto que el nivel de sólidos es del -% en un proceso normalmente industrial, el almidón tiene que ser estrechado o licuado de modo que pueda ser manipulado. Esta reducción de la viscosidad es hoy principalmente obtenida por degradación enzimática. Licuefacción Durante la fase de licuefacción, el almidón de cadena larga es degradado en unidades (maltodextrinas) ramificadas y lineales más cortas por una α-amilasa (p. ej. Termamyl ). El proceso de licuefacción se realiza a -1ºC durante a minutos seguidos de 1-2 horas a 9ºC. El ph se extiende entre. y 6.2. Para asegurar una estabilidad enzimática óptima bajo estas condiciones, se añade 1 mm de calcio ( ppm de iones calcio libres). Después de este tratamiento el almidón licuado tendrá un equivalente de dextrosa (DE) de -1. Sacarificación Después del proceso de licuefacción las maltodextrinas son convertidas en dextrosa por adición de una glucoamilasa (p. ej. AMG ) y una enzima desramificante, tal como una isoamilasa (patente estadounidense ) o una pululanasa (p. ej. Promozyme(tm)) (patente estadounidense 4..61). Antes de esta fase el ph es reducido a un valor inferior a 4., manteniendo la temperatura alta (superior a 9ºC) para inactivar la α-amilasa liquefactante para reducir la formación de oligosacáridos cortos llamados precursores de panosa que no pueden ser hidrolizados adecuadamente por la enzima desramificante. La temperatura es reducida a ºC, y la glucoamilasa y la enzima desramificante son agregadas. El proceso de sacarificación procede durante horas. Normalmente, cuando se desnaturaliza la α-amilasa después de la fase de licuefacción alrededor de un % del producto de sacarificación es el trisacárido ramificado 6 2 -α-glucosil maltosa (panosa) que no puede ser degradado por una pululanasa. Si la amilasa activa de la fase de licuefacción está presente durante la sacarificación (es decir sin desnaturalización), este nivel puede ser de hasta un 1-2%, lo cual es muy indeseable puesto que reduce el rendimiento de la sacarificación significativamente. Isomerización Cuando el producto de azúcar final deseado es p. ej. jarabe rico en fructosa, el jarabe de dextrosa puede ser convertido en fructosa. Después del proceso de sacarificación, el ph es aumentado hasta un valor en la gama de 6-8, preferiblemente a ph 7., y el calcio es quitado por intercambio fónico. El jarabe de dextrosa es luego convertido en jarabe rico en fructosa usando, p. ej., una glucosaisomerasa inmovilizada (tal como Sweetzyme ). Conversión de almidón en sustituto de la grasa Un sustituto de la grasa es un carbohidrato del tipo de la grasa que es usado como una sustitución funcional de grasa en alimentos. Los sustituyentes de la grasa normalmente consisten en amilosa de cadena corta de polímeros lineales que contienen de aproximadamente 1 a 6 unidades de anhidroglucosa enlazadas por enlaces α-1,4-d-glucosídicos. Tales sustituyentes de grasa pueden ser producidos por desramificación enzimática del almidón. Los métodos para degradar los enlaces α-1,6-d-glucosídicos del almidón para formar la amilosa de peso molecular bajo y de cadena corta mediante el uso de enzimas desramificantes están descritos en p. ej. patente estadounidense nº (Sugimoto), patente estadounidense nº (Kurimoto) y patente estadounidense nº (Yoshida). Otro método para producir amilosa de cadena corta para ser usada como un sustituto de grasa está descrito en EP A1 (National Strach and Chemical Investment Holding Corporation). Resumen de la invención La invención se refiere a una isoamilasa termoestable nueva adecuada para el uso en el proceso de conversión del almidón según la invención. Con respecto a la invención la expresión conversión del proceso del almidón incluye todos los procesos en los que el almidón es degradado en componentes glúcidos con un peso molecular inferior. En el primer aspecto la invención se refiere a una enzima aislada que muestra actividad de isoamilasa según la reivindicación 2. En un segundo aspecto la invención se refiere a una secuencia de ADN clonada según la reivindicación 1. 6 En un tercer aspecto la invención se refiere al uso de una isoamilasa en procesos de conversión del almidón. 3

4 Breve descripción de los dibujos Figura 1 muestra el mapa de la enzima de restricción de pria, el plásmido que comprende la isoamilasa de Rhodothermus marinus. Figura 2 muestra la curva de ph de la isoamilasa de R. marinus. Figura 3 muestra la curva de temperatura de la isoamilasa de R. marinus. Figura 4 muestra el vector de expresión, pfsl82. Figura muestra la curva de ph de la isoamilasa de Sulfolobus acidocaldarius Figura 6 muestra la curva de temperatura de la isoamilasa de S. acidocaldarus. Figura 7 muestra el efecto de añadir la isoamilasa de R. marinus durante la conversión de almidón en los rendimientos de DP1, DP2, DP3 y DP4+. Descripción detallada de la invención Es el objetivo de la presente invención el hecho de proporcionar una isoamilasa termoestable nueva adecuada para el uso en el proceso de la invención de conversión del almidón. Los presentes inventores han encontrado que el logro del objeto de la invención mencionado arriba requiere una enzima desramificante de isoamilasa que sea activa en la condición predominante del proceso. En el caso de un proceso de despolimerización del almidón, la isoamilasa debería ser activa durante la licuefacción. Esto significa que las isoamilasas son sustancialmente activas a temperaturas de licuefacción, que se extienden de 9-1ºC, especialmente alrededor de ºC, a un ph en la gama entre 4. y 6., especialmente alrededor de ph.. En el contexto de la invención sustancialmente activa significa que la actividad enzimática relativa de la isoamilasa es al menos del 0%, en particular al menos el %, especialmente al menos el 70%, así como al menos el 90%, o al menos el 9%, así como al menos el 99%, a 0ºC a ph. en comparación con la actividad relativa en la temperatura óptima. Cuando la desramificación tiene lugar durante la licuefacción con la acción de una α-amilasa la formación de los precursores de panosa es reducida. Reduciendo la formación de precursores de panosa habrá menos panosa presente en el producto final aumentando el rendimiento de sacarificación global. Una isoamilasa termoestable hace posible desempeñar la licuefacción y la desramificación a la vez antes de la fase de sacarificación. Ejemplos específicos de enzimas desramificantes termoestables son las isoamilasas termoestables derivadas de las bacterias termofílicas tales como Sulfolobus acidocaldarius ATCC (Maruta, K. et al., Biochimica et Biophysica Acta 1291, p (1996)), Sulfolobus solfataricusatcc 92 (número de acceso: Y0826) y Rhodothermus marinus DSM 422 como se describirá más abajo. El proceso En un aspecto la invención se refiere a un proceso de conversión del almidón del tipo que incluye una fase desramificante donde una isoamilasa que es activa en las condiciones del proceso predominante se usa para la desramificación del almidón. En una forma de realización de la invención el proceso de conversión del almidón es un proceso de despolimerización de almidón donde la isoamilasa es activa durante la fase de licuefacción junto con una α-amilasa. En una forma de realización preferida la enzima desramificante que es activa en las condiciones del proceso predominante es una isoamilasa termoestable. Con respecto a la invención el modelo de degradación enzimática en el proceso de despolimerización del almidón tradicional ha sido cambiado. Tal cambio de proceso enzimático no ha sido posible antes puesto que todas las isoamilasas conocidas han sido termolábiles y son inactivadas a temperaturas superiores a ºC. Con respecto a la invención la fase de licuefacción se realiza a valores de ph ajustados entre 4. y 6., preferiblemente entre. y 6.2, con p. ej. hidróxido sódico, a temperaturas de 9-1ºC para un periodo de 1 a 3 horas, preferiblemente alrededor de 2 horas. 4

5 Opcionalmente, si la α-amilasa es calcio dependiente se podrá añadir calcio en cantidades entre y 0 ppm, así como alrededor de ppm (o 0.7 a 1.2 mm, así como alrededor de 1 mm), en la fase de licuefacción para estabilizar la enzima. 1 2 Con respecto a la invención la α-amilasa no necesita ser inactivada después de la fase de licuefacción para reducir la formación de panosa. Ejemplos de α-amilasas específicas que pueden ser usadas en la fase de licuefacción incluyen α-amilasas de Bacillus licheniformis, tales como los productos comercialmente disponibles Termamyl, Spezyme AA, Spezyme Delta AA, Maxamyl, Kleistase y los mutantes de α-amilasa descritos en WO 96/23874 (Novo Nordisk) y PCT/DK97/ (Novo Nordisk). Las isoamilasas que pueden ser usadas según la invención incluyen la isoamilasa termoestable derivada de la arqueobacteria termofílica de Sulfolobus acidocaldarius, Sulfolobus solfataricus y las eubacterias termofílicas de Rhodothermus marinus (como se describirá con detalle más abajo). Con respecto a la invención la fase de sacarificación se realiza a temperaturas de a 6ºC preferiblemente alrededor de ºC por una glucoamilasa durante horas. Ejemplos de glucoamilasas adecuadas incluyen glucoamilasas de Aspergillus Niger, tales como AMG de p. ej. Novo Nordisk. En el caso del producto de azúcar final deseado es p. ej. un jarabe rico en fructosa de aprox. el 0% de jarabe de fructosa la D-glucosa formada está isomerizada por una isomerasa a un ph alrededor de 6-8, preferiblemente ph 7.. El calcio es eliminado si se añade antes la fase de licuefacción. Unos ejemplos de unas isomerasas adecuadas es una glucosa isomerasa tal como la glucosa isomerasa derivada de Streptomyces murinus. La isomerasa puede ser una glucosa isomerasa inmovilizada, tal como Sweetzyme (de Novo Nordisk). Uso En otro aspecto la invención se refiere al uso de una isoamilasa termoestable en los procesos de conversión del almidón, incluyendo procesos de conversión de jarabe de fructosa y para producir sustituyentes de grasa En el caso del proceso de conversión del almidón es un proceso de despolimerización del almidón la isoamilasa termoestable se usa en combinación con una α-amilasa durante la fase de licuefacción. La isoamilasa termoestable puede ser derivada de la arqueobacteria termofílica de Sulfolobus acidocaldarius o Sulfolobus solfataricuso de Rhodothermus marinus. La isoamilasa termoestable puede ser usada durante la fase de licuefacción de un almidón a jarabe de glucosa o proceso de conversión de jarabe de fructosa. La isoamilasa termoestable puede también ser usada en procesos para producir sustituyentes de grasa de almidón. Ventajas de la invención En los procesos de conversión del almidón tradicionales, tales como los procesos de despolimerización del almidón, la formación del producto secundario indeseado, la panosa, tiene una influencia significante en el rendimiento de sacarificación global. Es en consecuencia deseable reducir la formación de panosa para aumentar el rendimiento de la sacarificación. Se obtienen diferentes ventajas mediante la adición de una isoamilasa termoestable. Por ejemplo, cuando la desramificación del almidón se desarrolla junto con una α-amilasa en la fase de licuefacción de la despolimerización del almidón, es posible prolongar el tiempo del proceso de licuefacción sin arriesgar la formación de una gran cantidad de precursores de panosa. Como la enzima desramificante es una isoamilasa termoestable la desramificación por una pululanasa durante la sacarificación puede ser omitida. Esto es ventajoso cuando la pululanasa tiende a condensar la maltosa en un precursor de panosa, la 6 2 -α-maltosilmaltosa que es hidrolizada en panosa por la glucoamilasa. Prolongando la fase de licuefacción el DE es aumentado desde -1 hasta p. ej. 1- reduciendo la necesidad de glucoamilasa (p. ej. AMG ). Este requisito de una glucoamilasa reducida es ventajoso cuando la formación de isomaltosa es reducida. La isomaltosa está formada por D-glucosa que resulta de la despolimerización de oligosacáridos lineales por glucoamilasa que elimina la D-glucosa de las extremidades de la cadena que no se reducen. Todo ello junto con menos actividad de glucoamilasa ocasiona un aumento del rendimiento de glucosa. Además, el ahorro de glucoamilasa en el proceso de la invención permite que la fase de sacarificación sea efectuada a una concentración de sustrato más alta que es ventajoso cuando los costes de evaporación pueden ser reducidos.

6 Además, cuando se usa el proceso de la invención para la despolimerización la α-amilasa usada en el proceso de licuefacción no necesita ser inactivada/desnaturalizada. El tiempo de reacción de sacarificación puede también resumirse significativamente aumentando de ese modo la capacidad de producción. Un objetivo de la presente invención es el de reducir la formación de panosa En los procesos de despolimerización del almidón esto aumenta el rendimiento de la sacarificación cuando la adición de una isoamilasa que es activa durante la fase de licuefacción reduce la cantidad de precursores de panosa formados. Cuando se usa una isoamilasa termoestable de forma anticipada en el proceso de licuefacción el proceso es menos dependiente de la especificidad de la α-amilasa y la formación de los precursores de panosa. Este cambio permite un tiempo de proceso aumentado para la licuefacción y se obtiene un valor de DX más alto que el valor normal de DX -12. Si se permite una licuefacción más intensiva y se obtiene un valor de DX más alto usando una enzima desramificante termoestable es posible aumentar la concentración de Sustancia Seca (DS) desde el porcentaje normal de -3% hasta uno más alto. Este aumento del % de DS es ventajoso cuando los costes de evaporación son reducidos significativamente en el proceso del jarabe de maíz rico en fructosa (HFCS). Cómo identificar las isoamilasas termoestables adecuadas Las isoamilasas termoestables adecuadas pueden ser identificadas como se describe en el ejemplo 1 identificando en primer lugar las regiones conservadas de la secuencia de aminoácidos alineando las secuencias de isoamilasa disponibles. En base a las regiones conservadas, se diseñan los cebadores para la PCR. Unas reservas de ADN genómico de varias cepas bacterianas son luego sometidas a PCR, y las cepas que producen un fragmento del tamaño esperado son seleccionadas. Los fragmentos son purificados, ordenados, y alineados para confirmar la homología con las secuencias de isoamilasa publicadas. Entre las cepas identificadas, aquellas con la máxima temperatura de crecimiento óptima son también seleccionadas. Usando este enfoque, las isoamilasas de Rhodothermus marinus DSM 422 y de Rhodothermus obamensis JCM 978 fueron seleccionadas, y la isoamilasa de R. marinus fue además donada como se describe en el ejemplo 2. Isoamilasa nueva obtenida a partir de Rhodothermus marinus DSM 422 Como también se ha indicado arriba los presentes inventores han encontrado que una enzima que muestra actividad isoamilasa puede ser obtenida a partir de una cepa del género Rhodothermus, más específicamente Rhodothermus marinus, especialmente Rhodothermus marinus DSM 422, y haber prosperado en la donación de una secuencia de ADN que codifica dicha enzima. Comparación con la técnica precedente Una búsqueda de homología con la isoamilasa de la invención contra las bases de datos de nucleótidos y de proteínas fue realizada. Orígenes de los genes de isoamilasa identidad ADN a.a. 0 6 Pseudomonas amyloderamosa*1 0.4% 33.0% Pseudomonas sp. SMP1*2 0.4% 33.0% Flavobacterium sp.*3 4.0% 34.1% Flavobacterium odoratum*4 4.8% 36.6% Sulfolobus acidocaldarius* 1.8% 4.2% Sulfolobus solfataricus*6 1.1%.0% *1: Tabla 1;1 *2: Tabla 1;2 *3: Tabla 1;3 *4: Tabla 1;4 *: Tabla 1; *6: GenBank: Número de acceso; Y0826 6

7 La búsqueda de homología mostró que la(s) secuencia(s) conocida(s) más relacionada(s) fueron las isoamilasas de Sulfolobus acidocaldarius y Sulfolobus solfataricus. La secuencia de ADN de la invención (SEC ID NO: 3) que codifica una isoamilasa muestra aproximadamente un 1-2% de homología del ADN a las secuencias de isoamilasa conocidas de Sulfolobus acidocaldarius y SSulfolobus solfataricus la secuencia de aminoácidos correspondiente de la isoamilasa de la invención (SEC ID NO: 4) muestra aproximadamente una homología del 4-% a una secuencia de aminoácidos deducida en base a la secuencia de ADN conocida anterior. Esto muestra que una secuencia de ADN y/o de aminoácidos de una isoamilasa de la invención de hecho es distante de cualquier secuencia(s) conocida(s) de ADN y/o de aminoácidos que codifica una isoamilasa. El cálculo de homología fue realizado como se describe posteriormente en esta especificación. Definiciones Antes de discutir esta invención con más detalle, los términos siguientes serán definidos en primer lugar. Una secuencia de ADN clonada : La expresión Una secuencia de ADN clonada, se refiere a una secuencia de ADN donada conforme a procedimientos de clonación estándar usados en ingeniería genética para trasladar un segmento de ADN desde su ubicación natural hasta un sitio diferente en el que será reproducido. El proceso de clonación implica escisión y aislamiento del segmento de ADN deseado, inserción de la pieza de ADN en la molécula del vector e incorporación del vector recombinante en una célula en la que múltiples copias o clones del segmento de ADN serán replicadas. La secuencia de ADN clonada de la invención puede de forma alternativa ser denominada constructo de ADN o secuencia de ADN aislada. Obtenido a partir de : Para el objetivo de la presente invención el término obtenido a partir de como se utiliza en este caso en relación con una fuente microbiana específica, significa que la enzima es producida por la fuente específica, o por una célula donde se ha insertado un gen de la fuente. Un polipéptido aislado : Tal y como se define aquí el término, un polipéptido aislado o isoamilasa aislada, como se usa para la isoamilasa de la invención, es una isoamilasa o parte de isoamilasa que tiene al menos aproximadamente el % de pureza, preferiblemente al menos aproximadamente el % de pureza, más preferiblemente aproximadamente el % de pureza, incluso más preferiblemente aproximadamente el 80% de pureza, más preferiblemente aproximadamente el 90% de pureza, e incluso más preferiblemente aproximadamente el 9% de pureza, según está determinado por SDS-PAGE. El término polipéptido aislado puede de forma alternativa ser denominado polipéptido purificado. Impurezas : Como se utiliza en este caso el término impurezas significa cualquier impureza (p. ej. otro polipéptido distinto de la enzima de la invención) que se origina a partir de la célula homóloga a partir de la cual se obtiene la enzima de la invención originalmente. En la presente invención la célula homóloga puede p. ej. ser una cepa de Rhodothermus. Parte de codificación de isoamilasa : Según se utiliza en este caso los términos parte de codificación de isoamilasa usados con respecto a una secuencia de ADN significa la región de la secuencia de ADN que se corresponde con la región que es traducida en una secuencia polipeptídica. En la secuencia de ADN mostrada en la SEC ID NO: 3 es la región entre el primer codón de iniciación ATG (codón AUG en ARNm) y el codón de detención siguiente ( TAA, TAG o TGA ). En otras palabras éste es el polipéptido traducido. La isoamilasa en el presente contexto está definida según la Clasificación Enzimática (EC), como teniendo el número de EC: Caracterización de la isoamilasa termoestable nueva de Rhodothermus marinus Isoamilasa aislada Una isoamilasa de la invención obtenida a partir de un Rhodothermus sp. ha sido intensivamente caracterizada. En una forma de realización preferida, la enzima según el primer aspecto de la invención es obtenida a partir de una cepa de Rhodotermus marinus, especialmente Rhodothermus marinus DSM 422. En una forma de realización preferida, la enzima según el primer aspecto tiene la secuencia de aminoácidos madura mostrada como la posición en la SEC ID NO: 4. 6 Enzima aislada En otro aspecto la invención se refiere a una enzima aislada que muestra actividad isoamilasa seleccionada del grupo que se compone de: 7

8 (a) un polipéptido codificado por la parte de codificación de la enzima isoamilasa de la secuencia de ADN clonada en el plásmido puc19 presente en Escherichia coli DSM 11971; (b) un polipéptido que comprende una secuencia de aminoácidos como se muestra en las posiciones de la SEC ID NO: 4; (c) un análogo del polipéptido definido en (a) o (b) que es al menos un 70% homólogo a dicho polipéptido; y 1 (d) un fragmento de (a), (b) o (c). La enzima según este aspecto de la invención puede ser obtenida a partir de un microorganismo tal como una bacteria, una levadura o un hongo filamentoso: Preferiblemente se obtiene a partir de una bacteria-. Ejemplos de aquellos que son adecuados están proporcionados en la sección Fuentes microbianas (véase más abajo). Secuencia de ADN clonada de Rhodothermus marinus En otro aspecto ulterior la invención se refiere a una secuencia de ADN que codifica una enzima que muestra actividad isoamilasa, secuencia de ADN que comprende: (a) la parte de codificación de la isoamilasa de la secuencia de ADN donada en el plásmido puc19 presente en Escherichia coli DSM 11971; 2 (b) la secuencia de ADN mostrada en las posiciones en la SEC ID NO: 3 o su cadena complementaria; (c) un análogo de la secuencia de ADN definida en (a) o (b) que es al menos un 70% homóloga a dicha secuencia de ADN; (d) una secuencia de ADN que hibrida con una sonda de ADN bicatenario que comprende la secuencia mostrada en las posiciones (que codifican la parte madura de la enzima) en la SEC ID NO: 3 con una astringencia media; (e) una secuencia de ADN que codifica una enzima que tiene la secuencia de aminoácidos dispuesta como la parte madura de la SEC ID NO: 4; o (f) una secuencia de ADN que es un fragmento de las secuencias de ADN especificadas en (a), (b), (c), (d), o (e). Actualmente se cree que la parte de codificación de la isoamilasa de la secuencia de ADN donada en el plásmido puc19 presente en la cepa DSM es idéntica a la parte de codificación de la isoamilasa de la secuencia de ADN presentada en la SEC ID NO: 3. En consecuencia, los términos la parte de codificación de la isoamilasa de la secuencia de ADN clonada en el plásmido puc19 presente en DSM y la parte de codificación de la isoamilasa de la secuencia de ADN presentada en la SEC ID NO: 3 pueden ser usados de forma intercambiable. La secuencia de ADN puede ser de origen genómico, o sintético o cualquier combinación de estos. La presente invención también comprende una secuencia de ADN clonada que codifica una enzima que muestra actividad isoamilasa que tiene la secuencia de aminoácidos dispuesta como la parte madura de la SEC ID NO: 4 (es decir posición 1-726), secuencia de ADN que difiere de la SEC ID NO: 3 en virtud de la degeneración del código genético. La secuencia de ADN mostrada en la SEC ID NO: 3 y/o una secuencia de ADN análoga de la invención puede ser obtenida a partir de un microorganismo tal como unas bacterias, una levadura o un hongo filamentoso. Preferiblemente se obtiene a partir de un hongo filamentoso y ejemplos de aquellos adecuados están proporcionados en la sección Fuentes microbianas (véase más abajo). De forma alternativa, la secuencia análoga puede ser construida en base a la secuencia de ADN presentada como la parte de codificación de la isoamilasa de la SEC ID NO: 3, p. ej. puede ser una subsecuencia suya y/o ser construida por introducción de sustituciones de nucleótidos que no dan lugar a otra secuencia de aminoácidos de la isoamilasa codificada por la secuencia de ADN, pero que corresponden al uso del codón del organismo huésped destinado a la producción de la enzima, o por introducción de las sustituciones de nucleótidos que pueden dar lugar a una secuencia de aminoácidos diferente (es decir una variante de la isoamilasa de la invención). Cuando se llevan a cabo sustituciones de nucleótidos, los cambios de aminoácidos son preferiblemente de una naturaleza inferior, es decir las sustituciones de aminoácidos conservadoras que no afectan significativamente al plegamiento o a la actividad de la proteína, pequeñas eliminaciones, normalmente de uno a aproximadamente aminoácidos; pequeñas extensiones amino o carboxiloterminales, tales como un residuo de metionina aminoterminal; un 8

9 péptido de enlace pequeño de hasta aproximadamente -2 residuos; o una extensión pequeña que facilita la purificación, tal como un tracto de polihistidina; un epítopo antigénico o un dominio de unión Ejemplos de sustituciones conservadoras están dentro del grupo de aminoácidos básicos, tales como arginina, lisina, histidina; aminoácidos acídicos, tales como el ácido glutámico y el ácido aspártico; aminoácidos polares, tales como la glutamina y asparraguina; aminoácidos hidrofóbicos, tales como leucina, isoleucina, valina; aminoácidos aromáticos, tales como fenilalanina, triptófano, tirosina; y aminoácidos pequeños, tales como glicina, alanina, serina, treonina, metionina. Para una descripción general de la sustitución de nucleótidos, ver p. ej. Ford et al., (1991), Protein Expression and Purification 2, 9-7. Será evidente para los expertos en la técnica que tales sustituciones pueden ser hechas fuera de las regiones fundamentales para la función de la molécula y además resultan en un polipéptido activo. Los aminoácidos esenciales para la actividad del polipéptido codificados por la secuencia de ADN clonada de la invención, y en consecuencia preferiblemente no sometidos a sustitución pueden ser identificados según los procedimientos conocidos en la técnica, tales como mutagénesis sitio dirigida o mutagénesis de barrido de alanina (véase p. ej. Cunningham and Wells, (1989), Science 244, 81-8). En esta técnica, las mutaciones son introducidas en cada residuo en la molécula, y las moléculas mutantes resultantes son evaluadas por su actividad biológica (es decir isoamilasa) para identificar residuos aminoácidos que son fundamentales para la actividad de la molécula. Los sitios de interacción enzima-sustrato pueden también ser determinados por análisis de estructura cristalina según lo determinado por técnicas tales como análisis de resonancia magnética nuclear, cristalografía o marcado por fotoafinidad (véase p. ej. de Vos et al., (1992), Science 2, 6-312; Smith et al., (1992), J. Mol. Biol. 224, ; Wlodaver et al., (1992), FEBS Lett. 9, 9-64). Los polipéptidos de la presente invención también incluyen polipéptidos fusionados o polipéptidos divisibles de fusión donde otro polipéptido está fusionado en el N-terminal o el C-terminal del polipéptido o del fragmento derivado. Un polipéptido fusionado es producido fusionando una secuencia de ácidos nucleicos (o una parte de ésta) que codifica otro polipéptido hasta una secuencia de ácidos nucleicos (o una parte de ésta) de la presente invención. Las técnicas para producir polipéptidos de fusión son conocidas en la técnica, e incluyen la ligadura de las secuencias de codificación que codifican los polipéptidos de modo que estén en el marco de lectura y que la expresión del polipéptido fusionado esté bajo control del(los) mismo(s) promotor(es) y terminador. Homología de secuencias de ADN La homología de la secuencia de ADN a la que se hace referencia arriba está determinada como el grado de identidad entre dos secuencias que indican una derivación de la primera secuencia a partir de la segunda. La homología puede de manera adecuada ser determinada mediante programas informáticos conocidos en la técnica, tales como GAP proporcionado en el paquete de programa GCG (Program Manual for the Wisconsin Package, Versión 8, Agosto 1994, Genetics Computer Group, 7 Science Drive, Madison, Wisconsin, USA 3711)(Needleman, S.B. and Wunsch, C.D., (1970), Journal of Molecular Biology, 48, ). Usando GAP con los ajustes siguientes para la comparación de secuencias de ADN: penalización de creación de espacio de.0 y penalización de extensión de espacio de 0.3, la zona de codificación de las secuencias de ADN análogas a las que se hace referencia arriba muestra un grado de identidad preferiblemente al menos un 70%, más preferiblemente al menos un 80%, más preferiblemente al menos un 90%, más preferiblemente al menos un 9%, más preferiblemente al menos un 97% con la parte de codificación de la isoamilasa de la secuencia de ADN mostrada en la SEC ID NO: 3. Hibridación Las condiciones de hibridación a las que se hace referencia arriba definen una secuencia de ADN análoga tal y como se define en d) arriba que se hibrida en una sonda de ADN bicatenario que comprende la secuencia mostrada en las posiciones en la SEC ID NO: 3 (es decir la parte de codificación de la isoamilasa de la SEC ID NO: 4), bajo condiciones de astringencia medias o altas son según se describe con detalle más abajo. Las condiciones experimentales adecuadas para determinar la hibridación a media, o alta astringencia entre una sonda de nucleótidos y una secuencia de ADN o ARN homóloga implica el prerremojo del filtro conteniendo los fragmentos de ADN o ARN para hibridar en X SSC (Cloruro de Sodio/Citrato de Sodio, Sambrook et al. 1989) durante min, y la prehibridación del filtro en una solución de X SSC, X solución de Denhardt (Sambrook et al. 1989), 0.% de SDS y 0 µg/ml de ADN de esperma de salmón desnaturalizado y sometido a un baño de ultrasonidos (Sambrook et al ), seguido de la hibridación en la misma solución conteniendo una concentración de ng/ml de una sonda cebada aleatoriamente (Feinberg, A. P. and Vogelstein, B. (1.983) Anal. Biochem. 132: 6-13), marcada en 32 P-dCTP (actividad específica > 1 X 9 cpm/µg) durante 12 horas a aprox. 4ºC. El filtro es luego lavado dos veces durante minutos en 2 X SSC, 0.% de SDS al menos * ºC (astringencia media), más preferiblemente al menos 6ºC (astringencia media/alta), incluso más preferiblemente al menos 70ºC (astringencia alta), e incluso más preferiblemente al menos 7ºC (astringencia altísima). Las moléculas a las que la sonda de oligonucleótidos se hibrida bajo estas condiciones son detectadas usando una película radiográfica. Se ha descubierto que es posible predecir teóricamente si dos secuencias de ADN hibridarán bajo ciertas condiciones específicas o no. 9

10 En consecuencia, como alternativa al método experimental descrito anteriormente la determinación de si una secuencia de ADN análoga hibridará a la sonda de nucleótidos anteriormente descrita o no, puede estar basada en un cálculo teórico de la Tm (temperatura de fusión) en la que dos secuencias de ADN heterólogas con secuencias conocidas hibridarán bajo condiciones específicas (p. ej. con respecto a la concentración de cationes y temperatura). Para determinar la temperatura de fusión para las secuencias de ADN heterólogas (Tm(hetero)) es preciso determinar primero la temperatura de fusión (Tm(homo)) para las secuencias de ADN homólogas. La temperatura de fusión Tm(homo) entre dos cadenas completamente complementarias de ADN (formación de homodúplex) puede ser determinada usando la fórmula siguiente, Tm(homo) = 81.ºC (log M) (%GC) (% form) - 00/L 1 ( Current protocols in Molecular Biology. John Wiley and Sons, 199), donde M se refiere a la concentración molar de cationes en el tampón de lavado, %GC % Guanina (G) y Citosina (C) de número total de bases en la secuencia de ADN, % form % formamida en el lavado tampón, y 2 L la longitud de la secuencia de ADN. Usando esta fórmula y las condiciones de lavado experimentales dadas arriba, Tm(homo) para la formación de homodúplex de la sonda de nucleótidos correspondiente a la secuencia de ADN mostrada en la SEC ID NO: 3, es decir nucleótidos es: Tm(homo) = (log 0.) (6) (0) - (00/2178) Tm(homo) = 99.2ºC 3 M : 2 X SSC corresponde a un conc. catiónico de 0.3 M. %GC El %GC en SEC ID NO: 3 es % form : No hay ninguna formamida en el tampón de lavado. L : la longitud de SEC ID NO: 3 es La Tm determinada por la fórmula anterior es la Tm de una formación de homodúplex (Tm(homo)) entre dos secuencias completamente complementarias de ADN. Para adaptar el valor de la Tm al de dos secuencias de ADN heterólogas, se asume que una diferencia del 1% en la secuencia de nucleótidos entre las dos secuencias heterólogas es igual a un 1ºC de reducción de la Tm ( Current protocols in Molecular Biology. John Wiley and Sons, 199). En consecuencia, la Tm(hetero) para la formación heterodúplex se halla restando la diferencia de homología entre la secuencia análoga en cuestión y la sonda de nucleótidos anteriormente descrita a la Tm(homo). El porcentaje de homología de ADN que debe ser restado se calcula según se describe en este caso (véase arriba). Con las condiciones experimentales anteriores y una temperatura de lavado de 6ºC astringencia media), una secuencia análoga con una homología del 6.8% (0 - (99.2-6) =.8) será considerada para hibridar a la sonda de nucleótidos anteriormente descrita. Homología a secuencias de aminoácidos La homología del polipéptido al que se hace referencia arriba (propiedad (C)) del polipéptido de la invención está determinada como el grado de identidad entre dos secuencias que indican una derivación de la primera secuencia a partir de la segunda. La homología puede de manera adecuada ser determinada mediante programas informáticos conocidos en la técnica tales como GAP proporcionados en el paquete de programa GCG (Program Manual for the Wisconsin Package, Versión 8, Agosto 1994, Genetics Computer Group, 7 Science Drive, Madison, Wisconsin, USA 3711) (Needleman, S.B. and Wunsch, C.D., (1970), Journal of Molecular Biology, 48, ). Usando GAP con los ajustes siguientes para comparación de la secuencia polipeptídica: penalización de creación de espacio de 3.0 y penalización de extensión de espacio de 0.1, la parte madura de un polipéptido codificado por una secuencia de ADN análoga de la invención muestra algo de identidad preferiblemente al menos del 70%, más preferiblemente al menos del 80%, más preferiblemente al menos del 90%, más preferiblemente al menos del 9%, y especialmente al menos del 97% con la parte madura de la secuencia de aminoácidos mostrada en la SEC ID NO: 4, es decir posición en la SEC ID NO: 4.

11 La presente invención está también dirigida a variantes de isoamilasa que tienen una secuencia de aminoácidos que difiere de no más de tres aminoácidos, preferiblemente de no más de dos aminoácidos, y más preferiblemente de no más de un aminoácido desde la parte madura de la secuencia de aminoácidos dispuesta en la SEC ID NO: Reacción cruzada inmunológica Los anticuerpos para ser usados para determinar la reacción cruzada inmunológica pueden ser preparados usando una enzymx purificada. Más específicamente, el antisuero contra la enzymx de la invención puede ser aumentado inmunizando conejos (u otros roedores) según el procedimiento descrito por N. Axelsen et al. en A Manual of Quantitative Immunoelectrophoresis, Blackwell Scientific Publications, 1973, capítulo 23, o A. Johnstone y R. Thorpe, Immunochemistry in Practice, Blackwell Scientific Publications, 1982 (más específicamente p ). Se pueden obtener inmunoglobulinas purificadas a partir del antisuero obtenido, por ejemplo por precipitación de sal ((NH 4 ) 2 SO 4 ), seguida de diálisis y cromatografía de intercambio iónico, p. ej. en DEAE-Sephadex. La caracterización inmunoquímica de proteínas puede ser realizada bien por análisis de difusión doble de Outcherlony (O. Ouchterlony en: Handbook of Experimental Immunology (D.M. Weir, Ed.), Blackwell Scientific Publications, 1967, págs ), por inmunoelectroforesis cruzada (N. Axelsen et al., supra, capítulos 3 y 4), o por inmunoelectroforesis en cohete (N. Axelsen et al., Capítulo 2). Fuentes microbianas En la fecha de prioridad de la presente invención, la taxonomía aplicada más abajo es conforme con el navegador sobre la taxonomía del NCBI en el World Wide Web (WWW). Se espera que una secuencia de ADN que codifica para una enzima homóloga, es decir una secuencia de ADN análoga, se pueda obtener a partir de otros microorganismos. Por ejemplo, la secuencia de ADN puede ser derivada seleccionando de forma similar un banco de ADNc/ADN genómico de otro microorganismo, en particular unas bacterias, tales como una cepa del género Cytophagales, tal como una cepa de Rhodothermus sp., en particular una cepa de R. marinus o R. obamensis, especialmente R. marinus DSM 422. Cepa depositada La secuencia de ADN de longitud total completa que codifica la isoamilasa donada de Rhodothermus marinus DSM 422 ha sido transformada en una cepa de la bacteria E. coli DH12S, comprendida en el plásmido puc19. Dicho transformante ha sido depositado por los inventores según el Tratado de Budapest en el Reconocimiento Internacional del Depósito de Microorganismos a los fines del Procedimiento en materia de patentes en el Deutshe Sammlung von Mikroorganismen und Zellkulturen GmbH., Mascheroder Weg 1b, D Braunschweig República Federal de Alemania, (DSM). Fecha de depósito: Ref. del depositante: NN designación DSM: Escherichia coli DSM Siendo una Autoridad Depositaria Internacional bajo el Tratado de Budapest, Deutshe Sammlung von Mikroorganismen und Zell-kulturen GmbH., ofrece permanencia del depósito de acuerdo con sus reglas y reglamentos de dicho tratado, véase en particular la Regla 9. El acceso a los dos depósitos estarán disponibles durante la pendencia de esta solicitud de patente a una determinada por el Delegado de la Oficina de Patentes y Marcas de Estados Unidos para ser titulada 37 C.F.R. Par y 3 U.S.C. Par También, los depósitos anteriormente mencionados cumplen los requisitos de las solicitudes de patente europea sobre microorganismos según la Regla 28 EPC. El depósito anteriormente mencionado representa un cultivo substancialmente puro de las bacterias aisladas. El depósito está disponible según está requerido por las leyes de patentes extranjeras en los países en los que las solicitudes correspondientes a la solicitud en objeto, o su descendiente están depositadas. No obstante, debe ser entendido que la disponibilidad de la cepa depositada no constituye una licencia para poner en práctica la invención en objeto para derogar los derechos de las patentes concedidos por la acción gubernamental. La secuencia de ADN de la invención, que tiene la secuencia de nucleótidos mostrada en la SEC ID NO: 3, puede ser clonada a partir de la cepa anteriormente mencionada Escherichia coli DSM usando técnicas de donación estándares p. ej. como se describe por Sambrook et al., (1989), Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab.; Cold Spring Harbor, NY. La secuencia de ADN de la invención puede también ser clonada por cualquier método general que implique 6 donación, en vectores adecuados, de una genoteca de ADN de cualquier organismo que se espera que produzca la isoamilasa en cuestión, transformación de células huéspedes adecuadas de E.coli con dichos vectores, 11

12 cultivo de las células huéspedes bajo condiciones adecuadas para expresar cualquier enzima de interés codificada por un clon en la genoteca de ADN, y 1 aislamiento de la enzima que codifica el ADN de tales clones. Una descripción más detallada del método de selección está proporcionada en un ejemplo de funcionamiento de la presente (véase abajo). De forma alternativa, el ADN que codifica una isoamilasa de la invención puede, conforme a unos procedimientos bien conocidos, convenientemente ser donado a partir de una fuente adecuada, tal como cualquiera de los organismos mencionados en la sección Fuentes microbianas, usando la hibridación a sondas de oligonucleótidos sintéticas preparadas basándose en una secuencia de ADN descrita aquí. Por ejemplo, una sonda de oligonucleótidos adecuada puede ser preparada basándose en o preferiblemente ser la parte de codificación de la isoamilasa de las secuencias de nucleótidos presentadas como SEC ID NO: 3 o cualquier subsecuencia adecuada suya, o la base de la SEC ID NO de la secuencia de aminoácidos SEC ID NO: 4. De forma alternativa, la secuencia de ADN puede ser clonada usando cebadores de la PCR preparados basándose en la secuencia de ADN descrita aquí. 2 3 Vectores de expresión recombinantes Un vector recombinante que comprende un constructo de ADN que codifica la enzima de la invención puede ser cualquier vector que puede convenientemente ser sometido a procedimientos de ADN recombinante, y la elección del vector a menudo dependerá de la célula huésped en la que se deba introducir. Así, el vector puede ser un vector de replicación autónoma, es decir un vector que existe como una entidad extracromosómica, cuya replicación es independiente de la replicación cromosómica, p. ej. un plásmido. De forma alternativa, el vector puede ser uno que, al introducirse en una célula huésped, se integre en el genoma de la célula huésped o en su totalidad y se replique con el (los) cromosoma(s) donde haya sido integrado. El vector es preferiblemente un vector de expresión donde la secuencia de ADN que codifica la enzima de la invención está operativamente enlazada a segmentos adicionales requeridos para la transcripción del ADN. En general, el vector de expresión está derivado de ADN plásmido o vírico, o puede contener elementos de ambos. Los términos enlazado operativamente indican que los segmentos están dispuestos de modo que funcionen en concierto para sus objetivos previstos, p. ej. la transcripción se inicia en un promotor y prosigue a través de la secuencia de ADN que codifica para la enzima. El promotor puede ser cualquier secuencia de ADN que muestra actividad transcripcional en la célula huésped de elección y puede derivar de genes que codifican proteínas bien homólogas o heterólogas a la célula huésped Ejemplos de promotores adecuados para el uso en células huéspedes bacterianas incluyen el promotor del gen de amilasa maltogénica de Bacillus stearothermophilus, el gen de alfa-amilasa de Bacillus licheniformis, el gen de alfa-amilasa de Bacillus amyloliquefaciens, el gen de proteasa alcalina de Bacillus subtilis, o el gen de xilosidasa de Bacillus pumilus, o los promotores PR o PL del fago Lambda o los promotores lac, trp o tac de E. coli. La secuencia de ADN que codifica la enzima de la invención puede también, si fuera necesario, estar operativamente conectada a un terminador adecuado. El vector recombinante de la invención puede además comprender una secuencia de ADN que permita que el vector se replique en la célula huésped en cuestión. El vector puede también comprender un marcador seleccionable, p. ej. un gen cuyo producto complementa un defecto en la célula huésped, o un gen que codifica la resistencia a p. ej. antibióticos como canamicina, cloranfenicol, eritromicina, tetraciclina, espectinomicina, o similar, o la resistencia a metales pesados o herbicidas. Para dirigir una enzima de la presente invención en el vía secretora de las células huéspedes, una secuencia señal secretora (también conocida como una secuencia líder, secuencia prepro o secuencia pre) puede ser proporcionada en el vector recombinante. La secuencia señal secretora está unida a la secuencia de ADN que codifica la enzima en el marco de lectura correcto. Las secuencias señal secretoras se posicionan de forma común en a la secuencia de ADN que codifica la enzima. La secuencia señal secretora puede ser aquella asociada normalmente con la enzima o puede provenir de un gen que codifica otra proteína segregada. Los procedimientos usados para ligar las secuencias de ADN que codifican para la presente enzima, el promotor y opcionalmente el terminador y/o la secuencia señal secretora, respectivamente, o para ensamblar estas secuencias mediante esquemas de amplificación de PCR adecuados, y para insertarlos en los vectores adecuados conteniendo la información necesaria para la replicación o integración, son bien conocidos por los expertos en la técnica (ver, por ejemplo, Sambrook et al., op.cit.). 12

13 Células huéspedes La secuencia de ADN que codifica la presente enzima introducida en la célula huésped puede ser bien homóloga o heteróloga a la célula huésped en cuestión. Si fuera homóloga a la célula huésped, es decir producida por la célula huésped en la naturaleza, normalmente será operativamente conectada a otra secuencia promotora o, si fuera aplicable, a otra secuencia señal secretora y/o a una secuencia de terminación distinta de su entorno natural. El término homóloga está destinado a incluir una secuencia de ADN que codifica una enzima nativa a la del organismo huésped en cuestión. El término heteróloga se destina a incluir una secuencia de ADN no expresada por la célula huésped en la naturaleza. Así, la secuencia de ADN puede provenir de otro organismo, o puede ser una secuencia sintética. La célula huésped en la que el constructo de ADN o el vector recombinante de la invención está introducido puede ser cualquier célula capaz de producir la presente enzima, incluyendo bacterias, levadura, hongos y células eucarióticas más grandes. Ejemplos de células huéspedes bacterianas que, durante el cultivo, son capaces de producir la enzima de la invención son bacterias gram-positivas tales como cepas de Bacillus, tales como cepas de B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. agulans, B. circulans, B. lautus, B. megatherium o B. thuringiensis, o cepas de Streptomyces, tales como S. lividans o S. murinus, o bacterias gramnegativas tales como Escherichia Coli. La transformación de las bacterias puede ser efectuada por transformación, electroporación, conjugación de protoplastos, o usando células competentes de una manera conocida per se (ver Sambrook et al., supra). Cuando se expresa la enzima en bacterias como E. coli, la enzima puede ser retenida en el citoplasma, normalmente como gránulos insolubles (conocidos como cuerpos de inclusión), o pueden ser dirigidos al espacio periplásmico por una secuencia de secreción bacteriana. En este caso, las células son lisadas y los gránulos son recuperados y desnaturalizados tras lo cual la enzima es replegada diluyendo el agente desnaturalizante. En este caso, la enzima puede ser recuperada del espacio periplásmico interrumpiendo las células, p. ej. por sonicación o choque osmótico, para liberar el contenido del espacio periplásmico y recuperar la enzima. Cuando se expresa la enzima en bacterias gram-positivas tales como cepas de Bacillus o Streptomyces, la enzima puede ser retenida en el citoplasma, o puede ser dirigida al medio extracelular por una secuencia de secreción bacteriana. En este caso, la enzima puede ser recuperada del medio como se describe abajo. Las células eucarióticas adecuadas son particularmente células micóticas tales como levaduras. Ejemplos de células de levadura adecuadas incluyen células de Saccharomyces spp., en particular cepas de Saccharomyces cerevisiae, Saccharomyces kluyveri, Sacchromyces uvarum, o Schizosacaromyces spp., tales como de Schizosaccharomyces pombe. Métodos para transformar células de levadura con ADN heterólogo y producir polipéptidos heterólogos a partir de ello están descritos, p. ej. en patente estadounidense nº , patente estadounidense nº , patente estadounidense nº , patente estadounidense nº , y patente estadounidense nº , todas ellas están incorporadas en la presente por referencia. Las células transformadas están seleccionadas por un fenotipo determinado por un marcador seleccionable, normalmente de la resistencia a los fármacos o de la capacidad de crecer en ausencia de un nutriente particular, p. ej. leucina. Un vector preferido para el uso en levadura es el vector POT1 descrito en la patente estadounidense nº La secuencia de ADN que codifica el polipéptido de la invención puede ser precedido por una secuencia señal y opcionalmente una secuencia líder, p. ej. según el modo descrito anteriormente. Ejemplos adicionales de células de levadura adecuadas son cepas de Candida spp., tales como cepas de Candida utilis, candida boidinii, o de Kluyveremyces spp., tales como cepas de K. lactis, o de Hansenula spp., p. ej. cepas de H. polimorfa, o de Pichia spp., p. ej. Pichia methanolica, Pichia angusta, Pichia pastoris o Pichia anomala, Yarrowia spp., tales como Yarrowia lipolytica (ver Gleeson et al., J. Gen. Microbiol. 132;1986, págs ; patente estadounidense nº ). Método para producir isoamilasa La presente invención proporciona un método para producir una enzima aislada según la invención, donde una célula huésped adecuada, que ha sido transformada con una secuencia de ADN que codifica la enzima, está cultivada bajo condiciones que permiten la producción de la enzima, y la enzima resultante es recuperada del cultivo. Cuando un vector de expresión que comprende una secuencia de ADN que codifica la enzima es transformado en una célula huésped heteróloga es posible permitir la producción recombinante heteróloga de la enzima de la invención. De ese modo es posible hacer una composición de isoamilasa altamente purificada, caracterizada por estar libre de impurezas homólogas. Según la presente invención la célula huésped heteróloga puede p. ej. ser una cepa de E. coli, Bacillus spp., Saccharomyces, Candida, Pichia, Hansenula. 13

14 El medio usado para cultivar las células huéspedes transformadas puede ser cualquier medio convencional adecuado para hacer crecer las células huéspedes en cuestión. La isoamilasa expresada puede convenientemente ser segregada en el medio de cultivo y puede ser recuperada de éste por procedimientos bien conocidos que incluyen la separación de las células del medio por centrifugado o filtración, precipitación de los componentes proteínicos del medio mediante una sal tal como sulfato de amonio, seguido de procedimientos cromatográficos tales como cromatografía de intercambio iónico, cromatografía de afinidad, o similar. Cultivo puro aislado La invención también se refiere a un cultivo biológico substancialmente puro aislado de la cepa Escherichia coli DSM que contiene una secuencia de ADN que codifica la isoamilasa (la parte de codificación de la isoamilasa de la secuencia de ADN clonada en el plásmido puc19 presente en Escherichia coli DSM 11971) obtenida a partir de una cepa de las bacterias Rhodothermus (será entendido que cualquier mutante de dicha cepa de E.coli que ha retenido la capacidad de codificar la isoamilasa está considerado incluido en la presente invención); y a un cultivo biológico substancialmente puro aislado de Rhodothermus marinus DSM 422 (será entendido que cualquier mutante de dicha cepa de Rhodothermus marinus que ha retenido la capacidad de codificación de la isoamilasa está considerado incluido en la presente invención), a partir de lo cual se ha obtenido la secuencia de ADN presentada como la SEC ID NO: 3. Clonación de una secuencia de ADN a partir de una cepa de Sulfolobus La invención también se refiere a una secuencia de ADN clonada que codifica una enzima con actividad isoamilasa derivada de una cepa de Sulfolobus. La secuencia de ADN puede ser derivada de una cepa de Sulfolobus acidocaldarius o Sulfolobus solfataricus. Las secuencias pueden ser las secuencias de ADN que codifican una isoamilasa de Sulfolobus acidocaldarius descrita en Biochem. Biophys. Acta, 1291, p (1996), puede tratarse de la secuencia de ADN de Sulfolobus solfataricus disponible en GeneBank bajo el número de Acceso Y0826. La invención además se refiere a un vector de expresión recombinante que comprende una secuencia de ADN clonada derivada de Sulfolobus según el modo descrito anteriormente, en particular la secuencia de ADN descrita en Biochem. Biophys. Acta, 1291, p (1996) y GeneBank, nº de acceso Y0826. Además la invención se refiere a una célula huésped que comprende una secuencia de ADN clonada de Sulfolobus de la invención o un vector de expresión recombinante que comprende una secuencia de ADN de Sulfolobus de la invención. El huésped de la invención puede ser una célula eucariótica, en particular una célula micótica, tal como una célula de levadura o una célula micótica filamentosa. Específicamente, la célula huésped puede ser seleccionada del grupo que comprende una cepa de Saccharomyces, candida, Pichia, Hansenula, Fusarium, Aspergillus, Trichoderma, en particular una cepa de Saccharomyces cerevisiae, candida utilis, candida boidinii, Pichia metanolica, Pichia angusta, Pichia pastoris, Pichia anomala, Fusarium ATTC 334, Aspergillus Niger, Aspergillus oryzae, Trichoderma Harzianum o Trichoderma reesei. Finalmente la invención se refiere a un método para producir una enzima que muestra actividad isoamilasa codificada por una secuencia de ADN clonada de la invención, el método comprendiendo el cultivo de una célula huésped de la invención, bajo condiciones que permiten la producción de la enzima, y la recuperación de la enzima del cultivo. La clonación de la secuencia de ADN de Sulfolobus acidocaldarius descrita en Biochem. Biophys. Acta, 1291, p (1996) está descrita más abajo. Materiales y métodos Enzimas Promozymee: Pululanasa (disponible por Novo Nordisk) derivada de Bacillus acidopullulyticus (descrita en EP ). AMG: glucoamilasa de Aspergillus Niger (disponible por Novo Nordisk A/S) α-amilasa: α-amilasa de Bacillus licheniformis con las mutaciones siguientes: A1*+N2*+L3V+M1T+R23K+S29A+AE+Y31H+A33S+E34D+H3I+H16Y+A181T+N190F+A9V+ Q264S (véase WO 97/41213 de Novo Nordisk A/S). 6 14

15 Microorganismo(s) depositado(s) Cepa transformante Una cepa DH12S de E. coli que comprende la isoamilasa de longitud total clonada de Rhodothermus marinus DSM 422 ha sido depositada según el Tratado de Budapest en el Deutshe Sammlung von Mikroorganismen und Zellkulturen GmbH., Mascheroder Weg lb, D Braunschweig República Federal de Alemania, (DSM). Fecha de depósito: Ref. del depositante: NN Designación DSM: Escherichia coli DSM E.coli Top (Invitrogen) Plásmido pbad/myc-his A,B,C (Invitrogen) puc19 (Invitrogen) 2 Soluciones y Medios Medio LB: 1% bacto triptona, 0.% extracto de bacto-levadura, 1% NaCl, ph 7. Medio SOB: 2% bacto triptona, 0.% extracto de levadura, 0.0% NaCl, 2. mm de KCl, mm de MgSO 4, ph 7. 3 Solución de yodo: 2 ml de agua destilada, ml de 0.2% 12, 2.0% Kl y 0.2% H 2 SO 4. Métodos 4 Métodos de biología molecular general A menos que se mencione lo contrario, las manipulaciones de ADN y transformaciones fueron realizadas usando métodos estándares de biología molecular (Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, F. M. et al. (eds.) Current protocols in Molecular Biology. John Wiley and Sons, 199; Harwood, C. R., and Cutting, S. M. (eds.) Molecular Biological Methods for Bacillus. John Wiley and Sons, 1990). Las enzimas para las manipulaciones del ADN fueron usadas según las especificaciones de los proveedores. 0 Enzimas para manipulaciones de ADN A menos que se mencione lo contrario todas las enzimas para las manipulaciones del ADN, tales como p. ej. endonucleasas de restricción, ligasas etc., están obtenidas por New England Biolabs, Inc. Ejemplos Ejemplo 1 Selección de isoamilasa por PCR a) Condiciones de la PCR Para proporcionar isoamilasas termoestables, se realizo una alineación de cinco isoamilasas conocidas cuyos datos de la secuencia proteínica están disponibles (ver Tabla 1). 6 1

16 TABLA 1 1 Pseudomonas amyloderammosa Biochem. Biophys. Acta, 87, pág (1990) 2 Pseudomonas sp. Publicación de Patente Europea número: EP A2 3 Flavobacterium sp. Publicación de Patente Europea Internacional número: WO 96/ Flavobacterium odoratum Publicación de Patente Japonesa número: JP A Sulfolobus acidocaldarius Biochem. Biophys. Acta, 1291, pág (1996) 1 Dos regiones conservadas (ver i6 y i7 abajo) sin demasiada degeneración fueron identificadas. i6: RFNPNKL(V)L (residuos de isoamilasa de Pseudomonas amyloderamosa) i7: NYWGYMT (residuos de isoamilasa de Pseudomonas amyloderamosa) Los cebadores de la PCR fueron diseñados en base a dichas regiones conservadas. 2 cebador iso 6: -gitt(tc)aa(tc)cciaa(tc)aa(ag)(tcg)ti(tc)t-3 (SEC ID No: 1) 3 cebador iso 7: -gtcat(ga)taicccca(ag)ta(ga)tt-3 (SEC ID No: 2) Las reservas de ADN genómico de varias cepas bacterianas fueron preparadas con el método descrito en Current Protocols in Molecular Biology, unit 2.4 Preparation of Genomic DNA from Bacteria. Las condiciones de la PCR están mostradas como sigue, ADN genómico 0 ng cebador iso 6 cebador iso 7 2 µl de 0 pmol/µl (0 pmol) 2 µl de 0 pmol/µl (0 pmole) 2. mm de mezcla dntp 2 µl 4 x tampón Gen-Taq µl ADN-polimerasa Gen-Taq 2 unidades 0 se añadió H 2 O hasta un total de 0 µl Los ciclos de la PCR fueron realizados en el programa siguiente: 94ºC durante min, 0ºC durante 1. min, 72ºC durante 3 minutos, y 94ºC durante 1. min, 0ºC durante 1. min, 72ºC durante 3 min repetir 24 veces, y luego 94ºC durante 1. min, 0ºC durante 1. min, 72ºC durante 1 min. Diez ml de partes alícuotas de cada PCR se aplican en un 1.% de gel de agarosa para visualizar el fragmento previsto de bp. b) Secuenciación de positivos 6 Los fragmentos purificados fueron ligados al vector-t (Novagen) con el kit de ligadura de ADN (Takara Ver2.). Usando la mezcla ligada, la transformación de JM9 de E. coli competente fue realizada por el método de Hanahan. Los transformantes que soportan los fragmentos fueron cultivados y los plásmidos fueron preparados con el kit de QlAgen miniprep. Los plásmidos purificados se utilizan como molde de ADN en la reacción de secuenciación por ciclos (PRISM Dyedeoxy Terminator Cycle Sequencing Mix) de ambas cadenas usando cebadores Universales. La secuencia fue determinada con ABI PRISM 3 Genetic Analyzer (Perkin Elmer) y fueron alineados con el software MEgAlign (ADN Star, Laser gene). 16

17 Cinco cepas produjeron fragmentos del tamaño esperado de aproximadamente bp, y estos fueron purificados, secuenciados, y alineados. Los fragmentos tenían homología con las secuencias de isoamilasa publicadas como en la Tabla 2. El cálculo de homología fue realizado según se ha descrito previamente en esta especificación. TABLA 2 Cepas identificadas % homología con* Flavobacterium sp. FO Flavobacterium vorans ATCC Xantomonas campestris ATCC Rhodothermus marinus DSM Rhodothermus obamensis JCM los números se refieren a la Tabla 1 2 Las secuencias de a.a. de las enzimas mostradas en la tabla 2 están mostradas en el Listado de secuencias más abajo: Flavobacterium sp. IFO 1490: SEC ID NO: 11 Flavobacterium devorans ATCC 829: SEC No: 12 Xanthomonas campestrys ATCC 31922: SEC ID NO: 13 3 Rhodothermus marinus DSM 422: SEC NO: 4 Rhodothermus obamensis JCM 978: SEC ID NO: De las cinco, se seleccionó Rhodothermus marinus DSM 422 (SEC ID NO: 4) y Rhodothermus obamensis JCM 978 (SEC ID NO: 14) con la máxima temperatura de crecimiento óptimo (6-70ºC). Como las dos secuencias de fragmento son casi idénticas, sólo una de éstas, Rhodothermus marinus DSM 422, fue además empleada para la donación y expresión. Ejemplo 2 Clonación de un cien que codifica una isoamilasa termoestable y su expresión en E.coli Usando el método de selección por PCR para la isoamilasa anteriormente descrita se descubrió que Rhodothermus marinus, con una temperatura de crecimiento superior a ºC, tiene un gen que codifica una isoamilasa. El gen de isoamilasa de Rhodotermus marinus DSM 422 fue clonado con la técnica de hibridación de colonias como sigue: a) Hibridación de Southern 6 El ADN genómico de Rhodothermus marinus fue preparado según los métodos descritos en Current Protocols in Molecular Biology, unidad 2.4 Preparation of Genomic DNA from Bacteria. Se efectuó el Southern blotting con los métodos descritos en Current protocols in Molecular Biology, unidad Southern blotting. La membrana con fragmentos de ADN genómico fue prehibridada en una solución de hibridación ( X SSC, 0.% agente reactivo de bloqueo (Boehringer Mannheim), 0.1% N-lauroilsarcosina, y 0.02% SDS) a 68ºC durante 1 hora. Luego se hibridó en la solución de hibridación que incluía ng/ml de la sonda que fue el fragmento obtenido mediante la selección por PCR marcada por DIG DNA labeling Mix (Boehringer Mannheim) a 68ºC durante 12 horas. Luego, se detectó la sonda por DIG Nucleic Acid Detection Kit (Boehringer Mannheim). La hibridación de Southern mostró que un fragmento de aproximadamente 7 kbp de ADN genómico digerido con EcoRl se hibridó con la sonda. El ADN genómico digerido con EcoRl (6 a 8 kbp) fue extraído del 1% de gel de agarosa con Gel extraction kit (QlAgne). 17

18 b) Hibridación de colonias Los fragmentos digeridos por EcoRI fueron ligados en puc 19 para hacer una genoteca de ADN. Fueron transformados en DH12S Electromax de E.coli (Gibco BRL) por electroporación y colocados en placas sobre una placa de LB que incluía 0 mg/ml de ampicilina. Después del cultivo durante toda la noche a 37ºC estas colonias fueron replicadas en una membrana de nilón. Se mojaron en una solución de desnaturalización (1. M de NaCl y 0. M de NaOH) durante 7 min y luego en una solución de neutralización (1. M de NaCl, 0. M de Tris-HCI ph 7.2), y M de EDTA). Las condiciones de hibridación fueron las mismas que las de la hibridación de Southern. Entre 00 transformantes que fueron seleccionados por hibridación de colonias, 3 colonias hibridaron con la sonda. c) Análisis por restricción de clones positivos 1 2 Los plásmidos fueron preparados a partir de 3 transformantes, y la hibridación de Southern mostró que estos 3 transformantes tenían la misma inserción de un fragmento de EcoRI de 7 kbp que hibridó con la sonda. El mapa de la enzima de restricción de uno de los clones positivos denominado prisa, fue determinado y está mostrado en la figura 1. d) Secuenciación del gen de Isoamilasa La secuencia de nucleótidos del gen de isoamilasa fue determinada usando ABI PRISMTM 3 Genetic Analyzer. La reacción de secuenciación se efectuó usando el dye terminator cycle sequencing FS ready reaction kit (P/N 213). La reacción fue seguida del protocolo mencionado por PE Applied Biosystems. Los cebadores fueron diseñados a partir de la secuencia determinada de la ubicación de la sonda bp determinadas de ORF y la secuencia de aminoácidos deducida están mostradas en la SEC ID NO: 3. La secuencia de la sonda para hibridación es nt de la SEC ID NO: 3. e) Vector de expresión pbad/myc-his B fue usado para la expresión. 3 f) Clonación del gen de isoamilasa para la expresión El gen de isoamilasa de R. marinus fue donado por PCR a partir de pria. Los cebadores 4 Cebador N: gtcagtagcccatggcacattagcgc (SEC ID No: ) Cebador BX2: ctcggccggactagatctgtcttc (SEC ID No: 6) El sitio Ncol fue diseñado en el cebador N. ATG del sitio Ncol fue usado como el codón de iniciación. Debido al sitio Ncol (ccatgg), la segunda Serina del aminoácido cambió a Alanina. En el cebador BX2, el sitio XbaI fue diseñado detrás del codón de detención. Se efectuó la PCR el cebador con las siguientes condiciones usando el cebador N y cebador BX2. 0 ADN genómico cebador sentido 0 ng 1 ml de 0 pmol/ml (0 pmol) cebador antisentido 2. mm de mezcla de dntp 2 ml 1 ml de 0 pmol/ml (0 pmol) x tampón Taq DNA polimerasa ml 1 unidad H 2 O fue añadido al total hasta 0 ml 6 Los ciclos de la PCR fueron realizados en el programa siguiente. 94ºC min, ºC 1. min, 72ºC 3 min, luego 94ºC 1. min, ºC 1. min, 72ºC 3 min, repetición 24 veces, y 94ºC 1. min, ºC 1. min, 72ºC 1 min. 18

19 El fragmento obtenido (aproximadamente 2 kbp) fue tratado con Ncol y XbaI, luego fue ligado con pbad/myc- His B y se obtuvo el transformante conteniendo el plásmido denominado pbx2. El huésped para la expresión fue E.coli Top. 1 g) Condición para la expresión El transformante con pbx2 fue cultivado en 0 ml de medio LB, incluyendo 0 mg/ml de ampicilina a 37ºC durante toda la noche. Un ml de cultivo de semillas fue inoculado hasta 0 ml de medio SOB incluyendo 0 mg/ml de ampicilina y fue cultivado a 37ºC durante 2. horas. Luego 0 ml de arabinosa al % fueron añadidos para inducir las proteínas recombinantes. El cultivo fue continuado a 37ºC durante toda la noche. Al día siguiente, las células fueron recogidas por centrifugado. Las células fueron lavadas con 0 mm de tampón de Citrato de sodio (ph.0). Luego las células fueron suspendidas con el mismo tampón incluyendo 1 mg/ml de lisozima y conservadas a 4ºC durante 1 hora. Después del tratamiento con lisozima, las células fueron interrumpidas por ultrasonidos. Se obtuvo el sobrenadante por centrifugado a rpm durante minutos. El detrito fue interrumpido por ultrasonidos nuevamente. El tratamiento por ultrasonidos fue repetido una vez más. Finalmente, el sobrenadante fue reunido y calentado a 70ºC durante 1 hora para eliminar las proteínas de la cepa huésped. Se efectuó el centrifugado a rpm durante minutos y el sobrenadante constituyó la muestra de isoamilasa cruda. Ejemplo 3 Caracterización de la isoamilasa donada de Rhodothermus marinus a) Método de ensayo 2 3 El carácter de la isoamilasa fue investigado por el método de ensayo siguiente. ml de 1% amilopectina de arroz encerado y 0 ml de 0 mm de tampón citrato fueron preincubados durante minutos. La reacción fue comenzada añadiendo 0 ml de solución enzimática. Después de minutos de incubación, ml de mezcla reactiva fueron puestos en la solución de yodina (2 ml de D.W. y µl de 0.2% l 2, 2.0% Kl y 0.2% H 2 SO 4 ). Luego su valor OD0 fue medido. Se añadió agua destilada en vez de solución enzimática en el blanco. b) ph óptimo a 0ºC El ph óptimo de la isoamilasa de Rhodothermus fue determinado. La reacción se efectuó a 0ºC. El ph óptimo fue determinado a ph.0. La curva de ph está mostrada en la figura 2. c) Temperatura óptima a ph.0 Se determinó la temperatura óptima de la isoamilasa de Rhodothermus. La reacción se efectuó a ph a entre º-89ºC. Se determinó que la temperatura óptima estaba alrededor de 8ºC. La curva de temperatura está mostrada en la figura 3. d) Peso molecular y pl 4 El P M de Rhodothermus fue determinado por SDS PAGE. SDS PAGE se efectuó usando el Sistema Phast con gel de gradiente -1 (Pharmacia Biotech). El P M de la proteína recombinante fue calculado a 80 kda. e) Secuencia de aminoácidos N-terminal de la proteína recombinante 0 La secuencia de aminoácidos N-terminal de la proteína recombinante fue determinada. El resultado fue idéntico a la secuencia de aminoácidos deducida de la secuencia de nucleótidos (se cambió Serina por Alanina debido al cebador N). Ejemplo 4 6 Conversión de almidón usando la isoamilasa de Rhodothermus Para probar el efecto de la isoamilasa de Rhodothermus marinus en el rendimiento de glucosa en procesos de conversión de almidón un proceso de conversión estándar de almidón en dos fases fue realizado con/sin adición de isoamilasa en las fases de licuefacción y de sacarificación. Proceso estándar de conversión del almidón Un % p/p de maltodextrina DE obtenida a partir de almidón de maíz común fue usado como el material precursor. La fase de licuefacción se efectuó a 80ºC, ph., durante 90 minutos ante una variante de α-amilasa (8 microgramos/gramo de Sólido Seco). 19

20 La fase de sacarificación se efectuó a ºC, ph 4., durante un periodo de 48 horas en presencia de AMG (0.18 AGU/gramo de Sólido Seco) con/sin adición de una pululanasa (Promozyme ) (0.06 PUN/gramo de Sólido Seco). En la tabla 3 mostrada en la figura 7 las pruebas realizadas y el efecto de la isoamilasa en los rendimientos de DP1, DP2, DP3 y DP4+ están catalogados. Adición de isoamilasa en la fase de licuefacción 1 2 Como se puede observar en dicha Tabla 0 o 0 microgramos/gramo de isoamilasa de Rhodothermus marinus como Sólido Seco fue añadido en la PRUEBA 3, 4, 8 y 9 durante la licuefacción. En la PRUEBA 1, y 7 la α-amilasa fue inactivada después de 90 minutos de licuefacción ajustando el ph a 3.0 durante 1 minutos a 80ºC. En todas las pruebas cuando se añade isoamilasa se obtiene un rendimiento de DP4+ inferior. Esto indica que el sustrato ha sido más accesible para la α-amilasa y el AMG. Comparando la prueba 2 (es decir sin añadir isoamilasa) con 3 y 4 (es decir, adición de isoamilasa) se puede observar que el rendimiento de DP3 (es decir panosa) se reduce de 1.2% a 1.0% y 0.9%, respectivamente, y que el rendimiento de DP1 (es decir glucosa) aumenta de 96.3% a 96.% y 96.8%, respectivamente. Adición de isoamilasa en la fase de sacarificación En la prueba 7 la isoamilasa fue añadida durante la fase de sacarificación. Comparando la prueba 7 con la prueba, se puede observar que el rendimiento de DP3 (es decir panosa) se reduce de 0.% a 0.4%, y que el rendimiento de DP1 (es decir glucosa) aumenta de 93.2% a 94.8a Conclusión La adición de la isoamilasa de Rhodothermus marinus durante la conversión del almidón ocasiona un rendimiento aumentado de glucosa. Ejemplo Clonación y expresión del gen de isoamilasa de Sulfolobus acidocaldarius 3 a) Clonación del gen de isoamilasa El gen de isoamilasa de Sulfolobus acidocaldarius fue clonado por PCR. Los cebadores fueron diseñados en base a la secuencia mostrada en el artículo de la Tabla 1. cebador SINH: -gtatatcaaagcttatgaaagatcgaccattaaagcctg-3 (SEC ID No: 7) 4 cebador SICX: -ggttgtctagatcacctggaactctatcctcctgta-3 (SEC ID No: 8) La PCR se efectuó por el procedimiento descrito en el ejemplo 2-f. 0 Se obtuvo el fragmento derecho de tamaño (aproximadamente 2kb) y fue purificado usando el kit de purificación por PCR (QlAgen). El fragmento purificado fue tratado con HindIII y Xba I. b) Construcción del vector de expresión El vector de expresión fue construido a partir de pjs026 que tiene el promotor TPI (Annals New York Academy of Sciences, vo1782, p2 J.S.Okkels). pjsohx fue hecho a partir de pjso26 para eliminar el sitio BamHI y se añadió el sitio HindIII usando los 2 oligonucleótidos siguientes como cassette, gatcaagcttggaattcgctcgagct (SEC ID NO: 9) y ctagagctcgagcgaattccaagctt (SEC ID NO: ). El gen donado de Sulfolobus acidocaldarius fue insertado en el sitio Hind III y XbaI de pjsohx y se obtuvo el vector de expresión denominado pfsi82. pfsi 82 fue transformado en YNG318 de Saccharomyces cerevisiae. El mapa pfsi82 está mostrado en la figura 4. 6 c) Procedimiento de expresión El transformante que contiene pfsi82 fue cultivado en 0 ml de YPD durante 2 días. Las células fueron cosechadas por centrifugado a.000 rpm durante min y se hizo el esferoplasto con un protocolo básico (Bio manual series

Int. Cl.: 74 Agente: Tomás Gil, Tesifonte-Enrique

Int. Cl.: 74 Agente: Tomás Gil, Tesifonte-Enrique 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 278 2 1 Int. Cl.: C12N 9/ (06.01) C12N 1/6 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 037797.4

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre.

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Glúcidos, lípidos, proteínas, ácidos nucleicos. Oxígeno, calcio,

Más detalles

11 Número de publicación: 2 213 164. 51 Int. Cl. 7 : A23J 3/34. 72 Inventor/es: Nielsen, Per Munk. 74 Agente: Tomás Gil, Tesifonte-Enrique

11 Número de publicación: 2 213 164. 51 Int. Cl. 7 : A23J 3/34. 72 Inventor/es: Nielsen, Per Munk. 74 Agente: Tomás Gil, Tesifonte-Enrique 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 213 164 1 Int. Cl. 7 : A23J 3/34 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 993864.9 86 Fecha de presentación:

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR. RESUMEN Las repeticiones

Más detalles

Los polímeros naturales están presentes en sustancias como la celulosa, el caucho natural y la seda, pero su mayor relevancia está al interior de

Los polímeros naturales están presentes en sustancias como la celulosa, el caucho natural y la seda, pero su mayor relevancia está al interior de Polímeros Naturales Los polímeros naturales están presentes en sustancias como la celulosa, el caucho natural y la seda, pero su mayor relevancia está al interior de nuestro propio cuerpo y se denomina

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REGULACIÓN DE LA EXPRESIÓN GENÉTICA INTRODUCCIÓN La transmisión de la información genética (transcripción), posibilita la formación de proteínas, cuyas funciones van a caracterizar la actividad y morfología

Más detalles

Ficha Docente: BIOTECNOLOGÍA FARMACÉUTICA I

Ficha Docente: BIOTECNOLOGÍA FARMACÉUTICA I BIOTECNOLOGÍA FARMACÉUTICA I CURSO 2015-16 FACULTAD DE FARMACIA UNIVERSIDAD COMPLUTENSE DE MADRID I.- IDENTIFICACIÓN NOMBRE DE LA ASIGNATURA: CARÁCTER: Optativa MATERIA: Complementaria 9.2: Itinerario

Más detalles

INFLUENCIA DE LOS COMPONENTES DE LA HARINA EN LA PANIFICACIÓN.

INFLUENCIA DE LOS COMPONENTES DE LA HARINA EN LA PANIFICACIÓN. INFLUENCIA DE LOS COMPONENTES DE LA HARINA EN LA PANIFICACIÓN. PARTE 1. ALMIDON Por Carlos J. Bernabé. INDESPAN SL INTRODUCCION.- El presente articulo pretende profundizar en la influencia de los componentes

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles

GENES Y MANIPULACIÓN GENÉTICA

GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA

REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA Tema 4 REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA 1. ADN y ARN pág 92-93 -Composición química y conceptos: ADN, ARN, nucleótidos, bases nitrogenadas, ácido fosfórico. -Estructura: doble hélice, cadenas complementarias.

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

Unidad 5 (Parte 5) Aminoácidos, Péptidos y Proteínas.

Unidad 5 (Parte 5) Aminoácidos, Péptidos y Proteínas. Unidad 5 (Parte 5) Aminoácidos, Péptidos y Proteínas. Las proteínas se encuentran en todos los organismos vivos, son de muchos tipos diferentes y desempeñan muchas funciones biológicas distintas. La queratina

Más detalles

Ambientación Universitaria BIOLOGÍA. Guía de Actividades 2014

Ambientación Universitaria BIOLOGÍA. Guía de Actividades 2014 1 Ambientación Universitaria BIOLOGÍA Guía de Actividades 2014 2 I.- INTRODUCCIÓN- CONCEPTO DE CIENCIA Y VIDA 1) Lea el siguiente texto. Mencione ejemplos de lo que considere investigación en ciencias

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

CREACIÓN DE ALGORITMOS PARA LA PROGRAMACIÓN DE BACTERIAS POR MEDIO DEL ADN

CREACIÓN DE ALGORITMOS PARA LA PROGRAMACIÓN DE BACTERIAS POR MEDIO DEL ADN CREACIÓN DE ALGORITMOS PARA LA PROGRAMACIÓN DE BACTERIAS POR MEDIO DEL ADN Autor: Gabriel Jiménez Domínguez INSA de Lyon, Francia Laboratorio IBISC de la universidad de Evry Val d Essonne Tutor: Frank

Más detalles

EL PROCESO DE EXTRUSIÓN EN CEREALES Y HABAS DE SOJA. I. UTILIZACIÓN DE NUTRIENTES

EL PROCESO DE EXTRUSIÓN EN CEREALES Y HABAS DE SOJA. I. UTILIZACIÓN DE NUTRIENTES EL PROCESO DE EXTRUSIÓN EN CEREALES Y HABAS DE SOJA. I. UTILIZACIÓN DE NUTRIENTES EL PROCESO DE EXTRUSIÓN EN CEREALES Y HABAS DE SOJA I. EFECTO DE LA EXTRUSIÓN SOBRE LA UTILIZACIÓN DE NUTRIENTES 1. INTRODUCCIÓN

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

PRODUCCIÓN DE PROTEÍNAS PICHIA PASTORIS RECOMBINANTES EN. Procesos biotecnológicos Dra. Claudia Elena Año 2015

PRODUCCIÓN DE PROTEÍNAS PICHIA PASTORIS RECOMBINANTES EN. Procesos biotecnológicos Dra. Claudia Elena Año 2015 PRODUCCIÓN DE PROTEÍNAS RECOMBINANTES EN PICHIA PASTORIS Procesos biotecnológicos Dra. Claudia Elena Año 2015 CARACTERÍSTICAS GENERALES DEL SISTEMA DE EXPRESIÓN EN PICHIA Ventajas del sistema de expresión

Más detalles

AMINOÁCIDOS SE PUEDEN UNIR POR ENLACES PEPTÍDICOS

AMINOÁCIDOS SE PUEDEN UNIR POR ENLACES PEPTÍDICOS Tema 4. Proteínas: funciones biológicas y estructura primaria. Enlace peptídico. Péptidos y proteínas. Diversidad de funciones biológicas. Niveles de organización estructural de las proteínas. Separación

Más detalles

CURSO ACADÉMICO 2012-2013

CURSO ACADÉMICO 2012-2013 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2012-2013 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, ecología y Genética Área de conocimiento: Genética Ciclo:2º Curso: 4º Tipo:

Más detalles

TEMARIO PARA EL EXAMEN DE BIOQUÍMICA

TEMARIO PARA EL EXAMEN DE BIOQUÍMICA TEMARIO PARA EL EXAMEN DE BIOQUÍMICA PARTE I. ESTRUCTURA BIOLÓGICA Y QUÍMICA DE LAS PROTEÍNAS 1. CARACTERÍSTICAS QUÍMICAS DE LA MATERIA VIVA 1. La mayoría de los organismos están compuestos solamente de

Más detalles

Proteínas: Leche y caseína

Proteínas: Leche y caseína Proteínas: Leche y caseína El papel de la leche en la naturaleza es para alimentar y proporcionar una protección inmunológica para los mamíferos jóvenes. La leche ha sido una fuente de alimento para los

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

Capítulo 5: BIOMOLÉCULAS

Capítulo 5: BIOMOLÉCULAS Capítulo 5: BIOMOLÉCULAS De qué están hechas las células? Al analizar los átomos y moléculas presentes en las células, se observa que todas ellas se asemejan: una gran proporción es agua; el resto es un

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

11 Número de publicación: 2 217 328. 51 Int. Cl. 7 : C07K 14/82. 74 Agente: Ponti Sales, Adelaida

11 Número de publicación: 2 217 328. 51 Int. Cl. 7 : C07K 14/82. 74 Agente: Ponti Sales, Adelaida 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 217 328 51 Int. Cl. 7 : C07K 14/82 C12Q 1/68 G01N 33/53 A61K 38/17 A61K 48/00 A01K 67/027 12 TRADUCCIÓN DE PATENTE EUROPEA T3

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles

ARN mensajero. Síntesis y procesamiento. Corte y empalme. Capping. Poliadenilación. Estabilidad. Genética 1 er Curso. Facultad de Medicina TEMA 0-3

ARN mensajero. Síntesis y procesamiento. Corte y empalme. Capping. Poliadenilación. Estabilidad. Genética 1 er Curso. Facultad de Medicina TEMA 0-3 Facultad de Medicina Genética 1 er Curso TEMA 0-3 EXPRESIÓN GÉNICA: TRANSCRIPCIÓN Y TRADUCCIÓN ARN mensajero. La transcripción en eucariotas. Ribosomas. La traducción. ARN mensajero Apartados Síntesis

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles

ELECTROFORESIS. Agarosa. Poliacrilamida

ELECTROFORESIS. Agarosa. Poliacrilamida ELECTROFORESIS DE ADN ELECTROFORESIS Agarosa Poliacrilamida Finalidad de la electroforesis Separar Identificar Purificar 1 2 3 4 5 Tinción del ADN Bromuro de etidio Absorbancia a 302 y 366 y emisión a

Más detalles

Textos de refuerzo. 2. Formación de ADN y ARN. 1. Principios de bioquímica. Proteínas. 1 Unidad 3

Textos de refuerzo. 2. Formación de ADN y ARN. 1. Principios de bioquímica. Proteínas. 1 Unidad 3 1. Principios de bioquímica 2. Formación de ADN y ARN 1. Principios de bioquímica La bioquímica estudia los componentes químicos de los seres vivos: proteínas, carbohidratos, lípidos y ácidos nucleicos.

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

CICLO DE SEMINARIOS NUEVAS TÉCNICAS DE MEJORAMIENTO GENÉTICO EN PLANTAS

CICLO DE SEMINARIOS NUEVAS TÉCNICAS DE MEJORAMIENTO GENÉTICO EN PLANTAS CICLO DE SEMINARIOS NUEVAS TÉCNICAS DE MEJORAMIENTO GENÉTICO EN PLANTAS MUTAGÉNESIS DIRIGIDA POR OLIGONUCLEÓTIDOS (ODM) Dvorak Montiel Condado, Ph. D Profesor Tiempo Completo Facultad de Ciencias Biológicas,

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS Asignatura: Frecuencia: Docente a cargo: Destinatarios: Anual 5 horas por semana Lic. César R. Olsina

Más detalles

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA DATOS DE LA EMPRESA Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC- SODERCAN), Avda. Herrera Oria s/n. Santander. El tutor CSIC fue Raúl Fernández

Más detalles

TALLER EVALUATIVO- CARBOHIDRATOS

TALLER EVALUATIVO- CARBOHIDRATOS TALLER EVALUATIVO- CARBOHIDRATOS ÁREA/ASIGNATURA: QUIMICA Grado : 11 DOCENTE: Yadira Eugenia Guarin Blanco FECHA: 04/10/2013 1. Realiza la siguiente lectura, copia las preguntas en el cuaderno y responde.

Más detalles

PROPIEDAD INDUSTRIAL

PROPIEDAD INDUSTRIAL FORO EMPRENDEDOR BCN2011 DE LA GENERACIÓN DE CONOCIMIENTO A LA GENERACIÓN DE VALOR: SUPERANDO EL VALLE DE LA MUERTE PROPIEDAD INDUSTRIAL Juan Arias Sanz Licenciado en C. Químicas European Patent Attorney

Más detalles

Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA

Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal LICENCIATURA EN QUÍMICAS MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA PROGRAMA DE LAS ASIGNATURAS TÉCNICAS DE BIOLOGÍA MOLECULAR

Más detalles

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 249 794 1 Int. Cl. 7 : C12N 9/02 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9766.6 86 Fecha de presentación

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

TEMA 6. PURIFICACIÓN DE PROTEÍNAS

TEMA 6. PURIFICACIÓN DE PROTEÍNAS TEMA 6. PURIFICACIÓN DE PROTEÍNAS 1. Introducción 2. Métodos de rotura celular y extracción de proteínas 3. Métodos cromatográficos 4. Métodos electroforéticos 1. Introducción La mayor parte de las investigaciones

Más detalles

Aplicación de los microarrays de DNA al estudio de la resistencia a isoniazida en Mycobacterium tuberculosis

Aplicación de los microarrays de DNA al estudio de la resistencia a isoniazida en Mycobacterium tuberculosis Aplicación de los microarrays de DNA al estudio de la resistencia a isoniazida en Mycobacterium tuberculosis PNAS, 22: 12833-12838 (1999) Tuberculosis La tuberculosis es una enfermedad crónica infecciosa

Más detalles

FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General

FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General 1- Diga si son falsas o verdaderas las siguientes afirmaciones con respecto al núcleo celular: I. La envoltura nuclear presenta dos

Más detalles

Examen nº 3 Opción A

Examen nº 3 Opción A Examen nº 3 1. Indique qué es un enlace O-glucosídico [0,2] y qué grupos funcionales participan [0,1]. Cite dos polisacáridos que se forman por la polimerización de monosacáridos de configuración α [0,15]

Más detalles

Unidad 5 (Parte 6) Aminoácidos, Péptidos y Proteínas.

Unidad 5 (Parte 6) Aminoácidos, Péptidos y Proteínas. Unidad 5 (Parte 6) Aminoácidos, Péptidos y Proteínas. Las proteínas se encuentran en todos los organismos vivos, son de muchos tipos diferentes y desempeñan muchas funciones biológicas distintas. La queratina

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles

11 Número de publicación: 2 214 165. 51 Int. Cl. 7 : H04L 12/58. 72 Inventor/es: Degraeve, Michel. 74 Agente: Curell Suñol, Marcelino

11 Número de publicación: 2 214 165. 51 Int. Cl. 7 : H04L 12/58. 72 Inventor/es: Degraeve, Michel. 74 Agente: Curell Suñol, Marcelino 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 214 16 1 Int. Cl. 7 : H04L 12/8 H04Q 7/22 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 0187007. 86 Fecha

Más detalles

VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009

VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009 VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009 Caracterización y estudio de la función de un gen (Tb podría ser un fragmento de DNA genómico para el estudio de splicing o del promotor de un

Más detalles

el ARN heterogéneo nuclear que cumple diferentes funciones en el núcleo de las células.

el ARN heterogéneo nuclear que cumple diferentes funciones en el núcleo de las células. Tema 4.- Genética microbiana. Elementos genéticos bacterianos. Transferencia horizontal de material genético en microorganismos: transformación, conjugación y transducción. Elementos genéticos de los virus.

Más detalles

COPIA NO VÁLIDA PARA TRÁMITE

COPIA NO VÁLIDA PARA TRÁMITE PÁGINA: 1 de 6 FACULTAD DE: CIENCIAS BASICAS PROGRAMA DE: BIOLOGIA PLANEACIÓN DEL CONTENIDO DE CURSO 1. IDENTIFICACIÓN DEL CURSO NOMBRE : Biología Molecular CODIGO : 20116 SEMESTRE : SEXTO INTENSIDAD HORARIA

Más detalles

LAS PROTEÍNAS, LOS GLÚCIDOS Y LAS GRASAS

LAS PROTEÍNAS, LOS GLÚCIDOS Y LAS GRASAS LAS PROTEÍNAS, LOS GLÚCIDOS Y LAS GRASAS Las proteínas son elementos de construcción. Hombre de 65 kilos 65 gramos de proteínas Las necesidades diarias de proteínas se estiman en 1 g por kilo de peso.

Más detalles

Los mecanismos de las reacciones de la glucólisis son, en general, sustituciones nucleofílicas. Veamos algunos ejemplos:

Los mecanismos de las reacciones de la glucólisis son, en general, sustituciones nucleofílicas. Veamos algunos ejemplos: METABLISM DE AZÚAES III. Mecanismos de reacción Los mecanismos de las reacciones de la glucólisis son, en general, sustituciones nucleofílicas. Veamos algunos ejemplos:. Transferencia de grupo fosforilo

Más detalles

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR Convocatoria mayo de 2005 BIOLOGIA

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR Convocatoria mayo de 2005 BIOLOGIA Convocatoria mayo de 2005 BIOLOGIA a) El ADN es la molécula portadora del mensaje genético: define cómo está compuesto el ADN y qué diferencias existen entre el ADN y el ARN b) Explica qué es un gen y

Más detalles

PROTEÍNAS. Las proteínas están constituidas por la unión de numerosas moléculas sencillas (monómeros) denominados aminoácidos.

PROTEÍNAS. Las proteínas están constituidas por la unión de numerosas moléculas sencillas (monómeros) denominados aminoácidos. PROTEÍNAS 1. INTRODUCCIÓN Las proteínas son los constituyentes químicos fundamentales de la materia viva. Constituyen alrededor del 50% en peso seco del cuerpo. Los glúcidos y lípidos se encuentran en

Más detalles

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Classification of Normal and Tumor Colon Tissues Using Linear Classifiers and Microarray Data Análisis Inteligente de

Más detalles

ADN, ARN E INFORMACIÓN

ADN, ARN E INFORMACIÓN ADN, ARN E INFORMACIÓN LOS ÁCIDOS NUCLEICOS Los ácidos nucleicos fueron descubiertos en 1869 por Miescher, en el pus de los vendajes de heridas, pero su papel en la herencia y control de la actividad celular

Más detalles

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar.

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar. PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA DATOS DEL ASPIRANTE Apellidos: CALIFICACIÓN PRUEBA Nombre: D.N.I. o Pasaporte: Fecha de nacimiento: / / Instrucciones: Lee atentamente

Más detalles

Proteínas. Tabla 1: Funciones de las proteínas

Proteínas. Tabla 1: Funciones de las proteínas Colegio Lectura Hispano Complementaria Americano Depto. de Ciencias - Biología Nivel: 4to medio Unidad I Proteínas 1 En las células, son las proteínas las macromoléculas más abundantes y las que constituyen

Más detalles

III. Material genético. b. Composición y estructura del RNA.

III. Material genético. b. Composición y estructura del RNA. III. Material genético b. Composición y estructura del RNA. RNA (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa: en la posición 2' del anillo del azúcar hay un grupo

Más detalles

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático Criterios para diseñar primers Iván Ferrer Rodríguez, Ph.D. Catedrático 1 Qué es un primer? Es una cadena corta de nucleótidos, un oligonucleótido. Sirve como punto de partida para la replicación del DNA.

Más detalles

TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos

TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos TEMA 13: ESTERILIZACIÓN INDUSTRIAL Dr. Pedro F. Mateos I. INTRODUCCION Para poder llevar a cabo una fermentación con éxito es imprescindible y obligatorio tener en todas las etapas cultivos libres de contaminantes,

Más detalles

Int. Cl.: 74 Agente: Carpintero López, Mario

Int. Cl.: 74 Agente: Carpintero López, Mario 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 8 038 1 Int. Cl.: CL 1/02 (06.01) CL 1/18 (06.01) 12 TRADUCCIÓN DE PATENTE EUROPEA T3 96 Número de solicitud europea: 038944.3

Más detalles

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN Propiedades de una proteína que son útiles para su purificación por cromatografía Peso molecular Carga iónica Hidrofobicidad

Más detalles

NUTRICION MICROBIANA

NUTRICION MICROBIANA NUTRICION MICROBIANA La nutrición es el proceso por el que los microorganismos toman del medio donde habitan las sustancias químicas que necesitan para crecer Dichas sustancias se denominan nutrientes

Más detalles

ELEMENTOS GENÉTICOS TRANSFERIBLES: PLÁSMIDOS, TRANSPOSONES E INTEGRONES

ELEMENTOS GENÉTICOS TRANSFERIBLES: PLÁSMIDOS, TRANSPOSONES E INTEGRONES ELEMENTOS GENÉTICOS TRANSFERIBLES: PLÁSMIDOS, TRANSPOSONES E INTEGRONES DISEMINACION DE GENES DE RESISTENCIA 1 PLASMIDOS - DNA CIRCULAR - ELEMENTO REPLICATIVO AUTÓNOMO - PROPIEDADES: -TRANSFERENCIA DE

Más detalles

DATOS DE LA ASIGNATURA

DATOS DE LA ASIGNATURA DATOS DE LA ASIGNATURA Denominación: Ingeniería Genética Aplicada Código: 58127 Clase: Optativa Curso: 2º Carácter: Cuatrimestral Cuatrimestre: 2º Créditos LRU: 6 Teóricos: 4.5 Prácticos: 1.5 Créditos

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles

Estructura y propiedades de las proteínas

Estructura y propiedades de las proteínas Estructura y propiedades de las proteínas Matilde Julián Seguí Introducción Las proteínas son las macromoléculas biológicas más importantes. Hay gran variedad de proteínas y cumplen gran variedad de funciones

Más detalles

REAL ACADEMIA de INGENIERÍA MARTES de la RAI BIOTECNOLOGÍA INDUSTRIAL: BIORREFINERÍA

REAL ACADEMIA de INGENIERÍA MARTES de la RAI BIOTECNOLOGÍA INDUSTRIAL: BIORREFINERÍA REAL ACADEMIA de INGENIERÍA MARTES de la RAI BIOTECNOLOGÍA INDUSTRIAL: BIORREFINERÍA BIOPROCESOS: DESARROLLO y CAMBIO de ESCALA Félix GARCÍA-OCHOA SORIA UNIVERSIDAD COMPLUTENSE de MADRID Con el patrocinio

Más detalles

ALIMENTOS DE IMPORTANCIA COMERCIAL OBTENIDOS DE PROCESOS BIOTECNOLÓGICOS Lectura Lección Evaluativa Unidad 3

ALIMENTOS DE IMPORTANCIA COMERCIAL OBTENIDOS DE PROCESOS BIOTECNOLÓGICOS Lectura Lección Evaluativa Unidad 3 ALIMENTOS DE IMPORTANCIA COMERCIAL OBTENIDOS DE PROCESOS BIOTECNOLÓGICOS Lectura Lección Evaluativa Unidad 3 En un mundo donde los recursos son día a día más escasos es necesario encontrar rápidamente

Más detalles

(aislado directamente de células o tejidos) de otros tipos de ADN, como el

(aislado directamente de células o tejidos) de otros tipos de ADN, como el Glosario admixtura: se refiere al estado de estar mezclado (del inglés admixture). Ocurre cuando se entrecruzan individuos de dos o más poblaciones que se encontraban previamente separadas y el resultado

Más detalles

Int. Cl.: 72 Inventor/es: Orr, Bruce, Francis. 74 Agente: Elzaburu Márquez, Alberto

Int. Cl.: 72 Inventor/es: Orr, Bruce, Francis. 74 Agente: Elzaburu Márquez, Alberto 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 313 901 51 Int. Cl.: H04M 11/06 (2006.01) H04L 27/26 (2006.01) H04L 27/00 (2006.01) H03K 17/30 (2006.01) H03K 17/68 (2006.01)

Más detalles

7. Hidratos de carbono

7. Hidratos de carbono 7. Hidratos de carbono Hidratos de carbono Recomendaciones dietéticas Sustancias edulcorantes Hidratos de carbono Los hidratos de carbono, carbohidratos (CHO), glúcidos (Glícidos: anglicismo) o azúcares

Más detalles

TEMARIO DE TEORÍA CUATRIMESTRE: 1º CARÁCTER: OPTATIVA CRÉD. TEÓ.: 3,00 CRÉD. PRÁC.: 3,00

TEMARIO DE TEORÍA CUATRIMESTRE: 1º CARÁCTER: OPTATIVA CRÉD. TEÓ.: 3,00 CRÉD. PRÁC.: 3,00 CURSO: 2003/04 CENTRO: FAC. CC. EXPERIMENTALES ESTUDIOS: LICENCIADO EN QUÍMICAS-2000 ASIGNATURA: INGENIERIA DE ACIDOS NUCLEICOS CÓDIGO: 5008307 CICLO: 2º CURSO: OPT CUATRIMESTRE: 1º CARÁCTER: OPTATIVA

Más detalles

SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN

SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN SESIÓN 7 DUPLICACIÓN Y TRANSMISIÓN DE LA INFORMACIÓN CONTENIDA EN EL ADN I. CONTENIDOS: 1. Centro de control celular. 2. ADN: su estructura y función. 3. ADN y síntesis proteica. II. OBJETIVOS: Al término

Más detalles

Microorganismos y alimentos

Microorganismos y alimentos Microorganismos y alimentos Habitualmente, los microorganismos tienen mala fama. Se los asocia a las enfermedades y al deterioro de los alimentos. Sin embargo, cumplen muchas funciones beneficiosas para

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

Metodologías básicas del procesamiento de Proteinas

Metodologías básicas del procesamiento de Proteinas Metodologías básicas del procesamiento de Proteinas Alejandra Kun Departamento de Proteínas y Ácidos Nucleicos-IIBCE Unidad Asociada Sección Bioquímica Facultad de Ciencias 13 de octubre 2014 Curso Introducción

Más detalles

11 knúmero de publicación: 2 170 760. 51 kint. Cl. 7 : A61K 31/711

11 knúmero de publicación: 2 170 760. 51 kint. Cl. 7 : A61K 31/711 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 knúmero de publicación: 2 170 7 1 kint. Cl. 7 : A61K 31/711 A61K 48/00 A61K 38/18 12 k TRADUCCION DE PATENTE EUROPEA T3 86 knúmero de solicitud europea:

Más detalles