Plasma Renin Activity Kit Elisa

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Plasma Renin Activity Kit Elisa"


1 Plasma Renin Activity Kit Elisa KAPDB4600 DIAsource ImmunoAssays S.A. - Rue du Bosquet, 2 - B-1348 Louvain-la-Neuve - Belgium

2 : /1

3 Plasma Renin Activity Elisa Kit Para la detección cuantitativa de la Actividad de la Renina Plasmática (PRA) en plasma humano por inmunoensayo enzimático. KAPDB4600 DIAGNOSTICO IN VITRO ImmunoAssays SA - Rue du Bosquet 2, B-1348 Louvain-la-Neuve, Belgium - Tel: Fax : es INTENCION DE USO Para la detección cuantitativa de la Actividad de la Renina Plasmática (PRA) en plasma humano por inmunoensayo enzimático. Únicamente para uso in vitro. PRINCIPIO DE LA PRUEBA Este kit mide la PRA y los resultados son expresados en términos de masa de Angiotensina-I (Ang-I) generada por volumen e plasma humano en unidad de tiempo (ng/ml.h). La muestra de sangre es recolectada en un tubo que contiene EDTA. El plasma es separado, bien almacenado congelado o puede mantenerse a temperatura ambiente para su uso inmediato. Las muestras no deben ser enfriadas en hielo o almacenadas a temperaturas de entre 0 y 10 C durante la recolección o su procesamiento antes de ajustar el ph, esto podría llevar a una sobreestimación de la actividad de la renina. Antes de iniciar el inmunoensayo un inhibidor de la proteasa y un tampón de generación son adicionados a la muestra de plasma, la cual va a prevenir la Angiotensina-I (Ang-I) en el plasma de la degradación. El ph de la muestra de plasma es dividido en dos y las fracciones son incubadas de 0-4 C (en baño de hielo) y a 37 o C respectivamente por 90 minutos o más, para permitir la generación de Ang-I por la renina en plasma a 37 C. Opcionalmente, el ph puede ser ajustado a 6.5 o 7.4. El ajuste del ph es un paso crítico durante el ensayo, la acidificación del plasma a ph 3.3 o menos por un tiempo prolongado con regreso a ph neutral causa activación irreversible de la renina (Derkx et al., 1987), por otro lado, la incubación a un ph superior a 8.0 puede destruir la renina. Durante la incubación del inmunoensayo, otro conjunto de inhibidores de proteasas están involucrados, que funcionan para detener la nueva generación, así como la degradación de la Ang-I a péptidos más pequeños. El inmunoensayo de Ang-I es un ensayo competitivo que utiliza dos incubaciones, con un tiempo de incubación total de ensayo de menos de dos horas. Durante la primera incubación la Ang-I sin marcar (presente en los estándares, controles y muestras de plasma) compiten con la Ang-I biotinilada para unirse al anticuerpo anti-ang-i. En la segunda incubación el conjugado de Estreptavidina-HRP marcado, se une a la Ang-I-Biotina inmovilizada. Los procedimientos de lavado y decantación remueven los materiales que no se han unido. El sustrato colorimétrico HRP es adicionado y, después se detiene la reacción de desarrollo de color, la absorbancia (DO) es medida en un lector de microplacas. Los valores de absorbancia son inversamente proporcionales a la concentración de Ang-I en la muestra. Un juego de calibradores son utilizados para trazar la curva estándar de las concentraciones de Ang-I en donde las muestras y controles pueden ser leídos directamente. APLICACIONES CLÍNICAS La medición de PRA es importante para la evaluación clínica de pacientes hipertensos. En particular, la determinación de la actividad de Renina Plasmática puede ayudar al diagnóstico de hiperaldosteronismo (5-13% de los casos de hipertensión) y asiste en la terapia y manejo de otras formas de hipertensión. La renina libera la angiotensina-i a partir de angiotensinógeno. La Angiotensina-I es transformada a angiotensina-ii en gran medida en la circulación pulmonar por la enzima convertidora de angiotensina (ACE). La angiotensina II aumenta la presión arterial por vasoconstricción arteriolar directa, retención de sodio, y la estimulación de la secreción de aldosterona por la corteza suprarrenal. La aldosterona también ejerce un efecto de restablecer el equilibrio de sodio y elevar la presión arterial. La medición exacta de la concentración de circulación de angiotensina II es un reto debido a su inestabilidad en muestras de sangre. La concentración de aldosterona se puede determinar fácilmente utilizando el kit de inmunoensayo DIAsource (KAPDB450). PRECAUCIONES Y ADVERTENCIAS DEL PROCEDIMIENTO 1. Los usuarios deben tener una comprensión profunda de este protocolo para el correcto aprovechamiento de este kit. Un rendimiento fiable sólo se logrará mediante la adhesión estricta y cuidadosa a las instrucciones proporcionadas. 2. La Ang-II actualmente no se incluye en todos los esquemas de control de calidad externos. Por lo tanto, se sugiere que cada laboratorio establezca sus propios materiales de control de calidad internos y el procedimiento para la evaluación de la fiabilidad de los resultados. 3. Cuando requiera agua para realizar diluciones específicas o reconstituir, utilice agua destilada o desionizada. 4. Todos los reactivos del kit y muestras deben estar a temperatura ambiente y mezcladas antes de su uso. Evitar la congelación y descongelación repetidas de los reactivos y las muestras de plasma. 5. Se debe establecer Una curva de calibración para cada corrida. Los controles del kit deben ser incluidos en cada corrida y deben estar dentro de los límites de confianza establecidos. 6. No mezcle componentes de kits de diferentes lotes y no utilice algún componente después de vencida la fecha impresa en la etiqueta. 7. El sustrato (TMB) es sensible a la luz por lo que debe almacenarse en botellas oscuras y alejas de la luz directa del sol. 8. Para prevenir la contaminación de los reactivos, utilice puntas desechables de pipeta para dispensar cada reactive, muestra, estándares y controles. 9. Técnicas de procedimiento incorrectas, pipeteos imprecisos, lavados incompletos, así como almacenamiento inadecuado de reactivos puede generar que los valores para los controles no reflejen los rangos establecidos. El rendimiento de este ensayo se ve marcadamente influenciada por la correcta ejecución del procedimiento de lavado! LIMITACIONES 1. Este kit está específicamente diseñado y validado para la determinación de la actividad de la renina plasmática/ generación de Ang-I en plasma con EDTA. Otros usos del material deben ser validados antes de ser aplicado. 2. En nivel de Ang-I depende de multiples factores, incluyendo la actividad de la renina, la concentración de sustrato de renina, el ph del plasma, la temperatura y selección de inhibidores. Por lo tanto, las muestras de plasma deben ser preparadas cuidadosamente para que la prueba sea adecuada. 3. La contaminación bacteriana, los ciclos de congelación y descongelación repetidos y dilución de muestras de plasma pueden afectar el resultado del ensayo. 4. Para la interpretación de los resultados deben tenerse en cuenta las condiciones que pueden afectar la secreción de renina, como la ingesta de sodio y de potasio, la postura, los medicamentos como los diuréticos, clonidinea, beta-bloqueadores, estroprogestogenos y vasodilatadores periféricos. 5. No procese muestras hemolisadas, lipémicas, ictéricas, y muestras que no se manipulen adecuadamente de acuerdo con la instrucción. 6. Los resultados obtenidos con este kit no deben ser utilizados como única base para hacer un diagnóstico. Por ejemplo, la presencia de anticuerpos heterófilos en pacientes regularmente expuestos a animales o productos de animales tienen un riesgo potencial de causar interferencias en las pruebas inmunológicas. Consecuentemente, el diagnóstico clínico debe incluir todos los aspectos y antecedentes del paciente, incluyendo la frecuencia de exposición a los productos de origen animal si se sospecha resultados falsos. PRECAUCIONES Y ADVERTENCIAS DE SEGURIDAD MATERIAL POTENCIALMENTE BIOPELIGROSO Todos los reactivos de este kit deben ser considerados un peligro biológico potencial y manipulados con las mismas precauciones que se aplican a cualquier muestra de sangre. Las muestras de plasma humano deben ser manipulados como si fueran susceptibles de transmitir infecciones y de acuerdo con las buenas prácticas de laboratorio. RIESGOS QUIMICOS Evitar el contacto con reactivos que contienen PMSF, TMB, peróxido de hidrógeno y ácido sulfúrico. Si entra en contacto con cualquiera de estos u otros reactivos de este kit, lavar con abundante agua. TMB es un carcinógeno.

4 REACTIVOS Y EQUIPO NECESARIO PERO NO SUMINISTRADO 1. Tubos de recolección de sangre con EDTA Disodico (2 mg/ml sangre) 2. Pipetas automáticas y puntas desechables 3. Agua destilada o desionizada 4. Tubos de prueba desechables - 12 x 75mm. 5. Rotador 6. Lector de micropozos con filtro 450 nm filter. 7. Incubadora 37 C. 8. Baño de hielo. 9. Etanol al 95% REACTIVOS SUMINISTRADOS Preparación: Preparación: Tampón de generación Tampón y antibiótico no tóxico. 5 ml/botella Solución PMSF Requiere preparación Una botella contiene Fluoruro de fenilmetilsulfonilo (PMSF). Reconstituir por adición de 0.5 ml de etanol 95% a la botella y mezclar en vortex por 2 minutos hasta que esté completamente disuelto el PMSF. Refrigerar después del primer uso, mezcle en el vortex nuevamente para redisolver el contenido. No mantenga el frasco abierto innecesariamente. Placa de micropozos recubierta de anticuerpo de conejo Anti-Ang-I Dos placas de 96 micropozos pre-recubiertos en un empaque resellable con desecante. Conjugado Angiotensina-I-Biotina Una botella que contiene buffer, inhibidores de proteasa, conjugado Angiotensina-I-Biotina y un preservante libre de mercurio. 30 ml/botella Conjugado concentrado de Estreptavidina- Peróxido de rábano Requiere preparación Conjugado de Estreptavidina-HRP en un tampón con un preservante libre de mercurio 0.5 ml/vial Diluir el conjugado concentrado 1:100 en tampón de ensayo antes de usar. La solución de trabajo del conjugado es estable por 8 horas, descarte la solución no usada durante este periodo. Calibradores Angiotensina-I Ocho viales que contienen péptido sintético Angiotensina-I en un tampón basado en proteína con un preservante libre de mercurio. Los calibradores son calibrados contra un reactivo de referencia de la Organización Mundial de la Salud NIBSC código 86/536. Concentraciones de calibrador*: 0, 0.2, 0.5, 1.5, 4, 10, 25, 60 ng/ml. *Valor aproximado por favor verifique en la etiqueta del vial la concentración exacta de cada calibrador. Preparación: Calibrador A: 2 ml/vial Calibradores B-H: 0.7 ml/vial Controles Dos viales que contienen Angiotensina-I en un tampón basado en proteína con un preservante libre de mercurio. Verifique en la etiqueta el rango aceptable. 0.7 ml/vial Tampón de ensayo Una botella que contiene un tampón basado en proteína con un preservante libre de mercurio. Verifique en la etiqueta el rango aceptable. 40 ml/botella Tampón de lavado concentrado Requiere preparación Dos botellas que contienen tampón con un detergente no iónico y un preservante libre de mercurio. 50 ml/botella Diluir 1:10 en agua destilada o desionizada antes de usar. Si una placa completa va a ser usada debe diluir 50 ml de Tampón de lavado concentrado en 450 ml de agua. Sustrato TMB Una botella contiene Tetrametilbenzidina y Peróxido de Hidrógeno en un buffer no-dmf o DMSO. 32 ml/botella Solución de parada Una botella contiene Ácido Sulfúrico 1M. 12 ml/botella RECOLECCION DE MUESTRA Y ALMACENAMIENTO Un mínimo de 0.5 ml de plasma se requiere para la determinación por duplicado. Es esencial realizar una adecuada recolección de la muestra para una determinación precisa de Angiotensina-I. La generación in-vitro y degradación de la Angiotensina-I puede ser minimizada siguiendo este procedimiento: 1. Recolecte 2 ml de sangre en un tubo con EDTA por venopunción. 2. Centrifugue la sangre durante 15 minutos a 5000 rpm a temperatura ambiente. 3. Transfiera el plasma de la muestra a un tubo de vidrio de prueba a temperatura ambiente. 4. Si las muestras van a ser procesadas inmediatamente inicie el procedimiento de generación de Angiotensina-I, de lo contrario congele las muestras inmediatamente a -20 C o menos. Evite los ciclos de congelamiento y descongelamiento de muestras.

5 OD (450 nm) PROCEDIMIENTO DE GENERACION DE ANGIOTENSINA-I 1. Si una muestra de plasma recién extraída está siendo utilizada continúe con el paso 2. Si se utilizan muestras de plasma congeladas descongelar de la siguiente manera. Llevar rápidamente muestras de plasma congeladas a temperatura ambiente mediante la colocación de los tubos en un recipiente con agua a temperatura ambiente. 2. Transfiera 0.5 ml de la muestra de plasma dentro del tubo de ensayo de vidrio. 3. Adicione 5 µl de la solución PMSF a los 0.5 ml de la muestra de plasma (relación 1:100). Mezcle bien el tubo en el vortex. 4. Adicione 50 µl del tampón de generación a la muestra tratada del paso 3 (proporción 1:10). Mezcle bien el tubo en el vortex. 5. Divida la muestra tratada del paso 4 en dos alícuotas iguales transfiriendo 0.25 ml dentro de dos tubos de ensayo de vidrio. Incubar una alícuota durante 90 minutos o más a 37 C, ubique la segunda alícuota en un baño de hielo (0 C). Asegúrese de registrar el tiempo de incubación utilizado para las alícuotas ya que será necesario para los cálculos. 6. Al finalizar el tiempo de incubación ubique la alícuota de 37 C en el baño de hielo por 5 minutos para que se enfríe rápidamente. 7. Lleve dos alícuotas a temperatura ambiente mediante la colocación en un baño con agua a temperatura ambiente durante 5-10 minutos (no superior a 10 minutos). PROCEDIMIENTO DE PRUEBA 1. Deje que todos los componentes del kit estén a temperatura ambiente. Retirar el número necesario de tiras y montar en el marco de la placa. 2. Pipetear 50 µl de cada calibrador, control y muestra de plasma tratada (ambos alícuotas 37 C y 0 C) en los pocillos correspondientemente marcados por duplicado. 3. Pipetee 100 µl de conjugado Angiotensina-I-Biotina dentro de cada pozo (se recomienda el uso de una pipeta multicanal). 4. Incubar en un rotador de placas ( 200 rpm) durante 60 minutos a temperatura ambiente. 5. Lave los pozos 5 veces cada tiempo con 300 µl/pozo de tampón de lavado diluida. Después del lavado de la placa golpee firmemente contra un papel absorbente para remover cualquier residuo líquido (el uso de un lavador automático es altamente recomendado). El rendimiento de este ensayo está marcadamente influenciado por la correcta ejecución del procedimiento de lavado. 6. Pipetee 150 µl de la solución de trabajo del conjugado Estreptavidina- HRP dentro de cada pozo (se recomienda el uso de una pipeta multicanal). 7. Incubar en un rotador de placas ( 200 rpm) durante 30 minutos a temperatura ambiente. 8. Lave los pozos 5 veces con el mismo procedimiento del paso Pipetee 150 µl del sustrato TMB dentro de cada pozo (se recomienda el uso de una pipeta multicanal). Incubar en un rotador de placas ( 200 rpm) durante 10 a 15 minutos a temperatura ambiente. 10. Adicione 50 µl de solución de parada a cada pozo y mezclar bien golpeando suavemente la placa. 11. Mida la absorbancia a 450 nm en todos los pozos con un lector de microplaca entre los 0-20 minutos después de la adición de la solución de parada. CALCULOS 1. Utilizando un software de inmunoensayos, elegir una curva ya sea un parámetro 4 o 5 para el cálculo de resultados. 2. Si la muestra registra una lectura de más de 60 ng/ml, dilúyala con el calibrador 0 a una dilución no mayor de 1:10 y reanalice la muestra. El resultado obtenido debe ser multiplicado por el factor de dilución. 3. Calcule la actividad de la renina plasmática (PRA) en cada muestra utilizando la siguinete ecuación: PRA = [Ang-I (37 C)] [Ang-I (0 C)] Tiempo (hrs) x 1.11 TABULACION DE DATOS Datos de ejemplo solamente. No utilizar para calcular los resultados Calibrador DO media (450 nm) Ang-I (ng/ml) CURVA DE CALIBRACION TIPICA Curva de ejemplo solamente. No utilizar para calcular los resultados Angiotensin I (ng/ml) CARACTERISTICAS DE RENDIMIENTO SENSIBILIDAD El límite de detección bajo es calculado de la curva de calibración por determinación de la concentración resultante de la DO media del calibrador 0 (basado en el análisis de 14 replicados) menos 2 DS. Por lo tanto la sensibilidad del kit DIAsource PRA ELISA es ng/ml de Angiotensina-I. ESPECIFICIDAD (REACCION CRUZADA) Los siguientes componentes fueron probados para reactividad cruzada usando el método Abraham con reactividad a la Angiotensina-I al 100%: Antígeno Secuencia Angiotensina-I DRVYIHPFHL 100 Angiotensina 1-9 DRVYIHPFH Angiotensina-II DRVYIHPF <0.001 Angiotensina-III RVYIHPF <0.001 Angiotensina 1-5 DRVYI <0.001 Sustrato renina humana DRVYIHPFHLVIHN % Reactividad cruzada Donde tiempo (hrs) es el tiempo de incubación utilizado durante el paso de generación.

6 RECUPERACION Muestras enriquecidas se prepararon mediante la adición de cantidades definidas de la angiotensina-i a tres muestras de plasma de pacientes. Los resultados (en ng / ml) se tabulan a continuación: Muestra Resultado observado Resultado esperado %Recuperación 1.No enriquecida No enriquecida No enriquecida LINEARIDAD Tres muestras de plasma de pacientes fueron diluidas con el calibrador 0. Los resultados (en ng/ml) se tabulan a continuación: Resultado Resultado Muestra % Recuperación observado esperado : : : : : : : : : : : : INTERFERENCIA La prueba de interferencia fue realizada de acuerdo a la guía CLSI EP7-A2. Las muestras de plasma con diferentes niveles de Angiotensina-I fueron enriquecidas con sustancias potencialmente interferentes y se analizaron. Los resultados fueron comparados con las mismas muestras de plasma sin adicionar las sustancias para calcular el % de interferencia. Interferencia (%)= [Ang I(muestra enriquecida)] [Ang I (muestras nativas)] X 100 [Ang I (muestra nativa)] Interferente Hemoglobina Bilirrubina no conjugada Bilirrubina Conjugada* Hemoglobina + Bilirrubina Concentración de interferente adicionado 1 g/ L g/l µm (12 mg/l) µm (300 mg/l) 0 20 µm (16 mg/l) µm (400 mg/l) g/l + 20 µm g/l µm g/l + 20 µm g/l µm % Interferencia Triglicéridos 3.7 mm +4.8 (2C-10 C) 37 mm Triglicéridos 3.7 mm -0.6 (8C-16 C) 37 mm +2.2 HSA *Taurobilirubina 40 g/l g/l -9.6 PRECISION INTRA-ENSAYO Cuatro muestras fueron analizadas 14 veces cada una con la misma curva de calibrador. Los resultado (en ng/ml) se tabulan a continuación: Sample Mean SD CV% INTER-ASSAY PRECISION Four samples were assayed in ten different tests. The results (in ng/ml) are tabulated below: Muestra Media SD %CV ESTUDIOS COMPARATIVOS El kit DIAsource PRA ELISA kit (x) fue comparado con un kit PRA LIA (y). La comparación de 12 muestras de plasma ensayadas dieron como resultado la siguiente regresión lineal: y = 1.09x , r = VALORES NORMALES ESPERADOS Como para todos los ensayos clínicos cada laboratorio debe recolectar los datos y establecer su rango de valores normales esperados. Los datos presentados aquí fueron con muestras incubadas a ph 6.0 durante el paso de generación (Brossaud and Corcuff, 2009). Media PRA N (ng/ml.h) Rango PRA (10 th -90 th percentil) (ng/ml.h) REFERENCES 1. Brossaud, J., Corcuff JB. Clin. Chim. Act. 410:90, Bystrom CE et al., Clin Chem, 56:XXX, Campbell, DJ, et al., Clin. Chem. 55:867, Cartledge, S., Lawson, N., Ann. Clin. Biochem. 37:262, Derkx FH et al., J Biol Chem, 262:2472, Hartman D, et al., Clin Chem, 50:2159, Pimenta E, Calhoum D, Hypertension, 55:e17, Reudelhuber, TL, Hypertension, 55:1071, Sealey, JE, J. Hypertension, 13:27, Sealey, JE, Clin. Chem. 37/10(B): 1811, Sealey et al., Trends Endocrin Metab, 16:86, Ulmer PS, Weikle AW, Clin Chem. 46:1442, 2000.

7 P.I. Number : WASH SOLN CONC CAL 0 CAL N CONTROL N Ag 125I Ab 125I Ag 125I CONC Ab 125I CONC INC BUF ACETONITRILE SERUM DIL SPE DIL BUF ANTISERUM IMMUNOADSORBENT DIL CAL REC SOLN PEG EXTR SOLN ELU SOLN GEL PRE SOLN NEUTR SOLN TRACEUR BUF Ab HRP Ag HRP Ab HRP CONC Ag HRP CONC CONJ BUF CHROM TMB CONC CHROM TMB SUB BUF STOP SOLN INC SER BUF Ab AP SUB PNPP BIOT CONJ CONC AVID HRP CONC ASS BUF Ab BIOT Ab SAV HRP CONC NSB 2nd Ab ACID BUF DIST TRAY PMSF STRIP SUB EXTR SOLN CONC CART WASH SOLN Símbolos usados Consulte las instrucciones de uso Temperatura de almacenamiento Use por Número de lote Número de catálogo Control Dispositivo médico de diagnóstico In vitro Fabricante Contenido suficiente para <n> pruebas Solución de lavado concentrada Calibrador cero Calibrador # Control # Trazador Trazador Trazador concentrado Trazador concentrado Tubos Tampón de incubación Acetonitrilo Suero Diluyente de muestra Tampón de dilución Antisuero Immunoadsorbente Diluyente de calibrador Solución de reconstitución Polietilen glicol Solución de extracción Solución de elución Cartuchos de sílica Bond Elut solución Pre-tratamiento Solución de Neutralización Tampón trazador Micropozos Conjugado HRP Conjugado HRP HRP Conjugado concentrado HRP Conjugado concentrado Tampón de conjugado TMB Cromogenico concentrado Solución TMB Cromogenica Sustrato Solución de parada Incubación del suero Tampón AP Conjugado Sustrato PNPP Conjugado Biotin concentrado Avidina HRP concentrado Tampón de ensayo Biotina conjugado Anticuerpo específico Estreptavidina HRP concentrada Unión no específica 2do anticuerpo Tampón de Acidificación Distribuidor Bandejas de incubación Solución PMSF Proteger de la luz Tira Suastrato Tampón de extracción concentrado Cartucho Tampón de lavado Revisión nr

Mercodia Ultrasensitive C-peptide ELISA

Mercodia Ultrasensitive C-peptide ELISA Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso 10-1141-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia

Más detalles

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00 Quantikine IVD ELISA Inmunoensayo Epo Humano Manual de Instrucciones suplementario Referencia DEP00 Este manual de instrucciones incluye el protocolo del ensayo y debe leerse en su totalidad antes de comenzar

Más detalles

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente.

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente. bioelisa HCV 4.0 3000-1115 LEER CAMBIOS SOMBREADOS 96 tests 3000-1116 480 tests Test de ELISA para la detección de anticuerpos contra el virus de la hepatitis C (HCV) en suero o plasma humano para ser

Más detalles

ELISA PeliClass human IgG subclass kit REF M1551

ELISA PeliClass human IgG subclass kit REF M1551 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: +.0.5.599 Fax: +.0.5.570 Email: Website: M55/ November 007 ELISA PeliClass human IgG subclass

Más detalles

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas.

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. C-peptide N de código K6220 Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. Este kit contiene reactivos para 96 pocillos de prueba. (111838-002) K6220/ES/CKJ/2009.06.17

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar.

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar. bioelisa HIV-1+2 (rec) 3000-1143 LEER CAMBIOS SOMBREADOS 96 tests 3000-1144 480 tests Test de ELISA para la detección de anticuerpos contra HIV-1 y HIV-2 en suero o plasma humano. Sumario Como es conocido

Más detalles


PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles


PTH RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN PTH Un inmunoensayo enzimático para la determinación cuantitativa de la PTH (hormona paratiroidea) intacta en el suero humano RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN El kit de inmunoensayo enzimático de

Más detalles


DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

Murex anti-hbc (total)

Murex anti-hbc (total) es 8G21-01/-02 GE65/66 Primera edición 10/2009 Murex anti-hbc (total) Enzimoinmunoanálisis para la detección de anticuerpos frente al antígeno core del virus de la hepatitis B (anti-hbc) en suero o plasma

Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D-20354 Hamburg DISTRIBUIDOR medac Gesellschaft für klinische

Más detalles

Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN

Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN EIA (inmunoensayo enzimático) de la 25-OH vitamina D de MicroVue Página 1 de 17

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La prueba de Demanda Química de Oxígeno (DQO) se basa en la oxidación química de la materia orgánica e inorgánica, presente en las muestras de agua, con dicromato de potasio

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201)

Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201) Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201) 20 x 96 (n.º de referencia 0594-0501) Ensayo de IFN-γ en sangre total que mide la reacción a los antígenos peptídicos

Más detalles

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos Objetivos del Entrenamiento Una vez finalizado este capítulo, usted podrá: Definir inmunoensayo Describir la

Más detalles


Inhibin A ELISA. AL-123-i INTENCION DE USO RESUMEN Y EXPLICACION PRINCIPIO DE LA PRUEBA MATERIALES SUMINISTRADOS. Page 1 of 6 Page 1 of 6 Inhibin A ELISA AL-123-i INTENCION DE USO El kit de ensayo ezimatico inmunoabsorbente (ELISA) de Inhibina A, proporciona materiales para la medición cuantitativa de la Inhibina A dimérica en

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN 25. Perfil lipídico Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 1 Departamento de Bioquímica y Biología Molecular, Avda. Menéndez Pidal s/n, 14071- Córdoba, 2 Campus de Rabanales, Edif. Severo Ochoa 14071-Córdoba

Más detalles



Más detalles

Mercodia Proinsulin ELISA

Mercodia Proinsulin ELISA Mercodia Proinsulin ELISA Instrucciones para el uso 10-1118-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

Mercodia Iso-Insulin ELISA

Mercodia Iso-Insulin ELISA Mercodia Iso-Insulin ELISA Instrucciones para el uso 10-1128-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles


CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano.

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. 96 PRUEBAS USO El equipo de Prolactina CLIA se destina para

Más detalles


ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Página 1 de 9 ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Elaborado por: CNSP Blgo. Manuel Céspedes Zambrano Revisado por: CNSP TM. Julia I. Espinoza Soto CNSP MV Gladys Malásquez Mendoza Aprobado por: RD

Más detalles

Detección de IgE específica.

Detección de IgE específica. Detección de IgE específica. Una forma de identificar los alérgenos responsables de los síntomas alérgicos es la detección de anticuerpos IgE específicos frente a dichos alérgenos. Estos anticuerpos están

Más detalles

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular TP1: Diluciones Objetivos Familiarizarse con las unidades mas utilizadas en biología molecular y ser capaces de intercambiar ágilmente las distintas unidades. Familiarizarse con el material de uso corriente

Más detalles

Manual del GPHF-Minilab

Manual del GPHF-Minilab Una Guía Concisa de Control de Calidad de Drogas Esenciales y otros Medicamentos Manual del GPHF-Minilab Tercer Suplemento del Volumen II Cromatografía de Capa Fina Extensión 2003 Antiretrovirales Una

Más detalles

Integrantes: Andrés Felipe Cárdenas Álvarez 2101302 Diana Katherine Carreño Moyano 2100993 Lorena Duarte Peña 2100968. Grupo: 4

Integrantes: Andrés Felipe Cárdenas Álvarez 2101302 Diana Katherine Carreño Moyano 2100993 Lorena Duarte Peña 2100968. Grupo: 4 PRÁCTICA 8. DETERMINACIÓN DE CALCIO Y MAGNESIO EN UN LÁCTEO, LECHE ENTERA PARMALAT Integrantes: Andrés Felipe Cárdenas Álvarez 2101302 Diana Katherine Carreño Moyano 2100993 Lorena Duarte Peña 2100968

Más detalles

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68 APÉNDICE Apéndice 1. Espectrofotómetro (Users Manual 2100 Series Spectrophotometer) 68 El espectrofotómetro de la marca UNICO serie 2100 UV posee un rango de longitud de onda de 200-1000 nm. La técnica

Más detalles

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv RESULTADOS Y DISCUSIÓN Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv La curva estándar con la que se estimó la concentración proteica del filtrado

Más detalles


CARDIOCHEK y CARDIOCHEK P.A CARDIOCHEK y CARDIOCHEK P.A NUEVA GENERACIÓN DE ANALIZADORES PORTÁTILES Introducción El Cardiochek y Cardiochek P.A son instrumentos portátiles que proporcionan medidas rápidas y precisas de múltiples

Más detalles


SC5b-9 Plus RESUMEN Y EXPLICACIÓN SC5b-9 Plus Enzimoinmunoensayo para la cuantificación del complejo SC5b-9 presente en plasma o suero humanos MicroVue SC5b-9 Plus EIA Preparación del Reactivo y de la Muestra Diluya el Concentrado de Solución

Más detalles



Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles



Más detalles

Electrodo selectivo de cianuro

Electrodo selectivo de cianuro 96 53 Electrodo selectivo de cianuro - CN Electrodo selectivo de cianuro. Manual del usuario. Garantía El plazo de validez es de 6 meses a partir de la fecha de expedición del electrodo. La garantía cubre

Más detalles


MANEJO DE ANALIZADOR DE AUTOCLAVES MANEJO DE ANALIZADOR DE AUTOCLAVES GICUV Guía para el Manejo de Autoclaves 1 Oficina de Planeación y Desarrollo Institucional Prof. Carlos Hernán Gonzales Campo Dirección Área de Calidad y Mejoramiento

Más detalles


DENV Detect TM IgM CAPTURE ELISA Detect TM IgM CAPTURE ELISA USO PREVISTO La prueba Detect IgM Capture ELISA está diseñada para la detección cualitativa de anticuerpos IgM contra antígenos recombinantes DEN (DENRA) en suero para diagnóstico

Más detalles

Departamento de Bioquímica y Biología Molecular,

Departamento de Bioquímica y Biología Molecular, 18. Inmunoanálisis Aurora Galván Cejudo 1, Isaac Túnez Fiñana 2 Departamento de Bioquímica y Biología Molecular, 1 Campus Universitario de Rabanales, Edificio Severo Ochoa, 14071-Córdoba, 2 Facultad de

Más detalles

Curso Comparabilidad de resultados

Curso Comparabilidad de resultados Curso Comparabilidad de resultados Director: Gabriel A. Migliarino. Docente: Evangelina Hernández. Agenda Introducción. n. Protocolos iniciales de comparación de métodos. m * EP9-A2. CLSI. * Comparación

Más detalles

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY Modificaciones: 11 Supresiones:

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY Modificaciones: 11 Supresiones: DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY Modificaciones: 11 Supresiones: 1. FINALIDAD DEL ENSAYO Ensayo in vitro para determinación cuantitativa de alfafetoproteína

Más detalles


RECOMENDACIONES PARA TOMAR MUESTRAS DE AMONIO SANGUÍNEO RECOMENDACIONES PARA TOMAR MUESTRAS DE AMONIO SANGUÍNEO El amonio es un producto tóxico del metabolismo nitrogenado. Su acumulación en sangre y secundariamente en sistema nervioso central es responsable,

Más detalles


REACCIONES DE IONES METÁLICOS Actividad Experimental 4 REACCIONES DE IONES METÁLICOS Investigación previa -Investigar las medidas de seguridad para trabajar con amoniaco -Investigar las reglas de solubilidad de las sustancias químicas.

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Murex HIV Ag/Ab Combination

Murex HIV Ag/Ab Combination es 7G79-09/-11 GE41/42 Primera edición 08/2009 Murex HIV Ag/Ab Combination Enzimoinmunoanálisis para la detección mejorada de la seroconversión frente a los virus de la inmunodeficiencia humana tipo 1

Más detalles



Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985.

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985. Página 1 de 8 1. OBJETIVO Determinar la concentración de sodio, potasio y calcio en muestras de alimentos con bajo contenido de grasa. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a alimentos

Más detalles

J. Muestras 2015-871 - 2015-875 Proficiencia para Contaje de Espermatozoides.

J. Muestras 2015-871 - 2015-875 Proficiencia para Contaje de Espermatozoides. 5 de octubre de 2015 Laboratorios Participantes Laboratorios de Salud Pública De Puerto Rico Laboratorios de Salud Pública De Puerto Rico Laboratorios de Salud Pública de P.R. INSTRUCCIONES PARA LA PROFICIENCIA

Más detalles


GUIA DE MANEJO DE RESIDUOS QUÍMICOS La Universidad Autónoma de Occidente, mantendrá programas y operaciones para minimizar los efectos de las sustancias peligrosas y residuos peligrosos sobre el medio ambiente. Cuando se genere un residuo

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

Acción Enzimática: Actividad de la Catalasa

Acción Enzimática: Actividad de la Catalasa Acción Enzimática: Actividad de la Catalasa Experimento 3 Muchos organismos pueden descomponer el peróxido de hidrógeno (H 2 O 2 ) por la acción de las enzimas. Las enzimas son proteínas globulares responsables

Más detalles


CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS Ref. 4755 2014/04 CALIBRADORES Hb A1c CAPILAR Aplicación Los Calibradores Hb A1c CAPILAR están destinados a la calibración y al control de migración

Más detalles



Más detalles

B Fig. 2. Ley de Lambert

B Fig. 2. Ley de Lambert INTRODUCCION TEORICA FUNDAMENTOS DE ESPECTROFOTOMETRÍA Introducción : La espectrofotometría es uno de los métodos de análisis más usados, y se basa en la relación que existe entre la absorción de luz por

Más detalles


DETERMINACIÓN COLORIMÉTRICA DEL HIERRO DETERMINACIÓN COLORIMÉTRICA DEL HIERRO OBJETIVO Familiarizarse con los principios del análisis colorimétrico. INTRODUCCIÓN La base para lo que los químicos llaman análisis colorimétrico es la variación

Más detalles

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios:

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios: En muchos países, entre ellos Australia, Canadá, la Unión Europea, Corea, Japón, Nueva Zelanda, EEUU, existen leyes y sistemas de control para regular el etiquetado relativo a alergenos alimentarios. Las

Más detalles

RIDASCREEN. Leishmania Ab. Art. n.: K7121

RIDASCREEN. Leishmania Ab. Art. n.: K7121 RIDASCREEN Leishmania Ab Art. n.: K7121 R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Telf.: +49 (0) 6151 8102-0 / Fax: +49 (0) 6151 8102-20 1. Área de aplicación Para el diagnóstico

Más detalles

Validación y verificación de métodos de examen cuantitativos

Validación y verificación de métodos de examen cuantitativos Temas selectos de Calidad en Serología (aplicación en el banco de sangre) Validación y verificación de métodos de examen cuantitativos Ignacio Reyes Ramírez entidad mexicana de acreditación, a.c. Introducción

Más detalles

MR-12 Agitador de balanceo

MR-12 Agitador de balanceo MR-12 Agitador de balanceo Manual de funcionamiento Certificado para la versión V.2AW Contenidos 1. Precauciones de seguridad 2. Información general 3. Cómo empezar 4. Funcionamiento 5. Especificaciones

Más detalles

C1q CIC ELISA 704620

C1q CIC ELISA 704620 QUANTA Lite Para Diagnóstico In Vitro Complejidad de CLIA: Alto C1q CIC ELISA 704620 Aplicación El propósito de este kit es la determinación in-vitro de los inmunocomplejos circulantes (CIC) ligantes de

Más detalles


CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles


ANÁLISIS DE ELEMENTOS TRAZA EN ESPECÍMENES BIOLÓGICOS: Objetivo. Metodología FTTM07 Rev-1, 09/06/20119 INSTITUTO DE TOXICOLOGÍA DE LA DEFENSA Hospital Central de la Defensa. Glorieta del Ejército s/n. 28047 MADRID. Tel.: 914222625. Fax: 914222624 E- mails : //

Más detalles

El tipo de alteración observada también proporciona gran información:

El tipo de alteración observada también proporciona gran información: TEMA 5: ENZIMOLOGÍA CLÍNICA 1. Valor diagnóstico de las enzimas en el plasma. 2. Principios del análisis de enzimas 3. Análisis de isoenzimas. 4. Determinación enzimática de sustratos. 1. Valor diagnóstico

Más detalles


FICHA TÉCNICA LIMPIADOR DE MANOS ABRASIVO. SafePro Abrasive FICHA TÉCNICA LIMPIADOR DE MANOS ABRASIVO SafePro Abrasive (Con Enjuague - Cítrico) Nº de Inscripción: 0248/99 Fórmula cualitativa: Aqua Paraffinum Liquidum Glyceryl Stearate (and) PEG-100 Stearate Disodium

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis.

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis. Laboratorio de Métodos Instrumentales I Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis Equipo 1 Candy Lara Rentería Jessica Torres Gámez Salón 1 Mérida, Yucatán

Más detalles

DiaSorin Inc 1951 Northwestern Ave Stillwater, MN 55082 USA Tel. +1.651.439.9710 Fax +1.651.351.5669

DiaSorin Inc 1951 Northwestern Ave Stillwater, MN 55082 USA Tel. +1.651.439.9710 Fax +1.651.351.5669 DiaSorin Inc 1951 Northwestern Ave Stillwater, MN 55082 USA Tel. +1.651.439.9710 Fax +1.651.351.5669 Ensayo LIAISON N-TACT PTH (310910) 1. FINALIDAD DEL ENSAYO El ensayo LIAISON N-TACT PTH emplea la tecnología

Más detalles

Acido Urico Uricasa - POD

Acido Urico Uricasa - POD Acido Urico Uricasa - POD Usar un suero de calibración valorado por este método. Programar en el ordenador los siguientes parámetros: Nombre de la prueba : AC. URICO Prueba : URIC Código de barras de la

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Calf Notas Acerca de Terneros #39 - Usando el refractómetro

Calf Notas Acerca de Terneros #39 - Usando el refractómetro Calf Notas Acerca de Terneros #39 - Usando el refractómetro Introducción. El medir el grado de transferencia de inmunidad pasiva a los terneros recién nacidos puede decirle mucho acerca del nivel

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

1. Precauciones de seguridad

1. Precauciones de seguridad Contenidos 1. Precauciones de seguridad 2. Información general 3. Cómo empezar 4. Funcionamiento 5. Especificaciones 6. Mantenimiento 7. Garantía y reclamaciones 8. Declaración de conformidad 2 1. Precauciones

Más detalles


GEBRAX DIVISION DIAGNÓSTICA GEBRAX T h e r a p e u t i c s & D i a g n o s t i c s DIVISION DIAGNÓSTICA Se recomienda que el prospecto deba ser leído antes de comenzar el procedimiento de prueba. Aunque el ensayo está diseñado para

Más detalles



Más detalles


1. IDENTIFICACIÓN DEL PREPARADO Y DE LA SOCIEDAD O EMPRESA 1. IDENTIFICACIÓN DEL PREPARADO Y DE LA SOCIEDAD O EMPRESA 1.1 Identificación de la sustancia o el preparado Nombre comercial del producto: Aspecto: Líquido de color marrón 1.2 Uso de la sustancia/preparado

Más detalles


CONTENIDO DE LA GUÍA OBJETIVO CONTENIDO DE LA GUÍA OBJETIVO Reconocer las características físicas y formas de emplear el material de laboratorio, con el cual se desarrollan diferentes actividades experimentales que permiten alcanzar

Más detalles

5 Materiales y Métodos

5 Materiales y Métodos 5 Materiales y Métodos Los tejidos de Cenchurs ciliaris utilizados en esta investigación fueron obtenidos por pretratamiento con H 2 SO 4 al 0.15 M, a 135ºC, para eliminar la hemicelulosa. Con los tejidos

Más detalles

Prospecto de QuantiFERON -CMV ELISA 2 96

Prospecto de QuantiFERON -CMV ELISA 2 96 Prospecto de QuantiFERON -CMV ELISA 2 96 Prueba de IFN-γ en sangre total para medir las respuestas a los antígenos peptídicos del citomegalovirus humano Para uso de diagnóstico in vitro 0350-0201 Cellestis,

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles



Más detalles


BRUCELOSIS: TÉCNICA DE POLARIZACIÓN FLUORESCENTE, PARA ESTAR SEGUROS BRUCELOSIS: TÉCNICA DE POLARIZACIÓN FLUORESCENTE, PARA ESTAR SEGUROS Giménez P.M. 1, Barcos O. G. 2, Moran R. D. 3. 2007. Revista Brangus, Bs. As., 29(55):62-66. 1 y 2.- Méd. Vet. Laboratorio Colon. 3.-

Más detalles

CAPITULO 5. PROCESO DE SECADO. El secado se describe como un proceso de eliminación de substancias volátiles (humedad)

CAPITULO 5. PROCESO DE SECADO. El secado se describe como un proceso de eliminación de substancias volátiles (humedad) CAPITULO 5. PROCESO DE SECADO. 5.1 Descripción general del proceso de secado. El secado se describe como un proceso de eliminación de substancias volátiles (humedad) para producir un producto sólido y

Más detalles

GUEMISA Sta. Virgilia 3-b; 1º F 28033 Madrid Tfno.: 91 764 21 00 Fax.: 91 764 21 32

GUEMISA Sta. Virgilia 3-b; 1º F 28033 Madrid Tfno.: 91 764 21 00 Fax.: 91 764 21 32 ph 1. SUMARIO Y APLICACIONES 1. El principio básico de la medida electrométrica del ph se fundamenta en el registro potenciométrico de la actividad de los iones hidrógeno por el uso de un electrodo de

Más detalles

Pruebas serológicas para dengue

Pruebas serológicas para dengue Pruebas serológicas para dengue El 40% de la población mundial corre riesgo de infección por dengue Durante más de 25 años, Focus Diagnostics ha sido un líder en el desarrollo de ensayos inmunológicos

Más detalles


DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000 DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000 Este Modo Operativo está basado en la Norma ASTM C 289, la misma que se ha adaptado al nivel de implementación y a las

Más detalles

3M Placas Petrifilm TM para el Recuento de Aerobios

3M Placas Petrifilm TM para el Recuento de Aerobios 3M Placas Petrifilm TM para el Recuento de Aerobios Recomendaciones de uso Para detallar información sobre PRECAUCIONES, COMPENSACIONES POR GARANTÍA / GARANTÍA LIMITADA, LIMITACIONES POR RESPONSABILIDAD

Más detalles



Más detalles

Símbolos clave utilizados

Símbolos clave utilizados Sistema Microelisa HTLV-I/II de Avioq Símbolos clave utilizados Número de catálogo Consulte Instrucciones de uso Código de lote Dispositivo médico para diagnóstico in vitro Fecha de vencimiento Control

Más detalles

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - Italy Modificaciones: Supresiones:

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - Italy Modificaciones: Supresiones: DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - Italy Modificaciones: Supresiones: 1. FINALIDAD DEL ENSAYO Ensayo in vitro para la determinación de tiroglobulina humana (htg)

Más detalles