Mercodia Ultrasensitive C-peptide ELISA

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Mercodia Ultrasensitive C-peptide ELISA"

Transcripción

1 Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia AB, Sylveniusgatan 8A, SE Uppsala, Suecia

2 EXPLICACIÓN DE LOS SÍMBOLOS UTILIZADOS EN LAS ETIQUETAS = 96 Reactivos para 96 determinaciones Fecha de caducidad Conservar a entre 2 8 C Nº lote Para uso diagnóstico in vitro Mercodia

3 UTILIZACIÓN PREVISTA Mercodia Ultrasensitive C-peptide ELISA es un método para la determinación cuantitativa de humana péptido C en suero, plasma o orina. RESUMEN Y EXPLICACIÓN DE LA PRUEBA La evaluación cualitativa y cuantitativa de la función de las células ß pancreáticas se realiza no sólo para el estudio pre- y postdiagnóstico de la historia natural de la diabetes mellitus, sino que también es importante en la práctica clínica como guía para escoger el tratamiento correcto. Los niveles de insulina periférica no pueden utilizarse para evaluar la función de las células ß debido a la amplia y variable captación desde la circulación portal hacia el hígado, y debido a que los ensayos de insulina no diferencian entre insulina endógena y exógena. En la célula ß pancreática, la proinsulina se divide en una molécula de péptido C y una molécula de insulina. El péptido C posteriormente pasa a la circulación a concentraciones equimolares a las de insulina. A diferencia de la insulina, el péptido C es extraído sólo mínimamente por el hígado. Las concentraciones de péptido C periférico reflejan, por tanto, la secreción de las células ß de forma más precisa que la insulina. PRINCIPIO DEL PROCEDIMIENTO Mercodia Ultrasensitive C-peptide ELISA es un inmunoensayo de fase sólida de dos puntos. Se basa en la técnica de sandwich directo según la que dos anticuerpos monoclonales se dirigen contra determinantes antigénicos separados de la molécula de insulina. Durante la incubación, el péptido C de la muestra reacciona con los anticuerpos anti-péptido C unidos a al pocillo de microtitulación. Después una limpieza simple, se agrega anticuerpos anti-c-peptide conjugados en peroxidasa y se lo deja incubar una segunda vez. Un paso de limpieza simple elimina el anticuerpo etiquetado de enzima sin ligar. El conjugado ligado se detecta por reacción con 3,3,5,5 -tetrametilbencidina (TMB). La reacción se para añadiendo ácido para dar un punto final colorimétrico que se lee por espectrofotometría. ADVERTENCIAS Y PRECAUCIONES Para uso diagnóstico in vitro. El contenido de este kit y sus residuos no deben dejarse entrar en contacto con animales rumiantes o cerdos. La Stop Solution de este kit contiene 0.5M H 2 SO 4. Seguir las precauciones rutinarias para el manejo de productos químicos peligrosos. Las muestras deben manipularse como si fueran capaces de transmitir infecciones. Cada pocillo sólo puede ser usado una vez. MATERIAL REQUERIDO PERO NO SUMINISTRADO Pipetas de volumen adecuado (para añadir la solución de la Assay Buffer, solución de la enzyme conjugate 1X, Substrate TMB y Stop Solution se prefieren las pipetas de repetición) Tubos, Cubetas y probetas para preparar los reactivos 3

4 Agua bidestilada Agitador magnético Mezclador de vórtice Lector de microplacas (filtro de 450 nm) Agitador de placas ( vueltas por minuto, movimimento orbital) Aparato para lavador de microplaca con función de sobre-flujo de lavado (recomendado pero no obligatorio) REACTIVOS Cada kit de Mercodia Ultrasensitive C-peptide ELISA ( ) contiene reactivos para 96 pocillos, suficientes para 42 muestra y una curva de calibración por duplicado. Para series de ensayos más amplias, mezclar reactivos de paquetes de número de lote idéntico. La fecha de caducidad del kit completo está en el exterior identificada en una etiqueta. La temperatura de conservación recomendada es 2 8ºC. Coated Plate 1 placa 96 pocillos Listo para usar Anticuerpo monoclonal de ratón anti-c-peptide 8 tiras de pocillos Para cintas de microtitración sin utilizar, cerrar la bolsa con cinta adhesiva y conservar a 2 8 C durante 2 mes. Calibrators 1, 2, 3, 4, 5 5 viales 1000 μl Liofilizado humanos del C-peptide Añadir 1000 μl Codificado en amarillo de agua bidestilada Concentratión declaró la etiqueta del vial. por vial Almacenaje después de la reconstitución: 2-8 C durante 1 semana. Para el almacenaje de Calibrators reconstituidos durante más de 1 semana, conservar a 20 C. Calibrator 0 1 vial 5 ml Listo para usar Codificado en amarillo Assay Buffer 1 vial 6 ml Listo para usar Codificado en rojo Enzyme Conjugate 21X 1 vial 1.2 ml Preparación, Monoclonal de ratón Enzyme Conjugate ver abajo con peroxidasa anti-c-peptide Enzyme Conjugate Buffer 1 vial 24 ml Listo para usar Codificado en azul Wash Buffer 21X 1 botella 50 ml Diluir con 1000 ml Almacenaje después de diluir: agua bidestilada 2-8 C durante 2 mes para preparar la solución de wash buffer 1X Substrate TMB 1 botella 22 ml Listo para usar Solución incolora Atención! Es sensible a la luz! Stop Solution 1 vial 7 ml Listo para usar 0.5 M H 2 SO 4 4

5 Preparación de solución de la enzyme conjugate 1X Preparar el volumen necesario de solución de la enzyme conjugate 1X por dilución del Enzyme Conjugate 21X (1+20) en Enzyme Conjugate Buffer según la siguiente tabla. Si se usa toda la placa, verter completamente el tampón Emzyme Conjugate Buffer al vial Enzyme Conjugate 21X. Mezclar suavemente. Utilizar en un dia. Número de tiras 12 tiras 8 tiras 4 tiras Enzyme Conjugate 21X 1 vial 700 μl 350 μl Enzyme Conjugate Buffer 1 vial 14 ml 7 ml OBTENCIÓN Y MANIPULACIÓN DE MUESTRAS Suero Recoger la sangre por venipunción, dejar coagular y separar el suero por centrifugación. Las muestras pueden conservarse a 2 8 C hasta 3 días. Para periodos más largos, conservar las muestras a 20 C. Evitar la congelación y descongelación de forma repetida. Plasma Recoger la sangre por venipunción en tubos que contienen heparina o EDTA como anticoagulante y separar la fracción de plasma por centrifugación. Las muestras pueden conservarse a 2 8 C hasta 3 días. Para periodos más largos, conservar las muestras a 20 C. Evitar la congelación y descongelación de forma repetida. Orina Recoger orina de 24 horas (sin conservantes). Guardar la muestra a 2 8 C entre recogidas. Registrar el volumen total de muestra y guardar una alícuota bien mezclada para análisis. Conservar las muestras a 2 8 C durante un máximo de 24 horas antes del ensayo. Para una conservación más larga, congelar las muestras de orina a 70 C hasta que se realice el ensayo. Deben evitarse las congelaciones y descongelaciones repetidas. Los restos celulares deben eliminarse antes del ensayo, por filtración o centrifugación. Preparación de las muestras Diluir las muestras de orina 1/10 v/v en Calibrator 0 antes del ensayo. Sin dilución se normaly necesarios para las muestras de suero y plasma; sin embargo, muestras con una concentración superior a Calibrator 5 deben diluirse en Calibrator 0. 5

6 PROCEDIMIENTO DE EVALUACIÓN Todos los reactivos y muestras deben estar a temperatura ambiente antes de su uso. Preparar una curva calibración para cada ensayo. 1. Preparar solución de la enzyme conjugate 1X y solución de wash buffer 1X. 2. Preparar suficientes pocillos de microplaca para los Calibrators, controles y muestras por duplicado. 3. Pipetear 50 μl de cada Calibrator, controles y muestra en los pocillos correspondientes. 4. Añadir 50 μl de Assay Buffer a cada pocillo. 5. Incubar en un agitador de placas ( rpm) durante 1 hora a temperatura ambiente (18 25 C). 6. Lavar 6 veces con 700 μl solución de wash buffer 1X por pocillo mediante Lavador de placas automático con función de sobre-flujo de lavado. Después del lavado final, invertir la placa y golpearla firmemente contra papel absorbente. No usar el paso de remojo durante el proceso. O manualmente: Verter el líquido invirtiendo la microplaca en una pila. Añadir 350 μl de solución de wash buffer 1X, golpeando firmemente la placa contra papel absorbente para eliminar todo el líquido en exceso. Repetir 5 veces. Evitar remojo prolongado durante el proceso. 7. Añadir 200 μl solución de la enzyme conjugate 1X a cada pocillo. 8. Incubar en un agitador de placas ( rpm) durante 1 hora a temperatura ambiente (18 25 C). 9. Lavar como se describe en Añadir 200 μl de Substrate TMB. 11. Incubar durante 30 minutos en el banco a temperatura ambiente (18 25 C). 12. Añadir 50 μl de Stop Solution de parada a cada pocillo. Colocar la placa en un agitador durante aproximadamente 5 segundos para asegurar el mezclado. 13. Leer la densidad óptica a 450 nm y calcular los resultados. Leer en 30 minutos. Aviso: Usar pipetas distintas para prevenir contaminación entre conjugado y sustrato. 6

7 CONTROL DE CALIDAD INTERNA Los controles comerciales y/o mezclas de sueros internas con concentraciones de c-peptide bajas, medias y altas, se analizarán de forma rutinaria como muestras y los resultados se representarán día a día. Es una buena práctica de laboratorio registrar los siguientes datos en cada ensayo: número de lote del kit, fechas de preparado de los componentes del kit, valores de DO de blanco, Calibrators y controles. Los laboratorios deben seguir las normativas gubernamentales o requisitos de Acreditación para el control de calidad periódico. CÁLCULO DE RESULTADOS Cálculo computarizado Para obtener la concentración de péptido C realize la reducción de datos computarizados del a absorbancia para los Calibrators, sin Calibrator 0, frente a la concentración utilizando una regresión spline cúbica. Cálculo manual 1. Representar gráficamente los valores de absorbancia obtenidos para los Calibrators, sin Calibrator 0, frente a la concentración de péptido C en papel log-log y construir una curva de calibración. 2. Leer la concentración de las muestras a partir de la curva de calibración. Ejemplo de resultados Pocillos Identidad A 450 Conc. media pmol/l 1A B 1C D 1E F 1G H 2A B 2C D 2E F 2G H 3A B Calibrator 0 Calibrator 1* Calibrator 2* Calibrator 3* Calibrator 4* Calibrator 5* Muestra 1 Muestra 2 Muestra 3 *Concentratión declaró la etiqueta del vial 0.074/ / / / / / / / /

8 Ejemplo de curva de calibración Aquí se presenta una curva de calibración típica. Esta curva no debe utilizarse para verificar resultados de un ensayo ,0 O.D. O.D: 450 nm 1.0 1, , C- pep/de (pmol/l) C-peptide (pmol/l) LÍMITES DEL PROCEDIMIENTO Igual que todas las pruebas diagnósticas, un diagnóstico clínico definitivo no debe estar basado únicamente en los resultados de una sola prueba, sino que el médico debe hacerlo sólo después de haber evaluado todos los datos clínicos. Las muestras lipémicas, ictéricas o hemolizadas no interfieren en el ensayo. Usar pipetas y puntas distintas para el conjugado y el sustrato. VALORES ESPERADOS Una buena práctica de laboratorio dicta que cada laboratorio establezca su propio rango de valores. Los siguientes resultados pueden servir de guía hasta que el laboratorio haya reunido suficientes datos por su cuenta. Los niveles en ayunas de 136 individuos estudiados, aparentemente sanos, dieron una media de 742 pmol/l (2.2 μg/l), una mediana de 628 pmol/l (1.9 μg/l) y un rango, correspondiente al 95% central de las observaciones, de pmol/l ( μg/l). 8

9 CARACTERÍSTICAS DEL RENDIMIENTO Límite de detección El límite de detección se define como la capacidad de detección de acuerdo con ISO11843-Part 1. La capacidad de detección deberá considerarse un método de validación y no la concentración más baja medible. El límite de detección es 2.5 pmol/l ( µg/l), como se indica en la metodología descrita en ISO11843-Part 4. No se necesitará calcular la concentración de las muestras con una absorbancia inferior a la del Calibrator 1. En su lugar, se expresarán con una concentración inferior o igual a ( ) la concentración indicada en el vial del Calibrator 1. Recuperación Suero: La recuperación tras la incorporación es del % (103% de media). La recuperación tras la dilución es del % (111% de media). Efecto gancho Las muestras con una concentración superior a 36 nmol/l pueden medirse sin obtener resultados falsamente bajos. Precisión: Cada muestra se analizó en 4 replicados en 14 ocasiones diferentes. Coeficiente de variación Muestra Valor medio pmol/l intraensayo % interensayo % total ensayo % Especificidad La proinsulina en una concentración de 105 pmol/l dio un resultado de 5 pmol/l. Para los otros péptidos, se han hallado las siguientes reacciones cruzadas: Insulina < % Proinsulina 5% Proinsulina des (31 32) 3% Proinsulina split (32 33) 2% Proinsulina des (64 65) 74% Proinsulina split (65 66) 10% 9

10 CALIBRACIÓN El Mercodia Ultrasensitive C-peptide ELISA kit se calibra contra el reactivo de International Reference Reagent for C-peptide, IRR C-peptide 84/510. FACTOR DE CONVERSIÓN 1 μg/l corresponde a 331 pmol/l. GARANTÍA Los datos de rendimiento presentados aquí se obtuvieron usando el procedimiento indicado. Cualquier cambio o modificación en el procedimiento, no recomendado por Mercodia AB, puede afectar los resultados, en cuyo caso Mercodia AB declina cualquier responsabilidad y garantía acordada, implícita o explícita, incluso la garantía implícita sobre la comerciabilidad e idoneidad para su uso. Mercodia AB y sus distribuidores autorizados, en tal caso, no asumirán responsabilidades por daños y perjuicios indirectos o consiguientes. REFERENCIAS Craig ME, Howard NJ, Silink M, Rawlinson WD (2003) Reduced frequency of HLA DRB1*03- DQB1*02 in children with type 1 diabetes associated with enterovirus RNA. J Infect Dis 187: Gaines-Das RE and Bristow AF (1988) WHO International reference reagents for human proinsulin and human C-peptide. J Biol Stand 16: En nuestra web podrá encontrar más referencias: 10

11 HOJA DE RESUMEN DEL PROTOCOLO Mercodia Ultrasensitive C-peptide ELISA Añadir Calibrators, controles* y muestras Añadir Assay Buffer Incubar Lave la placa con la solución de wash buffer 1X Añadir solución de la enzyme conjugate 1X Incubar Lave la placa con la solución de wash buffer 1X Añadir Substrate TMB Incubar Añadir Stop Solution Medir A μl 50 μl 1 hora a C en un agitador de placas, rpm 700 µl, 6 veces 200 μl 1 hora a C en un agitador de placas, rpm 700 µl, 6 veces 200 μl 30 min a C 50 μl Agitar durante 5 segundos para asegurar el mezclado Valore los resultados *No suministrado Ver página 6 para detalles Version 10.0

Mercodia Proinsulin ELISA

Mercodia Proinsulin ELISA Mercodia Proinsulin ELISA Instrucciones para el uso 10-1118-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

Mercodia Iso-Insulin ELISA

Mercodia Iso-Insulin ELISA Mercodia Iso-Insulin ELISA Instrucciones para el uso 10-1128-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

Mercodia Ultrasensitive Insulin ELISA

Mercodia Ultrasensitive Insulin ELISA Mercodia Ultrasensitive Insulin ELISA Instrucciones para el uso 10-1132-01 REACTIVOS PARA 96 DETERMINACIONES Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN DE LOS SÍMBOLOS

Más detalles

10-1176-01 REACTIVOS PARA 96 ANÁLISIS

10-1176-01 REACTIVOS PARA 96 ANÁLISIS Mercodia MPO ELISA Instrucciones de uso 10-1176-01 REACTIVOS PARA 96 ANÁLISIS Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala Suecia EXPLICACIÓN DE LOS SÍMBOLOS EMPLEADOS EN LAS ETIQUETAS

Más detalles

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas.

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. C-peptide N de código K6220 Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. Este kit contiene reactivos para 96 pocillos de prueba. (111838-002) K6220/ES/CKJ/2009.06.17

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

ELISA PeliClass human IgG subclass kit REF M1551

ELISA PeliClass human IgG subclass kit REF M1551 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: +.0.5.599 Fax: +.0.5.570 Email: reagents@sanquin.nl Website: www.sanquinreagents.com M55/ November 007 ELISA PeliClass human IgG subclass

Más detalles

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00 Quantikine IVD ELISA Inmunoensayo Epo Humano Manual de Instrucciones suplementario Referencia DEP00 Este manual de instrucciones incluye el protocolo del ensayo y debe leerse en su totalidad antes de comenzar

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA.

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. El estudio INMA lleva asociado la toma de una serie de muestras biológicas según el momento o fase del estudio. Coincidiendo con el parto se recoge una muestra

Más detalles

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente.

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente. bioelisa HCV 4.0 3000-1115 LEER CAMBIOS SOMBREADOS 96 tests 3000-1116 480 tests Test de ELISA para la detección de anticuerpos contra el virus de la hepatitis C (HCV) en suero o plasma humano para ser

Más detalles

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA)

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Mercodia Oxidized LDL ELISA

Mercodia Oxidized LDL ELISA Mercodia Oxidized LDL ELISA Instrucciones para el uso 10-1143-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia AB, Sylveniusgatan

Más detalles

RIDASCREEN. Leishmania Ab. Art. n.: K7121

RIDASCREEN. Leishmania Ab. Art. n.: K7121 RIDASCREEN Leishmania Ab Art. n.: K7121 R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Telf.: +49 (0) 6151 8102-0 / Fax: +49 (0) 6151 8102-20 1. Área de aplicación Para el diagnóstico

Más detalles

Detección de IgE específica.

Detección de IgE específica. Detección de IgE específica. Una forma de identificar los alérgenos responsables de los síntomas alérgicos es la detección de anticuerpos IgE específicos frente a dichos alérgenos. Estos anticuerpos están

Más detalles

ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA

ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Página 1 de 9 ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Elaborado por: CNSP Blgo. Manuel Céspedes Zambrano Revisado por: CNSP TM. Julia I. Espinoza Soto CNSP MV Gladys Malásquez Mendoza Aprobado por: RD

Más detalles

CARDIOCHEK y CARDIOCHEK P.A

CARDIOCHEK y CARDIOCHEK P.A CARDIOCHEK y CARDIOCHEK P.A NUEVA GENERACIÓN DE ANALIZADORES PORTÁTILES Introducción El Cardiochek y Cardiochek P.A son instrumentos portátiles que proporcionan medidas rápidas y precisas de múltiples

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

DETERMINACIÓN COLORIMÉTRICA DEL HIERRO

DETERMINACIÓN COLORIMÉTRICA DEL HIERRO DETERMINACIÓN COLORIMÉTRICA DEL HIERRO OBJETIVO Familiarizarse con los principios del análisis colorimétrico. INTRODUCCIÓN La base para lo que los químicos llaman análisis colorimétrico es la variación

Más detalles

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS Ref. 4755 2014/04 CALIBRADORES Hb A1c CAPILAR Aplicación Los Calibradores Hb A1c CAPILAR están destinados a la calibración y al control de migración

Más detalles

Murex anti-hbc (total)

Murex anti-hbc (total) es 8G21-01/-02 GE65/66 Primera edición 10/2009 Murex anti-hbc (total) Enzimoinmunoanálisis para la detección de anticuerpos frente al antígeno core del virus de la hepatitis B (anti-hbc) en suero o plasma

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE

MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE CAPÍTULO 8 MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE Fuente: National Geographic - Noviembre 2000 INTRODUCCIÓN La medición de los contaminantes sirve para varias funciones tales como: Provee un criterio

Más detalles

PRINCIPIO DE LA PRUEBA: USO PREVISTO:

PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar.

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar. bioelisa HIV-1+2 (rec) 3000-1143 LEER CAMBIOS SOMBREADOS 96 tests 3000-1144 480 tests Test de ELISA para la detección de anticuerpos contra HIV-1 y HIV-2 en suero o plasma humano. Sumario Como es conocido

Más detalles

J. Muestras 2015-871 - 2015-875 Proficiencia para Contaje de Espermatozoides.

J. Muestras 2015-871 - 2015-875 Proficiencia para Contaje de Espermatozoides. 5 de octubre de 2015 Laboratorios Participantes Laboratorios de Salud Pública De Puerto Rico Laboratorios de Salud Pública De Puerto Rico Laboratorios de Salud Pública de P.R. INSTRUCCIONES PARA LA PROFICIENCIA

Más detalles

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D-20354 Hamburg DISTRIBUIDOR medac Gesellschaft für klinische

Más detalles

Programa PADNAAS. Programa de Ayuda para la Determinación de Niveles de Actividad de las Asparaginasa. Índice

Programa PADNAAS. Programa de Ayuda para la Determinación de Niveles de Actividad de las Asparaginasa. Índice Programa PADNAAS Programa de Ayuda para la Determinación de Niveles de Actividad de las Asparaginasa Índice 1 Manual de preparación del las muestras y envíos 2 Hoja de información de la muestra. La participación

Más detalles

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles

ANÁLISIS DE ELEMENTOS TRAZA EN ESPECÍMENES BIOLÓGICOS: Objetivo. Metodología

ANÁLISIS DE ELEMENTOS TRAZA EN ESPECÍMENES BIOLÓGICOS: Objetivo. Metodología FTTM07 Rev-1, 09/06/20119 INSTITUTO DE TOXICOLOGÍA DE LA DEFENSA Hospital Central de la Defensa. Glorieta del Ejército s/n. 28047 MADRID. Tel.: 914222625. Fax: 914222624 E- mails : jlopcol@oc.mde.es //mllobal@oc.mde.es//

Más detalles

PROCEDIMIENTO PARA APLICACIÓN DE LAS PRUEBAS

PROCEDIMIENTO PARA APLICACIÓN DE LAS PRUEBAS 1 de 9 TABLA DE CONTENIDO 1. Objetivo. 2. Alcance. 3. Referencias. 4. Definiciones. 5. Responsabilidades. 6. Descripción 7. Registros 8. Anexos 9. Control de Cambios. 2 de 9 1. OBJETIVO Establecer el procedimiento

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

Control de balanza analítica. Medida de masa

Control de balanza analítica. Medida de masa Control de balanza analítica Medida de masa Objetivo Identificar aspectos críticos y fundamentales en uso adecuado de las balanzas analíticas. Establecer una metodología practica para desarrollar un cronograma

Más detalles

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano.

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. 96 PRUEBAS USO El equipo de Prolactina CLIA se destina para

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La medición de nitratos en aguas residuales se hace en mg/l. El método es conocido usualmente con el nombre de Reducción de Cadmio, que es donde los iones de nitrito reaccionan

Más detalles

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis.

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis. Laboratorio de Métodos Instrumentales I Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis Equipo 1 Candy Lara Rentería Jessica Torres Gámez Salón 1 Mérida, Yucatán

Más detalles

Cuantificación de Clorofila a

Cuantificación de Clorofila a Cuantificación de Clorofila a Clorofilas Las clorofilas son una familia de pigmentos de color verde que se encuentran en las cianobacterias y en todos aquellos organismos que contienen cloroplastos en

Más detalles

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios:

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios: En muchos países, entre ellos Australia, Canadá, la Unión Europea, Corea, Japón, Nueva Zelanda, EEUU, existen leyes y sistemas de control para regular el etiquetado relativo a alergenos alimentarios. Las

Más detalles

Procesado de muestras en el laboratorio de la clínica (I)

Procesado de muestras en el laboratorio de la clínica (I) 12.prevención de la salud Procesado de muestras en el laboratorio de la clínica (I) A lo largo de esta primera parte veremos como realizar un manejo correcto de las muestras de sangre, orina y líquidos

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN 25. Perfil lipídico Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 1 Departamento de Bioquímica y Biología Molecular, Avda. Menéndez Pidal s/n, 14071- Córdoba, 2 Campus de Rabanales, Edif. Severo Ochoa 14071-Córdoba

Más detalles

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD Artículo 1. Este Reglamento es complementario del Reglamento de Higiene y Seguridad de la Facultad de Química de la

Más detalles

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica PRUEBA DE VIH Universidad de Panamá USAID Proyecto Capacity Centroamérica Es la prueba de detección que produce los resultados rápidamente, en aproximadamente 20 minutos y utiliza sangre de una vena o

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

GUIA DE PRACTICAS CORRECTAS DE HIGIENE PARA EL SECTOR APICOLA (Libro de gestión)

GUIA DE PRACTICAS CORRECTAS DE HIGIENE PARA EL SECTOR APICOLA (Libro de gestión) asociación MALAGUEÑA de apicultores www.mieldemalaga.com CRISTINA RUIZ MARTIN - Veterinaria - Asociación Malagueña de Apicultores Colmenar (Málaga) - Tel.: 952 71 80 30 www.mieldemalaga.com Email: mieldemalaga@mieldemalaga.com

Más detalles

DENV Detect TM IgM CAPTURE ELISA

DENV Detect TM IgM CAPTURE ELISA Detect TM IgM CAPTURE ELISA USO PREVISTO La prueba Detect IgM Capture ELISA está diseñada para la detección cualitativa de anticuerpos IgM contra antígenos recombinantes DEN (DENRA) en suero para diagnóstico

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

MANTENIMIENTO PREVENTIVO DEL EQUIPAMIENTO

MANTENIMIENTO PREVENTIVO DEL EQUIPAMIENTO MANTENIMIENTO PREVENTIVO DEL EQUIPAMIENTO CHRISTIAN MALICKI LICENCIADO ELECTRONICO TECNICO ELECTROMECANICO MATRICULA PROFESIONAL. : 11882 christian@eficap.com.ar Servicio Técnico Integral de Electromedicina

Más detalles

SC5b-9 Plus RESUMEN Y EXPLICACIÓN

SC5b-9 Plus RESUMEN Y EXPLICACIÓN SC5b-9 Plus Enzimoinmunoensayo para la cuantificación del complejo SC5b-9 presente en plasma o suero humanos MicroVue SC5b-9 Plus EIA Preparación del Reactivo y de la Muestra Diluya el Concentrado de Solución

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 REF/ PROYECTO: PROMIS 2012 NÚMERO DE LOTES: UNICO Este pliego contempla la adquisición de un sistema

Más detalles

MR-12 Agitador de balanceo

MR-12 Agitador de balanceo MR-12 Agitador de balanceo Manual de funcionamiento Certificado para la versión V.2AW Contenidos 1. Precauciones de seguridad 2. Información general 3. Cómo empezar 4. Funcionamiento 5. Especificaciones

Más detalles

UNIVERSIDAD COLEGIO MAYOR DE CUNDINAMARCA 65 Años COMUNICADO 01 RESPUESTA A OBSERVACIONES. INVITACIÓN A COTIZAR No.046 2010

UNIVERSIDAD COLEGIO MAYOR DE CUNDINAMARCA 65 Años COMUNICADO 01 RESPUESTA A OBSERVACIONES. INVITACIÓN A COTIZAR No.046 2010 COMUNICADO 01 RESPUESTA A OBSERVACIONES INVITACIÓN A COTIZAR No.046 2010 ADQUISICION DE EQUIPOS E IMPLEMENTOS DE LABORATORIO CON DESTINO AL PROGRAMA DE BACTERIOLOGIA CASA COMERCIAL QUIMICA MG LTDA Item

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles

Analizador portátil til CD4. Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos

Analizador portátil til CD4. Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos Analizador portátil til CD4 Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos Qué es PIMA? Es la primer solución point-of-care para el análisis de CD4. Diseñado para desempeñarse

Más detalles

MMP. MÉTODOS DE MUESTREO Y PRUEBA DE MATERIALES

MMP. MÉTODOS DE MUESTREO Y PRUEBA DE MATERIALES LIBRO: PARTE: TÍTULO: CAPÍTULO: MMP. MÉTODOS DE MUESTREO Y PRUEBA DE MATERIALES 5. MATERIALES PARA SEÑALAMIENTO Y DISPOSITIVOS DE SEGURIDAD 01. Pinturas para Señalamiento 003. Contenido de Pigmento en

Más detalles

CATÁLOGO ROCHE EQUIPOS 2013, AKRALAB

CATÁLOGO ROCHE EQUIPOS 2013, AKRALAB CATÁLOGO ROCHE EQUIPOS 2013, AKRALAB Pulsar Aquí 1.- ANALIZADORES DE ORINA / SISTEMAS DE URIANÁLISIS - URISYS 1100 - COBAS u411 ( URISYS 1800 ) - URISYS 2400 2.- ANALIZADORES DE QUÍMICA CLÍNICA - COBAS

Más detalles

Laboratorio Nº 4 Tema: INTERRELACIONES METABÓLICAS

Laboratorio Nº 4 Tema: INTERRELACIONES METABÓLICAS Laboratorio Nº 4 Tema: INTERRELACIONES METABÓLICAS Contenidos conceptuales: Integración del metabolismo de hidratos de carbonos, lípidos y proteínas. Interrelación de diferentes tejidos y órganos. La glucosa

Más detalles

NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA

NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA Este laboratorio será acreditado en conjunto con el Laboratorio de Embriología cuando aquel funciones dentro del Centro. Cuando el laboratorio

Más detalles

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

RepublicofEcuador EDICTOFGOVERNMENT±

RepublicofEcuador EDICTOFGOVERNMENT± RepublicofEcuador EDICTOFGOVERNMENT± Inordertopromotepubliceducationandpublicsafety,equaljusticeforal, abeterinformedcitizenry,theruleoflaw,worldtradeandworldpeace, thislegaldocumentisherebymadeavailableonanoncommercialbasis,asit

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

GUIA PARA LA ELABORACION DE ESTUDIOS DE ESTABILIDAD DE PRODUCTOS FARMACÉUTICOS VETERINARIOS. CAMEVET 2012

GUIA PARA LA ELABORACION DE ESTUDIOS DE ESTABILIDAD DE PRODUCTOS FARMACÉUTICOS VETERINARIOS. CAMEVET 2012 GUIA PARA LA ELABORACION DE ESTUDIOS DE ESTABILIDAD DE PRODUCTOS FARMACÉUTICOS VETERINARIOS. CAMEVET 2012 GUIA PARA LA ELABORACION DE ESTUDIOS DE ESTABILIDAD DE PRODUCTOS FARMACÉUTICOS VETERINARIOS 1.

Más detalles

Plan de Mantenimiento Preventivo de Aparatos y Equipos. Loles Franco Jose Manuel Cebrián

Plan de Mantenimiento Preventivo de Aparatos y Equipos. Loles Franco Jose Manuel Cebrián Plan de Mantenimiento Preventivo de Aparatos y Equipos Loles Franco Jose Manuel Cebrián 1 1. Conceptos generales: Mantenimiento, Verificación y Calibración 2. Por qué se requiere el control de los equipos?

Más detalles

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos Objetivos del Entrenamiento Una vez finalizado este capítulo, usted podrá: Definir inmunoensayo Describir la

Más detalles

1. IDENTIFICACIÓN DEL PREPARADO Y DE LA SOCIEDAD O EMPRESA

1. IDENTIFICACIÓN DEL PREPARADO Y DE LA SOCIEDAD O EMPRESA 1. IDENTIFICACIÓN DEL PREPARADO Y DE LA SOCIEDAD O EMPRESA 1.1 Identificación de la sustancia o el preparado Nombre comercial del producto: Aspecto: Líquido de color marrón 1.2 Uso de la sustancia/preparado

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

DEPARTAMENTO DE MEDICINA INTERNA HOSPITAL DE EXPLORACIÓN COLEGIO UNIVERSITARIO YONSEI DE MEDICINA 1- Test: Efectos de bloqueo por el filtro nasal Nosk, en la penetración de alérgenos. 2- Resumen: Certificamos

Más detalles

PTH RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN

PTH RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN PTH Un inmunoensayo enzimático para la determinación cuantitativa de la PTH (hormona paratiroidea) intacta en el suero humano RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN El kit de inmunoensayo enzimático de

Más detalles

MANEJO DE REACTIVOS Y MEDICIONES DE MASA Y VOLUMEN

MANEJO DE REACTIVOS Y MEDICIONES DE MASA Y VOLUMEN Actividad Experimental 1 MANEJO DE REACTIVOS Y MEDICIONES DE MASA Y VOLUMEN Investigación previa 1. Investiga los siguientes aspectos de una balanza granataria y de una balanza digital: a. Características

Más detalles

Manual de instrucciones Balanza portátil

Manual de instrucciones Balanza portátil Manual de instrucciones Balanza portátil E Manual de instrucciones Balanza portátil Índice 1 Datos técnicos... 3 2 Descripción del aparato... 4 2.1 Descripción del teclado... 5 3 Indicaciones básicas (informaciones

Más detalles

RECOMENDACIONES PARA EL TRANSPORTE DE SUSTANCIAS BIOLÓGICAS AL LABORATORIO DE REFERENCIA DE SALUD PÚBLICA DE ANDALUCÍA PARA VIRUS

RECOMENDACIONES PARA EL TRANSPORTE DE SUSTANCIAS BIOLÓGICAS AL LABORATORIO DE REFERENCIA DE SALUD PÚBLICA DE ANDALUCÍA PARA VIRUS RECOMENDACIONES PARA EL TRANSPORTE DE SUSTANCIAS BIOLÓGICAS AL LABORATORIO DE REFERENCIA DE SALUD PÚBLICA DE ANDALUCÍA PARA VIRUS NORMATIVA: Acuerdo europeo relativo al transporte internacional de mercancías

Más detalles

4.2. Limpieza del material de laboratorio.

4.2. Limpieza del material de laboratorio. Química 4 Tema 4. Material de laboratorio 4.1. Material de uso frecuente en el laboratorio. 4.2. Limpieza del material de laboratorio. Clasificación: i) según su función ii) según el material de que está

Más detalles

SELECCIÓN POSITIVA DE CÉLULAS CD34+

SELECCIÓN POSITIVA DE CÉLULAS CD34+ Página 1 de 8 PROPÓSITO U OBJETO Definir los procedimientos para la selección positiva de células de acuerdo con los estándares de la Unidad de Trasplante de Progenitores Hematopoyéticos (UTPH) del Hospital

Más detalles

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68 APÉNDICE Apéndice 1. Espectrofotómetro (Users Manual 2100 Series Spectrophotometer) 68 El espectrofotómetro de la marca UNICO serie 2100 UV posee un rango de longitud de onda de 200-1000 nm. La técnica

Más detalles

KefaRid Airless no es adecuado para superficies de madera sin pintar.

KefaRid Airless no es adecuado para superficies de madera sin pintar. KefaRid Airless DESCRIPCIÓN EJEMPLOS DE USO KefaRid Airless es un recubrimiento técnico de base acuosa que contiene microporos, los cuales eliminan la humedad y mantienen la superficie seca. BioRid es

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La prueba de Demanda Química de Oxígeno (DQO) se basa en la oxidación química de la materia orgánica e inorgánica, presente en las muestras de agua, con dicromato de potasio

Más detalles

Prospecto de QuantiFERON -CMV ELISA 2 96

Prospecto de QuantiFERON -CMV ELISA 2 96 Prospecto de QuantiFERON -CMV ELISA 2 96 Prueba de IFN-γ en sangre total para medir las respuestas a los antígenos peptídicos del citomegalovirus humano Para uso de diagnóstico in vitro 0350-0201 Cellestis,

Más detalles

LABORATORIO: MICROBIOLOGÍA BIOQUÍMICA Y HEMATOLOGÍA.

LABORATORIO: MICROBIOLOGÍA BIOQUÍMICA Y HEMATOLOGÍA. LABORATORIO: MICROBIOLOGÍA BIOQUÍMICA Y HEMATOLOGÍA. CS Illes Columbretes Página 1 En el laboratorio de microbiología se realizan investigaciones microbiológicas (diagnóstico bacteriológico, micológico,

Más detalles

5 Materiales y Métodos

5 Materiales y Métodos 5 Materiales y Métodos Los tejidos de Cenchurs ciliaris utilizados en esta investigación fueron obtenidos por pretratamiento con H 2 SO 4 al 0.15 M, a 135ºC, para eliminar la hemicelulosa. Con los tejidos

Más detalles

Mezclado y Combinado. Molienda y Pulverizado. Tejido Homogeneización Lisis de la Célula. Agitación Vertical Única

Mezclado y Combinado. Molienda y Pulverizado. Tejido Homogeneización Lisis de la Célula. Agitación Vertical Única Mezclado y Combinado Molienda y Pulverizado Tejido Homogeneización Lisis de la Célula Agitación Vertical Única Manipulación de Múltiples muestras desde 96 pocillos hasta tubos para centrífuga de 50 ml

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT SensPERT Canine Parvovirus Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000

DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000 DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000 Este Modo Operativo está basado en la Norma ASTM C 289, la misma que se ha adaptado al nivel de implementación y a las

Más detalles

PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA

PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA OBJETIVOS En esta práctica se tratarán aspectos de interés relacionados con la instrumentación básica utilizada en química, haciendo especial hincapié en la

Más detalles

Analizador de Carbono Orgánico Total Fusion TOC

Analizador de Carbono Orgánico Total Fusion TOC Analizador de Carbono Orgánico Total Fusion TOC Resultados sin precedentes El analizador Fusión de carbono orgánico total (TOC) analizador por oxidación con persulfato y radiación UV permitiendo la liberación

Más detalles

Guía de Preparación de Muestras para PLASTICOS para el Software de Formulación de Datacolor

Guía de Preparación de Muestras para PLASTICOS para el Software de Formulación de Datacolor Guía de Preparación de Muestras para PLASTICOS para el Software de Formulación de Datacolor 1. Generalidades 2. Qué se necesita para comenzar? 3. Qué hacer para sistemas opacos y translúcidos? 4. Qué hacer

Más detalles

DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA:

DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: EQUIPO AUTOMÁTICO PARA LA DETECCIÓN DE PATÓGENOS minividas-vidas DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: Sistema automático de inmunodetección rápida de patógenos basado en la técnica ELFA (Enzyme

Más detalles

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua destilada utilizando Dióxido de Titanio dopado con Nitrógeno,

Más detalles

Calf Notes.com. Notas Acerca de Terneros #39 - Usando el refractómetro

Calf Notes.com. Notas Acerca de Terneros #39 - Usando el refractómetro Calf Notes.com Notas Acerca de Terneros #39 - Usando el refractómetro Introducción. El medir el grado de transferencia de inmunidad pasiva a los terneros recién nacidos puede decirle mucho acerca del nivel

Más detalles