ELISA PeliClass human IgG subclass kit REF M1551

Tamaño: px
Comenzar la demostración a partir de la página:

Download "ELISA PeliClass human IgG subclass kit REF M1551"

Transcripción

1 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: Fax: Website: M55/ November 007 ELISA PeliClass human IgG subclass kit REF M55 Kit ELISA para la determinación cuantitativa de las subclases de IgG humano en suero (es) Ab BLACK BUF CAL CONJ CONTROL es Anticuerpos contra Preto Tampón Calibrador Conjugado Control DIL GREEN HRP HUM HO MOU es Dilución Verde HRP Humano Peróxido de hidrógeno Murino RED SEALS STOCK STOP SUB SUBS es Rojo Cierres de placa Stock Parar Subclases Substrato WASH WELL YELLOW es Lavado Pocillos Amarillo Rango ELISA REF PeliClass ELISA kit M800 x8 WELL aigg, aigg RED BLACK M80 x8 WELL aigg, aigg YELLOW GREEN M80 0. ml CAL M80 0. ml CONTROL M80 0. ml HRP MOU Ab HUM IgG CONJ M ml BUF WASH STOCK :0 M80 0 ml BUF DIL STOCK :0 M808 5 ml BUF SUBS STOCK :0 M80.0 ml ABTS STOCK :50 M ml HO STOCK :00 M807 0 ml BUF STOP SEALS

2 es I. INTRODUCCIÓN Las IgG humanas comprenden cuatro subclases: IgG, IgG, IgG e IgG. Las características bioquímicas de las subclases de IgG han sido descritas exhaustivamente (5). Las diferencias entre las subclases de IgG se reflejan en diferentes funciones biológicamente importantes tales como el reconocimiento de antígeno, la activación de complemento y la unión a receptores de superficie celular. Numerosos estudios han revelado que las anomalías en los niveles en suero de las subclases de IgG posiblemente están asociadas con diferentes estados patológicos. En especial ha sido ampliamente documentada la asociación de la deficiencia selectiva de la subclase IgG con una mayor susceptibilidad a infecciones virales o bacterianas (, 5). En pacientes con infecciones recurrentes de las vías respiratorias superiores e inferiores se han observado niveles bajos en suero de IgG o IgG. En otros casos se ha establecido una asociación entre las concentraciones muy bajas en suero de IgG y las infecciones sinopulmonarias recurrentes (). Asimismo se han observado anomalías en los niveles en suero de las subclases de IgG en enfermedades autoinmunes, trastornos neurológicos e infecciones por VIH (). II. PRINCIPIO TÉCNICO El kit ELISA PeliClass para subclases humanas es un inmunoensayo enzimático tipo sandwich. El kit contiene tiras de micropocillo recubiertas con anticuerpos monoclonales muy ávidos, cada uno específico para una de las subclases de IgG humano. Las muestras de análisis y los sueros de calibración y control son incubados en los pocillos correspondientes. La subclase de IgG a determinar se unirá a la fase sólida y el IgG no unido se elimina mediante lavado. A continuación se añade antisuero IgG antihumano conjugado con peroxidasa a cada pocillo y el conjugado no unido se elimina mediante lavado. Después de la incubación con solución de substrato (ABTS) y HO, la reacción se detiene con tampón ácido. El producto de reacción de color verde es medido mediante absorbencia y la concentración de subclase de IgG en la muestra de análisis es calculada comparándose con los valores de la curva de calibración. El suero de control de las subclases de IgG es ensayado para controlar la validez de las curvas de calibración y la exactitud de las determinaciones de las subclases de IgG. Los niveles de las subclases de IgG en el calibrador fueron determinados empleando un calibrador derivado de la preparación de referencia de la OMS 7/97. Se usaron los valores meta recomendados de 5,0 g/l para IgG,, g/l para IgG, 0, g/l para IgG y 0,5 g/l para IgG (7). III. ALMACENAMIENTO Y ESTABILIDAD Guardar el kit ELISA PeliClass para subclases humanas en posición vertical a 8 C. Puede usarse hasta la fecha de vencimiento indicada en la etiqueta. La estabilidad de todos los componentes después de su apertura es de semana, siempre y cuando se almacene a 8 C. Las condiciones de transporte pueden diferir de las condiciones de almacenamiento. IV. CONTENIDO DEL KIT Ver la Tabla al principio de este anexo en el embalaje. El kit ELISA PeliClass para subclases humanas contiene reactivos suficientes para 8 análisis para cada subclase, incluidos calibradores, controles y blancos. Los anticuerpos monoclonales fueron purificados de medio de cultivo de tejido, usando cromatografía de columna (intercambio iónico y cromatografía de afinidad). El calibrador y control son sueros líquidos humanos. V. MATERIALES ADICIONALES REQUERIDOS Agua destilada para dilución de los tampones de lavado, dilución y substrato. Equipo de pipetaje para dosificar volúmenes de forma precisa. Una incubadora (7 ± C). Una lavadora estándar ELISA o una botella rociadora de plástico de 500 ml para el lavado automático o manual de las tiras. Un lector estándar ELISA para la medición de la absorbencia a nm o 05 nm. Papel linear logarítmico. VI. MANIPULACIÓN DE LAS MUESTRAS DE ANÁLISIS Sólo deben analizarse muestras de suero. Las muestras han de ser lo más frescas posibles, o conservadas congeladas. Las muestras deben diluirse manualmente antes de su uso (ver VII PROTOCOLO DE ENSAYO). VII. PROTOCOLO DE ENSAYO Llevar todos los reactivos a temperatura ambiente (85 C) y mezclar bien. Evitar la formación de burbujas o espuma. Se recomienda analizar todas las muestras, controles y diluciones del calibrador por duplicado.. PLACA MICROTITER El kit ELISA PeliClass para subclases de IgG humano ofrece la posibilidad de usar placas parciales en diferentes ocasiones. Antes de abrir la bolsa de plástico, determinar el número de tiras requeridas para analizar el número deseado de muestras, más pocillos que se necesitan para realizar las calibraciones, controles y blancos por duplicado. Quitar las tiras que no se usarán del marco para placa y colocarlas de nuevo en la bolsa de plástico con desecante, y almacenar a 8 C.. SOLUCIONES DE TAMPÓN Tampón de lavado: Preparar el tampón de lavado añadiendo el contenido completo de la botella del concentrado de tampón de lavado a 950 ml de agua destilada. El tampón de lavado diluido debe guardarse a 8 C y permanece estable durante semana. Observación: El tampón concentrado puede contener cristales de sal. Antes de preparar el tampón de carga de trabajo, calentar el tampón concentrado POR POCO TIEMPO a 7 C para disolver los cristales. Tampón de dilución: Calcular la cantidad de tampón de dilución requerida (aproximadamente ml de tampón sin diluir por tira de micropocillo) y preparar una solución de carga de trabajo diluyendo el tampón en una proporción diez veces mayor en agua destilada.. PREPARACIÓN DEL CALIBRADOR Y DE LOS SUEROS DE CONTROL Para concentraciones ver la Tabla y del folleto de información adjunto. Calibrador: (Ver tabla del folleto de información adjunto) Etiquetar un tubo de 0 ml con ':500' y ocho tubos de ml con 'Cal a Cal8' respectivamente. Pipetar,99 ml del tampón de dilución en el tubo de 0 ml y añadir 0 µl del suero del calibrador (dilución inicial :500). Pipetar,9 ml del tampón de dilución en el tubo etiquetado con 'Cal' y,0 ml en los tubos etiquetados con 'CalCal8'.

3 Pipetar 00 µl del calibrador diluido :500 al tubo Cal, y hacer con este tubo siete diluciones seriales dobles añadiendo,0 ml de la dilución anterior al siguiente tubo 'Cal'. Seleccionar para cada subclase de IgG las series de diluciones del calibrador: IgG : : IgG, IgG e IgG :0.000 : Control: Etiquetar un tubo con ':500', y dos tubos de ml con ':0.000' (para IgG,, ) y ':0.000' (para IgG) respectivamente. Pipetar en el tubo etiquetado con :500,99 ml de tampón de dilución y 0 µl de suero de control. Pipetar en el tubo etiquetado con : µl de tampón de dilución y 5 µl de dilución :500. Pipetar en el tubo etiquetado con : µl de tampón de dilución y 5 µl de dilución : Preparar un tubo de ml con ml de tampón de dilución como blanco.. PREPARACIÓN DE MUESTRAS Diluir las muestras de análisis con el tampón de dilución según el mismo protocolo que para el suero de control. Si los resultados no se encuentran dentro de los rangos indicados (ver la Tabla del folleto de información adjunto), debe repetirse el análisis con una dilución diferente. 5. PRIMER PASO DE LAVADO Lavar los micropocillos requeridos en el marco para placa cuatro veces con tampón de lavado. Para lavado manual, llenar completamente los pocillos con tampón de lavado (> 00 µl) y desechar, repetir tres veces este procedimiento. Al final los pocillos deben quedar completamente vacíos. Añadir inmediatamente el reactivo subsiguiente, no dejar que los pocillos permanezcan secos durante un tiempo prolongado.. PRIMER PASO DE INCUBACIÓN Añadir 00 µl de los calibradores, controles, muestras y blancos diluidos en los pocillos correspondientes. Cubrir la placa con un cierre adhesivo, agitar suavemente dando golpecitos en el borde de la placa microtiter durante unos segundos para mezclar los contenidos de cada pocillo. Incubar durante hora a 7 C. Justo antes del lavado, preparar el siguiente reactivo para incubación tal como se describe en el punto SEGUNDO PASO DE LAVADO Aspirar el sobrenadante de los pocillos y lavar la placa tal como se describe en el punto INCUBACIÓN CON ANTICUERPO CONJUGADO HRP CON IgG HUMANO Diluir el conjugado :500 pipetando 0 µl del conjugado en,97 ml de tampón de dilución. Diluir el conjugado además: :000 pipetando, ml de la dilución :500 en,0 ml de tampón de dilución. :000 pipetando,0 ml de la dilución :500 en,0 ml de tampón de dilución. :000 pipetando,5 ml de la dilución :500 en,5 ml de tampón de dilución. Añadir: 00 µl de la dilución :500 a las tiras de micropocillo antiigg; 00 µl de la dilución :000 a las tiras de micropocillo antiigg; 00 µl de la dilución :000 a las tiras de micropocillo antiigg; 00 µl de la dilución :000 a las tiras de micropocillo antiigg. Cubrir la placa con un cierre adhesivo, agitar suavemente dando golpecitos en el borde de la placa microtiter durante unos segundos para mezclar los contenidos de cada pocillo. Incubar durante hora a 7 C. Justo antes del lavado, preparar el siguiente reactivo para incubación tal como se describe en el punto TERCER PASO DE LAVADO Aspirar el sobrenadante de los pocillos y lavar la placa tal como se describe en el punto INCUBACIÓN CON SUBSTRATO ABTS Calcular la cantidad de solución de substrato (se requiere aproximadamente 0,9 ml por cada tira de micropocillo). Añadir los equivalentes de 00 µl de solución patrón de peróxido de hidrógeno y 00 µl de solución patrón de ABTS a 0 ml de tampón de substrato de carga de trabajo ( ml de solución patrón de substrato + 8 ml de agua destilada). Añadir 00 µl de solución de substrato a todos los pocillos. Agitar suavemente dando golpecitos en el borde de la placa microtiter durante unos segundos para mezclar los contenidos de cada pocillo. Incubar durante 0 minutos a temperatura ambiente (85ºC).. DETENER LA REACCIÓN ENZIMÁTICA Añadir 50 µl de solución de paro a todos los pocillos.. LECTURA DE PLACA Leer dentro de hora a (preferentemente) o 05 nm en un lector ELISA. VIII. RESULTADOS E INTERPRETACIÓN DE LOS DATOS Registrar la absorbencia a (preferentemente) o 05 nm para cada pocillo y calcular la media de los valores duplicados. En cada muestra, los duplicados no deben diferir más del 5% del valor medio. Si la variación de los duplicados es superior, repetir el ensayo. Determinar los valores medios de absorbencia de los calibradores (eje y) frente a la concentración de subclase en ng/ml (eje x) en papel linear logarítmico y trazar la curva correspondiente. Los niveles de las subclases de IgG en el suero de control deben encontrarse dentro de los rangos indicados en la Tabla del folleto de información adjunto. Interpolar el valor medio de absorbencia para cada muestra en la curva de calibración. Las muestras de análisis que muestran un valor medio de absorbencia fuera de los rangos de dilución de la curva de calibración, deben diluirse de manera apropiada. Para una evaluación de la concentración de subclases de IgG en una muestra de análisis, comparar los niveles hallados con valores normales de subclases de IgG (ver X VALORES DE REFERENCIA). IX. VALORES DE ENSAYO Consultar la Tabla del folleto de información adjunto para los valores de ensayo específicos del kit.

4 X. VALORES DE REFERENCIA Valores de referencia (g/l) para las subclases de IgG en muestras de suero de sujetos caucásicos sanos (8). Para otras poblaciones deben obtenerse valores de referencia por separado. Edad IgG IgG IgG IgG 0 ½ 9 > ½ 9 8 8, 0,,8,7,8 7,0,0 7,7,5 8,,9 8,5, 9,0,5 9,,7 0,0,0 0,8,0,5,7,8,9, 0,87, 0,8, 0,, 0,, 0,8, 0,5, 0,5,8 0,,0 0,7, 0,85, 0,98,8,0,,50, 0, 0,55 0, 0,70 0,5 0,80 0,5 0,97 0,5,07 0,5, 0,,0 0,, 0,, 0,, 0,5,9 0,8, 0,0,0 0,0 0,5 <0,0 0, <0,0 0, <0,0 0, <0,0 0, <0,0 0,79 <0,0,0 <0,0,7 <0,0,58 <0,0,89 0,0,0 0,0,0 0,08,0 XI. a CARACTERÍSTICAS ESPECÍFICAS DE FUNCIONAMIENTO Reproducibilidad concentración de subclases de IgG IgG IgG IgG IgG variación intraensayo (%) variación intraensayo (%) 7 7 b Comparación del kit PeliClass para subclases de IgG humano con Mancini. Las concentraciones de IgG, IgG, IgG e IgG en sueros fueron determinadas mediante un ensayo ELISA y comparadas con los valores correspondientes hallados en Mancini. Se establecieron las siguientes correlaciones: subclase de IgG línea de regresión linear correlación IgG Y = 0,90X 0,9 0,97 IgG Y =,0X 0,7 0,9 IgG Y = 0,9X + 0,00 0,99 IgG Y = 0,9X 0,0 0,98 Observación: Los valores mencionados para las características específicas de funcionamiento representan resultados típicos y no deben considerarse como especificaciones para este kit. XII. RESTRICCIONES. El usuario debe estar capacitado y familiarizado con los ensayos ELISA y el procedimiento de análisis.. No deben usarse muestras extremadamente hemolizadas o lipémicas. Pueden surgir resultados inesperados con muestras que contienen el factor reumatoide, elevados niveles de bilirrubina u otros complejos inmunes circulantes. Estas muestras deben analizarse mediante otro método.. Las muestras que se encuentran fuera de los rangos de valores, por ejemplo en el caso de paraproteínas, deben analizarse de nuevo con diferentes diluciones.. La obtención de un nivel reducido de una de las subclases de IgG nunca puede proporcionar un diagnóstico seguro, sino que debe considerarse más bien como un indicio de una alteración en el sistema inmune, que requiere un análisis diagnóstico adicional. 5. Usar siempre los sueros de control para controlar la validez de las curvas de calibración. Cuando el resultado se encuentra fuera de los rangos de valores indicados, los resultados de las muestras de análisis no son fiables. Debe repetirse el análisis.. Los reactivos de diferentes lotes no son intercambiables. 7. Los restos de reactivos (p.ej. volumen muerto) no deben mezclarse con el contenido de viales que se acaban de abrir. 8. Los tapones y viales no son intercambiables. Los tapones deben colocarse en los viales correspondientes. 9. A pesar de que los sueros humanos de calibración y control han sido analizados para descartar la existencia de marcadores de agentes específicos transmisores de enfermedades de acuerdo con las directrices vigentes de la UE sobre GMP y resultaron ser no reactivos, todos los componentes de origen humano deben considerarse como potencialmente infecciosos. 0. Conservante: Thiomersal 0,00%.. Usar nuevos cierres de placa para cada paso de incubación/fijación en el experimento ELISA para evitar contaminación cruzada. No usar papel de aluminio.. Usar puntas de pipeta desechables para cada transferencia para evitar contaminación cruzada.. Cada vez que se usa el kit, hacer diluciones frescas de los calibradores, conjugado y tampones.. No usar otros reactivos y tiras de micropocillo que los suministrados con el kit. 5. Ázida de sodio inactiva la HRP, no usar soluciones que contienen ázida de sodio, ni añadir ázida de sodio a los tampones suministrados.. La eliminación de residuos debe realizarse conforme a las regulaciones de su laboratorio.

5 XIII. REFERENCIAS. Shakib, F. (Editor), Monograph in Allergy, Karger A.G., 9 (98).. Shakib, F. (Editor), The human IgG subclass, Pergamon Press (990).. Vlug, A. et al., Eur. Clin. lab., 8: (989).. Jefferis, R. et al Clin.Exp.Immunol. 8:57 (990). 5. Hamilton, R.C., Clin. Chem., :707 (987).. Beck, C.S. and Heiner, D.C., Am. Rev. Respir. Dis., :9 (98). 7. Klein, F et al., Clin. Chem. Acta., 50 9 (985) 8. Vlug, A. et al., Ann. Biol. Clin. 5:57 (99). 5

Mercodia Ultrasensitive C-peptide ELISA

Mercodia Ultrasensitive C-peptide ELISA Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso 10-1141-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia

Más detalles

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente.

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente. bioelisa HCV 4.0 3000-1115 LEER CAMBIOS SOMBREADOS 96 tests 3000-1116 480 tests Test de ELISA para la detección de anticuerpos contra el virus de la hepatitis C (HCV) en suero o plasma humano para ser

Más detalles

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00 Quantikine IVD ELISA Inmunoensayo Epo Humano Manual de Instrucciones suplementario Referencia DEP00 Este manual de instrucciones incluye el protocolo del ensayo y debe leerse en su totalidad antes de comenzar

Más detalles

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar.

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar. bioelisa HIV-1+2 (rec) 3000-1143 LEER CAMBIOS SOMBREADOS 96 tests 3000-1144 480 tests Test de ELISA para la detección de anticuerpos contra HIV-1 y HIV-2 en suero o plasma humano. Sumario Como es conocido

Más detalles

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas.

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. C-peptide N de código K6220 Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. Este kit contiene reactivos para 96 pocillos de prueba. (111838-002) K6220/ES/CKJ/2009.06.17

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA

ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Página 1 de 9 ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Elaborado por: CNSP Blgo. Manuel Céspedes Zambrano Revisado por: CNSP TM. Julia I. Espinoza Soto CNSP MV Gladys Malásquez Mendoza Aprobado por: RD

Más detalles

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985.

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985. Página 1 de 8 1. OBJETIVO Determinar la concentración de sodio, potasio y calcio en muestras de alimentos con bajo contenido de grasa. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a alimentos

Más detalles

Mercodia Proinsulin ELISA

Mercodia Proinsulin ELISA Mercodia Proinsulin ELISA Instrucciones para el uso 10-1118-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano.

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. 96 PRUEBAS USO El equipo de Prolactina CLIA se destina para

Más detalles

Murex anti-hbc (total)

Murex anti-hbc (total) es 8G21-01/-02 GE65/66 Primera edición 10/2009 Murex anti-hbc (total) Enzimoinmunoanálisis para la detección de anticuerpos frente al antígeno core del virus de la hepatitis B (anti-hbc) en suero o plasma

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 REF/ PROYECTO: PROMIS 2012 NÚMERO DE LOTES: UNICO Este pliego contempla la adquisición de un sistema

Más detalles

RIDASCREEN. Leishmania Ab. Art. n.: K7121

RIDASCREEN. Leishmania Ab. Art. n.: K7121 RIDASCREEN Leishmania Ab Art. n.: K7121 R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Telf.: +49 (0) 6151 8102-0 / Fax: +49 (0) 6151 8102-20 1. Área de aplicación Para el diagnóstico

Más detalles

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY www.diasorin.com. Modificaciones: 11 Supresiones:

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY www.diasorin.com. Modificaciones: 11 Supresiones: DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY www.diasorin.com Modificaciones: 11 Supresiones: 1. FINALIDAD DEL ENSAYO Ensayo in vitro para determinación cuantitativa de alfafetoproteína

Más detalles

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA.

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. El estudio INMA lleva asociado la toma de una serie de muestras biológicas según el momento o fase del estudio. Coincidiendo con el parto se recoge una muestra

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - Italy www.diasorin.com. Modificaciones: Supresiones:

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - Italy www.diasorin.com. Modificaciones: Supresiones: DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - Italy www.diasorin.com Modificaciones: Supresiones: 1. FINALIDAD DEL ENSAYO Ensayo in vitro para la determinación de tiroglobulina humana (htg)

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

PRINCIPIO DE LA PRUEBA: USO PREVISTO:

PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS Ref. 4755 2014/04 CALIBRADORES Hb A1c CAPILAR Aplicación Los Calibradores Hb A1c CAPILAR están destinados a la calibración y al control de migración

Más detalles

DENV Detect TM IgM CAPTURE ELISA

DENV Detect TM IgM CAPTURE ELISA Detect TM IgM CAPTURE ELISA USO PREVISTO La prueba Detect IgM Capture ELISA está diseñada para la detección cualitativa de anticuerpos IgM contra antígenos recombinantes DEN (DENRA) en suero para diagnóstico

Más detalles

SC5b-9 Plus RESUMEN Y EXPLICACIÓN

SC5b-9 Plus RESUMEN Y EXPLICACIÓN SC5b-9 Plus Enzimoinmunoensayo para la cuantificación del complejo SC5b-9 presente en plasma o suero humanos MicroVue SC5b-9 Plus EIA Preparación del Reactivo y de la Muestra Diluya el Concentrado de Solución

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

ENFERMEDADES PARASITARIAS TRANSMITIDOS POR ALIMENTOS: (CISTICERCOSIS, HIDATIDOSIS Y FASCIOLOSIS)

ENFERMEDADES PARASITARIAS TRANSMITIDOS POR ALIMENTOS: (CISTICERCOSIS, HIDATIDOSIS Y FASCIOLOSIS) ENFERMEDADES PARASITARIAS TRANSMITIDOS POR ALIMENTOS: (CISTICERCOSIS, HIDATIDOSIS Y FASCIOLOSIS) Dr. Hermes Escalante Añorga Profesor Principal de la Universidad Nacional de Trujillo Laboratorio Clínico

Más detalles

Manual del GPHF-Minilab

Manual del GPHF-Minilab Una Guía Concisa de Control de Calidad de Drogas Esenciales y otros Medicamentos Manual del GPHF-Minilab Tercer Suplemento del Volumen II Cromatografía de Capa Fina Extensión 2003 Antiretrovirales Una

Más detalles

Mercodia Iso-Insulin ELISA

Mercodia Iso-Insulin ELISA Mercodia Iso-Insulin ELISA Instrucciones para el uso 10-1128-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D-20354 Hamburg DISTRIBUIDOR medac Gesellschaft für klinische

Más detalles

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA)

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

Departamento de Bioquímica y Biología Molecular,

Departamento de Bioquímica y Biología Molecular, 18. Inmunoanálisis Aurora Galván Cejudo 1, Isaac Túnez Fiñana 2 Departamento de Bioquímica y Biología Molecular, 1 Campus Universitario de Rabanales, Edificio Severo Ochoa, 14071-Córdoba, 2 Facultad de

Más detalles

Acción Enzimática: Actividad de la Catalasa

Acción Enzimática: Actividad de la Catalasa Acción Enzimática: Actividad de la Catalasa Experimento 3 Muchos organismos pueden descomponer el peróxido de hidrógeno (H 2 O 2 ) por la acción de las enzimas. Las enzimas son proteínas globulares responsables

Más detalles

C1q CIC ELISA 704620

C1q CIC ELISA 704620 QUANTA Lite Para Diagnóstico In Vitro Complejidad de CLIA: Alto C1q CIC ELISA 704620 Aplicación El propósito de este kit es la determinación in-vitro de los inmunocomplejos circulantes (CIC) ligantes de

Más detalles

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv RESULTADOS Y DISCUSIÓN Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv La curva estándar con la que se estimó la concentración proteica del filtrado

Más detalles

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular TP1: Diluciones Objetivos Familiarizarse con las unidades mas utilizadas en biología molecular y ser capaces de intercambiar ágilmente las distintas unidades. Familiarizarse con el material de uso corriente

Más detalles

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN 25. Perfil lipídico Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 1 Departamento de Bioquímica y Biología Molecular, Avda. Menéndez Pidal s/n, 14071- Córdoba, 2 Campus de Rabanales, Edif. Severo Ochoa 14071-Córdoba

Más detalles

10-1176-01 REACTIVOS PARA 96 ANÁLISIS

10-1176-01 REACTIVOS PARA 96 ANÁLISIS Mercodia MPO ELISA Instrucciones de uso 10-1176-01 REACTIVOS PARA 96 ANÁLISIS Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala Suecia EXPLICACIÓN DE LOS SÍMBOLOS EMPLEADOS EN LAS ETIQUETAS

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

TRABAJ O PRÁCTICO: PRECIPITACIÓN Y FILTRACIÓN

TRABAJ O PRÁCTICO: PRECIPITACIÓN Y FILTRACIÓN TRABAJ O PRÁCTICO: PRECIPITACIÓN Y FILTRACIÓN PREGUNTA DE ENFOQUE: Es posible conocer la cantidad de cloruro de plata que se forma al mezclar una disolución acuosa de cloruro de sodio con una de nitrato

Más detalles

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles

DiaSorin Inc 1951 Northwestern Ave Stillwater, MN 55082 USA Tel. +1.651.439.9710 Fax +1.651.351.5669

DiaSorin Inc 1951 Northwestern Ave Stillwater, MN 55082 USA Tel. +1.651.439.9710 Fax +1.651.351.5669 DiaSorin Inc 1951 Northwestern Ave Stillwater, MN 55082 USA Tel. +1.651.439.9710 Fax +1.651.351.5669 Ensayo LIAISON N-TACT PTH (310910) 1. FINALIDAD DEL ENSAYO El ensayo LIAISON N-TACT PTH emplea la tecnología

Más detalles

Prospecto de QuantiFERON -CMV ELISA 2 96

Prospecto de QuantiFERON -CMV ELISA 2 96 Prospecto de QuantiFERON -CMV ELISA 2 96 Prueba de IFN-γ en sangre total para medir las respuestas a los antígenos peptídicos del citomegalovirus humano Para uso de diagnóstico in vitro 0350-0201 Cellestis,

Más detalles

CONTENIDO DE LA GUÍA OBJETIVO

CONTENIDO DE LA GUÍA OBJETIVO CONTENIDO DE LA GUÍA OBJETIVO Reconocer las características físicas y formas de emplear el material de laboratorio, con el cual se desarrollan diferentes actividades experimentales que permiten alcanzar

Más detalles

RECOPILADO POR: EL PROGRAMA UNIVERSITARIO DE ALIMENTOS

RECOPILADO POR: EL PROGRAMA UNIVERSITARIO DE ALIMENTOS NMX-F-368-1983. ALIMENTOS. LECHE FLUIDA. FOSFATASA RESIDUAL. MÉTODO DE PRUEBA. FOODS. FLUID MILK. RESIDUAL PHOSPHATASE. METHOD OF TEST. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. PREFACIO En la elaboración

Más detalles

FICHA DE DATOS DE SEGURIDAD (MSDS) KIT CLART CMA KRAS BRAF PI3K

FICHA DE DATOS DE SEGURIDAD (MSDS) KIT CLART CMA KRAS BRAF PI3K 1. Identificación de la sustancia y proveedor Nombre comercial CLART CMA KRAS BRAF PI3K Referencias: Amplificación KRAS 8 determinaciones Ref.: CS-0412-8 24 determinaciones Ref.: CS-0412-24 Amplificación

Más detalles

Murex HIV Ag/Ab Combination

Murex HIV Ag/Ab Combination es 7G79-09/-11 GE41/42 Primera edición 08/2009 Murex HIV Ag/Ab Combination Enzimoinmunoanálisis para la detección mejorada de la seroconversión frente a los virus de la inmunodeficiencia humana tipo 1

Más detalles

Símbolos clave utilizados

Símbolos clave utilizados Sistema Microelisa HTLV-I/II de Avioq Símbolos clave utilizados Número de catálogo Consulte Instrucciones de uso Código de lote Dispositivo médico para diagnóstico in vitro Fecha de vencimiento Control

Más detalles

DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000

DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000 DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000 Este Modo Operativo está basado en la Norma ASTM C 289, la misma que se ha adaptado al nivel de implementación y a las

Más detalles

Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN

Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN EIA (inmunoensayo enzimático) de la 25-OH vitamina D de MicroVue Página 1 de 17

Más detalles

3M Placas Petrifilm TM para el Recuento de Aerobios

3M Placas Petrifilm TM para el Recuento de Aerobios 3M Placas Petrifilm TM para el Recuento de Aerobios Recomendaciones de uso Para detallar información sobre PRECAUCIONES, COMPENSACIONES POR GARANTÍA / GARANTÍA LIMITADA, LIMITACIONES POR RESPONSABILIDAD

Más detalles

DT040A Sensor de Dióxido de carbono gaseoso

DT040A Sensor de Dióxido de carbono gaseoso Sensor de CO 2 DT040A Sensor de Dióxido de carbono gaseoso El sensor de CO 2 puede ser conectado a los recolectores de datos ITP-C, MultiLogPRO o TriLink. El sensor de CO 2 mide la concentración de dióxido

Más detalles

SINDROME AGUDO RESPIRATORIO SEVERO (SARS)

SINDROME AGUDO RESPIRATORIO SEVERO (SARS) SINDROME AGUDO RESPIRATORIO SEVERO (SARS) DOCUMENTO ORIGINAL ELABORADO POR LA OMS. Oficina Regional del Pacífico Oeste. Traducción Programa de Enfermedades Transmisibles OPS Aislamiento/ lavado de manos

Más detalles

Aseguramiento de la Calidad en Equipos de Laboratorio. Temas Selectos de Calidad en Serología BIO-RAD

Aseguramiento de la Calidad en Equipos de Laboratorio. Temas Selectos de Calidad en Serología BIO-RAD Aseguramiento de la Calidad en Equipos de Laboratorio Temas Selectos de Calidad en Serología BIO-RAD México, DF. 09-dic-2009 Enfoque Integral de un Sistema de Gestión n de Calidad. SGC PLANEAR el SGC mediante:

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

Electrodo selectivo de cianuro

Electrodo selectivo de cianuro 96 53 Electrodo selectivo de cianuro - CN Electrodo selectivo de cianuro. Manual del usuario. Garantía El plazo de validez es de 6 meses a partir de la fecha de expedición del electrodo. La garantía cubre

Más detalles

NTE INEN 344 Primera revisión 2014-XX

NTE INEN 344 Primera revisión 2014-XX Quito Ecuador NORMA TÉCNICA ECUATORIANA NTE INEN 344 Primera revisión 2014-XX BEBIDAS ALCOHÓLICAS DETERMINACIÓN DE FURFURAL DETERMINATION OF ALCOHOLIC BEVERAGES. FURFURAL DESCRIPTORES: Bebidas Alcohólicas,

Más detalles

4.2. Limpieza del material de laboratorio.

4.2. Limpieza del material de laboratorio. Química 4 Tema 4. Material de laboratorio 4.1. Material de uso frecuente en el laboratorio. 4.2. Limpieza del material de laboratorio. Clasificación: i) según su función ii) según el material de que está

Más detalles

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68 APÉNDICE Apéndice 1. Espectrofotómetro (Users Manual 2100 Series Spectrophotometer) 68 El espectrofotómetro de la marca UNICO serie 2100 UV posee un rango de longitud de onda de 200-1000 nm. La técnica

Más detalles

Cómo llevar a cabo una reacción química desde el punto de vista experimental

Cómo llevar a cabo una reacción química desde el punto de vista experimental Cómo llevar a cabo una reacción química desde el punto de vista experimental Para obtener un compuesto se pueden utilizar varias técnicas, que incluyen el aislamiento y la purificación del mismo. Pero

Más detalles

Acido Urico Uricasa - POD

Acido Urico Uricasa - POD Acido Urico Uricasa - POD Usar un suero de calibración valorado por este método. Programar en el ordenador los siguientes parámetros: Nombre de la prueba : AC. URICO Prueba : URIC Código de barras de la

Más detalles

Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201)

Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201) Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201) 20 x 96 (n.º de referencia 0594-0501) Ensayo de IFN-γ en sangre total que mide la reacción a los antígenos peptídicos

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

RIDASCREEN. HSV 2 IgG, IgM. Nº de artículo: K5221 (IgG) K5231 (IgM)

RIDASCREEN. HSV 2 IgG, IgM. Nº de artículo: K5221 (IgG) K5231 (IgM) RIDASCREEN HSV 2 IgG, IgM Nº de artículo: K5221 (IgG) K5231 (IgM) R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Teléfono: +49 61 51 81 02-0/Fax: +49 61 51 81 02-20 1. Uso previsto

Más detalles

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems INDICE I. Introducción II. Objetivo General del Manual III. Políticas de

Más detalles

EMBARAZO Y NEONATOLOGÍA

EMBARAZO Y NEONATOLOGÍA EMBARAZO Y NEONATOLOGÍA 1. Introducción 2. Diagnóstico del embarazo 3. Parámetros bioquímicos alterados durante el embarazo 4. Estudio del líquido amniótico para la detección y prevención de alteraciones

Más detalles

TEMA 4 MATERIAL DE LABORATORIO

TEMA 4 MATERIAL DE LABORATORIO UNIVERSIDADE DA CORUÑA Química 4 Curso 2013-2014 TEMA 4 MATERIAL DE LABORATORIO 4.1. MATERIAL DE USO FRECUENTE EN EL LABORATORIO. 4.2. LIMPIEZA Y SECADO DEL MATERIAL DE LABORATORIO. 4.1.1. CLASIFICACIÓN

Más detalles

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación.

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación. 23 de agosto 2007 Se comenzó la elaboración de la bitácora Medio LB Broth, Billar (Luria-Bertani) 25gr/litro Se preparó 500 mililitros agregando 12.5 gramos Se diluyó y esterilizó por autoclave Medio LB

Más detalles

INTRODUCCIÓN AL CULTIVO CELULAR

INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD Artículo 1. Este Reglamento es complementario del Reglamento de Higiene y Seguridad de la Facultad de Química de la

Más detalles

HIDROPROTECCION DE COLOMBIA HOJA DE SEGURIDAD HIDROSIL CONCRETO / HS-HSCCC-02 OCTUBRE 2007 Página 1 de 5

HIDROPROTECCION DE COLOMBIA HOJA DE SEGURIDAD HIDROSIL CONCRETO / HS-HSCCC-02 OCTUBRE 2007 Página 1 de 5 Página 1 de 5 1. IDENTIFICACIÓN DE PRODUCTO Y COMPAÑÍA Nombre del Producto: Familia Química: Proveedor: HIDROSIL CONCRETO Impermeabilizantes Hidroprotección de Colombia Autopista Norte No. 169-25 Bogotá,

Más detalles

PTH RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN

PTH RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN PTH Un inmunoensayo enzimático para la determinación cuantitativa de la PTH (hormona paratiroidea) intacta en el suero humano RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN El kit de inmunoensayo enzimático de

Más detalles

RESUMEN DE CARACTERÍSTICAS DEL PRODUCTO. 25 μg

RESUMEN DE CARACTERÍSTICAS DEL PRODUCTO. 25 μg agencia española de medicamentos y productos sanitarios RESUMEN DE CARACTERÍSTICAS DEL PRODUCTO 1. NOMBRE DEL MEDICAMENTO HibTITER solución inyectable Vacuna conjugada frente a Haemophilus influenzae tipo

Más detalles

FICHA DE DATOS DE SEGURIDAD

FICHA DE DATOS DE SEGURIDAD Ficha de datos de seguridad de acuerdo al reglamento (CE) nº 1907/2006 del Parlamento Europeo y del Consejo. I. IDENTIFICACIÓN DEL PRODUCTO Y DE LA SOCIEDAD O EMPRESA Nombre del producto PEGOLAND FIX Uso

Más detalles

Detección de IgE específica.

Detección de IgE específica. Detección de IgE específica. Una forma de identificar los alérgenos responsables de los síntomas alérgicos es la detección de anticuerpos IgE específicos frente a dichos alérgenos. Estos anticuerpos están

Más detalles

QUANTA Lite TM Sm 708560 Para Diagnóstico In Vitro Complejidad de CLIA: Alto

QUANTA Lite TM Sm 708560 Para Diagnóstico In Vitro Complejidad de CLIA: Alto QUANTA Lite TM Sm 708560 Para Diagnóstico In Vitro Complejidad de CLIA: Alto Aplicación QUANTA Lite TM Sm es un ensayo basado en la técnica ELISA (Enzyme-Linked Immunosorbent Assay) para la detección semi

Más detalles

FICHA DE DATOS DE SEGURIDAD (MSDS) CLART SeptiBac +

FICHA DE DATOS DE SEGURIDAD (MSDS) CLART SeptiBac + Página 1 de 5 1. Identificación de la sustancia y proveedor Nombre comercial CLART SeptiBac + Referencias: Amplificación 48 determinaciones Ref.: CS-0311-48 Detección 48 determinaciones Ref.: CS-0411-48

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

PLATELIA HSV 1+2 IgM 96 PRUEBAS 72822. DETECCIÓN CUALITATIVA DE ANTICUERPOS IgM ANTI-HSV 1+2, EN SUERO O PLASMA HUMANO, POR MÉTODO INMUNOENZIMÁTICO

PLATELIA HSV 1+2 IgM 96 PRUEBAS 72822. DETECCIÓN CUALITATIVA DE ANTICUERPOS IgM ANTI-HSV 1+2, EN SUERO O PLASMA HUMANO, POR MÉTODO INMUNOENZIMÁTICO PLATELIA HSV 1+2 IgM 96 PRUEBAS 72822 DETECCIÓN CUALITATIVA DE ANTICUERPOS IgM ANTI-HSV 1+2, EN SUERO O PLASMA HUMANO, POR MÉTODO INMUNOENZIMÁTICO 1. CAMPO DE APLICACIÓN Platelia HSV 1+2 IgM es una prueba

Más detalles

Revelado de películas blanco y negro con exposición a sensibilidad nominal.

Revelado de películas blanco y negro con exposición a sensibilidad nominal. Revelado de películas blanco y negro con exposición a sensibilidad nominal. Equipo de revelado. El revelado de los negativos blanco y negro se realiza en un recipiente llamado tanque de revelado. Este

Más detalles

LIMPIEZA DEL MATERIAL DE LABORATORIO. La limpieza del material de laboratorio es un proceso que implica la eliminación de impurezas.

LIMPIEZA DEL MATERIAL DE LABORATORIO. La limpieza del material de laboratorio es un proceso que implica la eliminación de impurezas. LIMPIEZA DEL MATERIAL DE LABORATORIO Importancia de la limpieza del material de laboratorio. La limpieza del material de laboratorio es un proceso que implica la eliminación de impurezas. Una adecuada

Más detalles

Aguas residuales - Métodos de análisis - Parte 21: Determinación del poder espumógeno

Aguas residuales - Métodos de análisis - Parte 21: Determinación del poder espumógeno Vencimiento consulta pública: 2009.05.22 PROYECTO DE NORMA EN CONSULTA PUBLICA NCh2313/21.cR2009 Aguas residuales - Métodos de análisis - Parte 21: Determinación del poder espumógeno Preámbulo El Instituto

Más detalles

DIGESTORES RAPIDOS. Características y Beneficios

DIGESTORES RAPIDOS. Características y Beneficios DIGESTORES RAPIDOS Características y Beneficios El controlador de estado sólido está calibrado de fábrica con control de temperatura progresivo desde temperatura de ambiente hasta 450º C. El control triac

Más detalles

Contenido. Bioseguridad Chile Ltda., Septiembre 2014i www.bioseguridadchile.cl nfo@bioseguridadchile.cl 1

Contenido. Bioseguridad Chile Ltda., Septiembre 2014i www.bioseguridadchile.cl nfo@bioseguridadchile.cl 1 Contenido Control de Infecciones, Recolección y Manejo de Muestras... 2 Recomendaciones para la evaluación de los riesgos para el personal... 2 Recomendaciones para la recogida de muestras por parte del

Más detalles

BENTLEY BactoCount IBC

BENTLEY BactoCount IBC BENTLEY BactoCount IBC Características del equipo El BactoCount IBC es un equipo automático para contar rápido e individualmente las bacterias de la leche cruda. Capacidad: de 50 hasta 150 muestras / hora.

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La medición de nitratos en aguas residuales se hace en mg/l. El método es conocido usualmente con el nombre de Reducción de Cadmio, que es donde los iones de nitrito reaccionan

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

GEBRAX DIVISION DIAGNÓSTICA

GEBRAX DIVISION DIAGNÓSTICA GEBRAX T h e r a p e u t i c s & D i a g n o s t i c s DIVISION DIAGNÓSTICA Se recomienda que el prospecto deba ser leído antes de comenzar el procedimiento de prueba. Aunque el ensayo está diseñado para

Más detalles

PRACTICAS DE CONTENCIÓN

PRACTICAS DE CONTENCIÓN PRACTICAS DE CONTENCIÓN Las medidas de control usadas en los laboratorios están diseñadas para proteger a los empleados de la posible exposición a agentes infecciosos y a proteger al público mediante la

Más detalles

MINICAP Hb A1c. Ref. 2215 2014/06

MINICAP Hb A1c. Ref. 2215 2014/06 MINICAP Hb A1c Ref. 2215 2014/06 UTILIZACIÓN El kit MINICAP Hb A1c permite la separación y cuantificación de la fracción glicada HbA 1c de la hemoglobina de la sangre humana, mediante electroforesis capilar

Más detalles

Indicaciones Asma bronquial, en pacientes que previamente no hayan respondido a terapia con broncodilatadores y/o antialérgicos.

Indicaciones Asma bronquial, en pacientes que previamente no hayan respondido a terapia con broncodilatadores y/o antialérgicos. 1 Pulmicort 0,5 mg/ml suspensión para nebulización budesonida Suspensión para nebulización Composición Cada dosis unitaria (2 ml) contiene: budesonida 1 mg. Excipientes: edetato de disodio, cloruro de

Más detalles

M.S.D.S P 551 DESENGRASANTE ECOLOGICO IDENTIFICACIÓN DEL PRODUCTO

M.S.D.S P 551 DESENGRASANTE ECOLOGICO IDENTIFICACIÓN DEL PRODUCTO Página 1 de 6 SECCIÓN I IDENTIFICACIÓN DEL PRODUCTO 1.1 NUMERO UN Mercancía no peligrosa 1.2 NOMBRE COMERCIAL P-551 DESENGRASANTE ECOLOGICO 1.3 NOMBRE QUÍMICO No aplica 1.4 FAMILIA QUÍMICA No establecida

Más detalles

Las cubetas para espectrofotometría Zuzi son instrumentos de gran precisión con una relación calidad/precio inmejorable. Pueden ser empleadas con gran variedad de espectrofotómetros y colorímetros, atendiendo

Más detalles