Mercodia Ultrasensitive C-peptide ELISA

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Mercodia Ultrasensitive C-peptide ELISA"

Transcripción

1 Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia AB, Sylveniusgatan 8A, SE Uppsala, Suecia

2 EXPLICACIÓN DE LOS SÍMBOLOS UTILIZADOS EN LAS ETIQUETAS = 96 Reactivos para 96 determinaciones Fecha de caducidad Conservar a entre 2 8 C Nº lote Para uso diagnóstico in vitro Mercodia

3 UTILIZACIÓN PREVISTA Mercodia Ultrasensitive C-peptide ELISA es un método para la determinación cuantitativa de humana péptido C en suero, plasma o orina. RESUMEN Y EXPLICACIÓN DE LA PRUEBA La evaluación cualitativa y cuantitativa de la función de las células ß pancreáticas se realiza no sólo para el estudio pre- y postdiagnóstico de la historia natural de la diabetes mellitus, sino que también es importante en la práctica clínica como guía para escoger el tratamiento correcto. Los niveles de insulina periférica no pueden utilizarse para evaluar la función de las células ß debido a la amplia y variable captación desde la circulación portal hacia el hígado, y debido a que los ensayos de insulina no diferencian entre insulina endógena y exógena. En la célula ß pancreática, la proinsulina se divide en una molécula de péptido C y una molécula de insulina. El péptido C posteriormente pasa a la circulación a concentraciones equimolares a las de insulina. A diferencia de la insulina, el péptido C es extraído sólo mínimamente por el hígado. Las concentraciones de péptido C periférico reflejan, por tanto, la secreción de las células ß de forma más precisa que la insulina. PRINCIPIO DEL PROCEDIMIENTO Mercodia Ultrasensitive C-peptide ELISA es un inmunoensayo de fase sólida de dos puntos. Se basa en la técnica de sandwich directo según la que dos anticuerpos monoclonales se dirigen contra determinantes antigénicos separados de la molécula de insulina. Durante la incubación, el péptido C de la muestra reacciona con los anticuerpos anti-péptido C unidos a al pocillo de microtitulación. Después una limpieza simple, se agrega anticuerpos anti-c-peptide conjugados en peroxidasa y se lo deja incubar una segunda vez. Un paso de limpieza simple elimina el anticuerpo etiquetado de enzima sin ligar. El conjugado ligado se detecta por reacción con 3,3,5,5 -tetrametilbencidina (TMB). La reacción se para añadiendo ácido para dar un punto final colorimétrico que se lee por espectrofotometría. ADVERTENCIAS Y PRECAUCIONES Para uso diagnóstico in vitro. El contenido de este kit y sus residuos no deben dejarse entrar en contacto con animales rumiantes o cerdos. La Stop Solution de este kit contiene 0.5M H 2 SO 4. Seguir las precauciones rutinarias para el manejo de productos químicos peligrosos. Las muestras deben manipularse como si fueran capaces de transmitir infecciones. Cada pocillo sólo puede ser usado una vez. MATERIAL REQUERIDO PERO NO SUMINISTRADO Pipetas de volumen adecuado (para añadir la solución de la Assay Buffer, solución de la enzyme conjugate 1X, Substrate TMB y Stop Solution se prefieren las pipetas de repetición) Tubos, Cubetas y probetas para preparar los reactivos 3

4 Agua bidestilada Agitador magnético Mezclador de vórtice Lector de microplacas (filtro de 450 nm) Agitador de placas ( vueltas por minuto, movimimento orbital) Aparato para lavador de microplaca con función de sobre-flujo de lavado (recomendado pero no obligatorio) REACTIVOS Cada kit de Mercodia Ultrasensitive C-peptide ELISA ( ) contiene reactivos para 96 pocillos, suficientes para 42 muestra y una curva de calibración por duplicado. Para series de ensayos más amplias, mezclar reactivos de paquetes de número de lote idéntico. La fecha de caducidad del kit completo está en el exterior identificada en una etiqueta. La temperatura de conservación recomendada es 2 8ºC. Coated Plate 1 placa 96 pocillos Listo para usar Anticuerpo monoclonal de ratón anti-c-peptide 8 tiras de pocillos Para cintas de microtitración sin utilizar, cerrar la bolsa con cinta adhesiva y conservar a 2 8 C durante 2 mes. Calibrators 1, 2, 3, 4, 5 5 viales 1000 μl Liofilizado humanos del C-peptide Añadir 1000 μl Codificado en amarillo de agua bidestilada Concentratión declaró la etiqueta del vial. por vial Almacenaje después de la reconstitución: 2-8 C durante 1 semana. Para el almacenaje de Calibrators reconstituidos durante más de 1 semana, conservar a 20 C. Calibrator 0 1 vial 5 ml Listo para usar Codificado en amarillo Assay Buffer 1 vial 6 ml Listo para usar Codificado en rojo Enzyme Conjugate 21X 1 vial 1.2 ml Preparación, Monoclonal de ratón Enzyme Conjugate ver abajo con peroxidasa anti-c-peptide Enzyme Conjugate Buffer 1 vial 24 ml Listo para usar Codificado en azul Wash Buffer 21X 1 botella 50 ml Diluir con 1000 ml Almacenaje después de diluir: agua bidestilada 2-8 C durante 2 mes para preparar la solución de wash buffer 1X Substrate TMB 1 botella 22 ml Listo para usar Solución incolora Atención! Es sensible a la luz! Stop Solution 1 vial 7 ml Listo para usar 0.5 M H 2 SO 4 4

5 Preparación de solución de la enzyme conjugate 1X Preparar el volumen necesario de solución de la enzyme conjugate 1X por dilución del Enzyme Conjugate 21X (1+20) en Enzyme Conjugate Buffer según la siguiente tabla. Si se usa toda la placa, verter completamente el tampón Emzyme Conjugate Buffer al vial Enzyme Conjugate 21X. Mezclar suavemente. Utilizar en un dia. Número de tiras 12 tiras 8 tiras 4 tiras Enzyme Conjugate 21X 1 vial 700 μl 350 μl Enzyme Conjugate Buffer 1 vial 14 ml 7 ml OBTENCIÓN Y MANIPULACIÓN DE MUESTRAS Suero Recoger la sangre por venipunción, dejar coagular y separar el suero por centrifugación. Las muestras pueden conservarse a 2 8 C hasta 3 días. Para periodos más largos, conservar las muestras a 20 C. Evitar la congelación y descongelación de forma repetida. Plasma Recoger la sangre por venipunción en tubos que contienen heparina o EDTA como anticoagulante y separar la fracción de plasma por centrifugación. Las muestras pueden conservarse a 2 8 C hasta 3 días. Para periodos más largos, conservar las muestras a 20 C. Evitar la congelación y descongelación de forma repetida. Orina Recoger orina de 24 horas (sin conservantes). Guardar la muestra a 2 8 C entre recogidas. Registrar el volumen total de muestra y guardar una alícuota bien mezclada para análisis. Conservar las muestras a 2 8 C durante un máximo de 24 horas antes del ensayo. Para una conservación más larga, congelar las muestras de orina a 70 C hasta que se realice el ensayo. Deben evitarse las congelaciones y descongelaciones repetidas. Los restos celulares deben eliminarse antes del ensayo, por filtración o centrifugación. Preparación de las muestras Diluir las muestras de orina 1/10 v/v en Calibrator 0 antes del ensayo. Sin dilución se normaly necesarios para las muestras de suero y plasma; sin embargo, muestras con una concentración superior a Calibrator 5 deben diluirse en Calibrator 0. 5

6 PROCEDIMIENTO DE EVALUACIÓN Todos los reactivos y muestras deben estar a temperatura ambiente antes de su uso. Preparar una curva calibración para cada ensayo. 1. Preparar solución de la enzyme conjugate 1X y solución de wash buffer 1X. 2. Preparar suficientes pocillos de microplaca para los Calibrators, controles y muestras por duplicado. 3. Pipetear 50 μl de cada Calibrator, controles y muestra en los pocillos correspondientes. 4. Añadir 50 μl de Assay Buffer a cada pocillo. 5. Incubar en un agitador de placas ( rpm) durante 1 hora a temperatura ambiente (18 25 C). 6. Lavar 6 veces con 700 μl solución de wash buffer 1X por pocillo mediante Lavador de placas automático con función de sobre-flujo de lavado. Después del lavado final, invertir la placa y golpearla firmemente contra papel absorbente. No usar el paso de remojo durante el proceso. O manualmente: Verter el líquido invirtiendo la microplaca en una pila. Añadir 350 μl de solución de wash buffer 1X, golpeando firmemente la placa contra papel absorbente para eliminar todo el líquido en exceso. Repetir 5 veces. Evitar remojo prolongado durante el proceso. 7. Añadir 200 μl solución de la enzyme conjugate 1X a cada pocillo. 8. Incubar en un agitador de placas ( rpm) durante 1 hora a temperatura ambiente (18 25 C). 9. Lavar como se describe en Añadir 200 μl de Substrate TMB. 11. Incubar durante 30 minutos en el banco a temperatura ambiente (18 25 C). 12. Añadir 50 μl de Stop Solution de parada a cada pocillo. Colocar la placa en un agitador durante aproximadamente 5 segundos para asegurar el mezclado. 13. Leer la densidad óptica a 450 nm y calcular los resultados. Leer en 30 minutos. Aviso: Usar pipetas distintas para prevenir contaminación entre conjugado y sustrato. 6

7 CONTROL DE CALIDAD INTERNA Los controles comerciales y/o mezclas de sueros internas con concentraciones de c-peptide bajas, medias y altas, se analizarán de forma rutinaria como muestras y los resultados se representarán día a día. Es una buena práctica de laboratorio registrar los siguientes datos en cada ensayo: número de lote del kit, fechas de preparado de los componentes del kit, valores de DO de blanco, Calibrators y controles. Los laboratorios deben seguir las normativas gubernamentales o requisitos de Acreditación para el control de calidad periódico. CÁLCULO DE RESULTADOS Cálculo computarizado Para obtener la concentración de péptido C realize la reducción de datos computarizados del a absorbancia para los Calibrators, sin Calibrator 0, frente a la concentración utilizando una regresión spline cúbica. Cálculo manual 1. Representar gráficamente los valores de absorbancia obtenidos para los Calibrators, sin Calibrator 0, frente a la concentración de péptido C en papel log-log y construir una curva de calibración. 2. Leer la concentración de las muestras a partir de la curva de calibración. Ejemplo de resultados Pocillos Identidad A 450 Conc. media pmol/l 1A B 1C D 1E F 1G H 2A B 2C D 2E F 2G H 3A B Calibrator 0 Calibrator 1* Calibrator 2* Calibrator 3* Calibrator 4* Calibrator 5* Muestra 1 Muestra 2 Muestra 3 *Concentratión declaró la etiqueta del vial 0.074/ / / / / / / / /

8 Ejemplo de curva de calibración Aquí se presenta una curva de calibración típica. Esta curva no debe utilizarse para verificar resultados de un ensayo ,0 O.D. O.D: 450 nm 1.0 1, , C- pep/de (pmol/l) C-peptide (pmol/l) LÍMITES DEL PROCEDIMIENTO Igual que todas las pruebas diagnósticas, un diagnóstico clínico definitivo no debe estar basado únicamente en los resultados de una sola prueba, sino que el médico debe hacerlo sólo después de haber evaluado todos los datos clínicos. Las muestras lipémicas, ictéricas o hemolizadas no interfieren en el ensayo. Usar pipetas y puntas distintas para el conjugado y el sustrato. VALORES ESPERADOS Una buena práctica de laboratorio dicta que cada laboratorio establezca su propio rango de valores. Los siguientes resultados pueden servir de guía hasta que el laboratorio haya reunido suficientes datos por su cuenta. Los niveles en ayunas de 136 individuos estudiados, aparentemente sanos, dieron una media de 742 pmol/l (2.2 μg/l), una mediana de 628 pmol/l (1.9 μg/l) y un rango, correspondiente al 95% central de las observaciones, de pmol/l ( μg/l). 8

9 CARACTERÍSTICAS DEL RENDIMIENTO Límite de detección El límite de detección se define como la capacidad de detección de acuerdo con ISO11843-Part 1. La capacidad de detección deberá considerarse un método de validación y no la concentración más baja medible. El límite de detección es 2.5 pmol/l ( µg/l), como se indica en la metodología descrita en ISO11843-Part 4. No se necesitará calcular la concentración de las muestras con una absorbancia inferior a la del Calibrator 1. En su lugar, se expresarán con una concentración inferior o igual a ( ) la concentración indicada en el vial del Calibrator 1. Recuperación Suero: La recuperación tras la incorporación es del % (103% de media). La recuperación tras la dilución es del % (111% de media). Efecto gancho Las muestras con una concentración superior a 36 nmol/l pueden medirse sin obtener resultados falsamente bajos. Precisión: Cada muestra se analizó en 4 replicados en 14 ocasiones diferentes. Coeficiente de variación Muestra Valor medio pmol/l intraensayo % interensayo % total ensayo % Especificidad La proinsulina en una concentración de 105 pmol/l dio un resultado de 5 pmol/l. Para los otros péptidos, se han hallado las siguientes reacciones cruzadas: Insulina < % Proinsulina 5% Proinsulina des (31 32) 3% Proinsulina split (32 33) 2% Proinsulina des (64 65) 74% Proinsulina split (65 66) 10% 9

10 CALIBRACIÓN El Mercodia Ultrasensitive C-peptide ELISA kit se calibra contra el reactivo de International Reference Reagent for C-peptide, IRR C-peptide 84/510. FACTOR DE CONVERSIÓN 1 μg/l corresponde a 331 pmol/l. GARANTÍA Los datos de rendimiento presentados aquí se obtuvieron usando el procedimiento indicado. Cualquier cambio o modificación en el procedimiento, no recomendado por Mercodia AB, puede afectar los resultados, en cuyo caso Mercodia AB declina cualquier responsabilidad y garantía acordada, implícita o explícita, incluso la garantía implícita sobre la comerciabilidad e idoneidad para su uso. Mercodia AB y sus distribuidores autorizados, en tal caso, no asumirán responsabilidades por daños y perjuicios indirectos o consiguientes. REFERENCIAS Craig ME, Howard NJ, Silink M, Rawlinson WD (2003) Reduced frequency of HLA DRB1*03- DQB1*02 in children with type 1 diabetes associated with enterovirus RNA. J Infect Dis 187: Gaines-Das RE and Bristow AF (1988) WHO International reference reagents for human proinsulin and human C-peptide. J Biol Stand 16: En nuestra web podrá encontrar más referencias: 10

11 HOJA DE RESUMEN DEL PROTOCOLO Mercodia Ultrasensitive C-peptide ELISA Añadir Calibrators, controles* y muestras Añadir Assay Buffer Incubar Lave la placa con la solución de wash buffer 1X Añadir solución de la enzyme conjugate 1X Incubar Lave la placa con la solución de wash buffer 1X Añadir Substrate TMB Incubar Añadir Stop Solution Medir A μl 50 μl 1 hora a C en un agitador de placas, rpm 700 µl, 6 veces 200 μl 1 hora a C en un agitador de placas, rpm 700 µl, 6 veces 200 μl 30 min a C 50 μl Agitar durante 5 segundos para asegurar el mezclado Valore los resultados *No suministrado Ver página 6 para detalles Version 10.0

Mercodia Proinsulin ELISA

Mercodia Proinsulin ELISA Mercodia Proinsulin ELISA Instrucciones para el uso 10-1118-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

Mercodia Iso-Insulin ELISA

Mercodia Iso-Insulin ELISA Mercodia Iso-Insulin ELISA Instrucciones para el uso 10-1128-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN

Más detalles

Mercodia Ultrasensitive Insulin ELISA

Mercodia Ultrasensitive Insulin ELISA Mercodia Ultrasensitive Insulin ELISA Instrucciones para el uso 10-1132-01 REACTIVOS PARA 96 DETERMINACIONES Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Suecia EXPLICACIÓN DE LOS SÍMBOLOS

Más detalles

10-1176-01 REACTIVOS PARA 96 ANÁLISIS

10-1176-01 REACTIVOS PARA 96 ANÁLISIS Mercodia MPO ELISA Instrucciones de uso 10-1176-01 REACTIVOS PARA 96 ANÁLISIS Fabricado por Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala Suecia EXPLICACIÓN DE LOS SÍMBOLOS EMPLEADOS EN LAS ETIQUETAS

Más detalles

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas.

C-peptide. N de código K6220. Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. C-peptide N de código K6220 Inmunoensayo enzimático para la medición cuantitativa del péptido C en muestras clínicas humanas. Este kit contiene reactivos para 96 pocillos de prueba. (111838-002) K6220/ES/CKJ/2009.06.17

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

ELISA PeliClass human IgG subclass kit REF M1551

ELISA PeliClass human IgG subclass kit REF M1551 Sanquin Reagents Plesmanlaan 5 0 CX Amsterdam The Netherlands Phone: +.0.5.599 Fax: +.0.5.570 Email: reagents@sanquin.nl Website: www.sanquinreagents.com M55/ November 007 ELISA PeliClass human IgG subclass

Más detalles

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00

Quantikine IVD ELISA. Inmunoensayo Epo Humano Manual de Instrucciones suplementario. Referencia DEP00 Quantikine IVD ELISA Inmunoensayo Epo Humano Manual de Instrucciones suplementario Referencia DEP00 Este manual de instrucciones incluye el protocolo del ensayo y debe leerse en su totalidad antes de comenzar

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente.

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente. bioelisa HCV 4.0 3000-1115 LEER CAMBIOS SOMBREADOS 96 tests 3000-1116 480 tests Test de ELISA para la detección de anticuerpos contra el virus de la hepatitis C (HCV) en suero o plasma humano para ser

Más detalles

ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA

ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Página 1 de 9 ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Elaborado por: CNSP Blgo. Manuel Céspedes Zambrano Revisado por: CNSP TM. Julia I. Espinoza Soto CNSP MV Gladys Malásquez Mendoza Aprobado por: RD

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Murex anti-hbc (total)

Murex anti-hbc (total) es 8G21-01/-02 GE65/66 Primera edición 10/2009 Murex anti-hbc (total) Enzimoinmunoanálisis para la detección de anticuerpos frente al antígeno core del virus de la hepatitis B (anti-hbc) en suero o plasma

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA)

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

Mercodia Oxidized LDL ELISA

Mercodia Oxidized LDL ELISA Mercodia Oxidized LDL ELISA Instrucciones para el uso 10-1143-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia AB, Sylveniusgatan

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar.

4. DIL SAMP DILUYENTE DE LAS MUESTRAS: Tampón fosfato con proteínas estabilizadoras y conservantes. Listo para usar. bioelisa HIV-1+2 (rec) 3000-1143 LEER CAMBIOS SOMBREADOS 96 tests 3000-1144 480 tests Test de ELISA para la detección de anticuerpos contra HIV-1 y HIV-2 en suero o plasma humano. Sumario Como es conocido

Más detalles

RIDASCREEN. Leishmania Ab. Art. n.: K7121

RIDASCREEN. Leishmania Ab. Art. n.: K7121 RIDASCREEN Leishmania Ab Art. n.: K7121 R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Telf.: +49 (0) 6151 8102-0 / Fax: +49 (0) 6151 8102-20 1. Área de aplicación Para el diagnóstico

Más detalles

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS

CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS CALIBRATEURS Hb A1c CAPILLAIRE Hb A1c CAPILLARY CALIBRATORS Ref. 4755 2014/04 CALIBRADORES Hb A1c CAPILAR Aplicación Los Calibradores Hb A1c CAPILAR están destinados a la calibración y al control de migración

Más detalles

PRINCIPIO DE LA PRUEBA: USO PREVISTO:

PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512

medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 medac Asparaginase-Aktivitäts-Test MAAT Castellano 550-VPS/010512 FABRICANTE medac Gesellschaft für klinische Spezialpräparate mbh Fehlandtstraße 3 D-20354 Hamburg DISTRIBUIDOR medac Gesellschaft für klinische

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano.

Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. Prolactina Código: 9001004 Ensayo inmunoenzimático por Quimioluminiscencia para la medición cuantitativa de Prolactina (PRL) en suero humano. 96 PRUEBAS USO El equipo de Prolactina CLIA se destina para

Más detalles

Detección de IgE específica.

Detección de IgE específica. Detección de IgE específica. Una forma de identificar los alérgenos responsables de los síntomas alérgicos es la detección de anticuerpos IgE específicos frente a dichos alérgenos. Estos anticuerpos están

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

DETERMINACIÓN COLORIMÉTRICA DEL HIERRO

DETERMINACIÓN COLORIMÉTRICA DEL HIERRO DETERMINACIÓN COLORIMÉTRICA DEL HIERRO OBJETIVO Familiarizarse con los principios del análisis colorimétrico. INTRODUCCIÓN La base para lo que los químicos llaman análisis colorimétrico es la variación

Más detalles

PROCEDIMIENTO PARA APLICACIÓN DE LAS PRUEBAS

PROCEDIMIENTO PARA APLICACIÓN DE LAS PRUEBAS 1 de 9 TABLA DE CONTENIDO 1. Objetivo. 2. Alcance. 3. Referencias. 4. Definiciones. 5. Responsabilidades. 6. Descripción 7. Registros 8. Anexos 9. Control de Cambios. 2 de 9 1. OBJETIVO Establecer el procedimiento

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN 25. Perfil lipídico Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 1 Departamento de Bioquímica y Biología Molecular, Avda. Menéndez Pidal s/n, 14071- Córdoba, 2 Campus de Rabanales, Edif. Severo Ochoa 14071-Córdoba

Más detalles

MANTENIMIENTO PREVENTIVO DEL EQUIPAMIENTO

MANTENIMIENTO PREVENTIVO DEL EQUIPAMIENTO MANTENIMIENTO PREVENTIVO DEL EQUIPAMIENTO CHRISTIAN MALICKI LICENCIADO ELECTRONICO TECNICO ELECTROMECANICO MATRICULA PROFESIONAL. : 11882 christian@eficap.com.ar Servicio Técnico Integral de Electromedicina

Más detalles

SC5b-9 Plus RESUMEN Y EXPLICACIÓN

SC5b-9 Plus RESUMEN Y EXPLICACIÓN SC5b-9 Plus Enzimoinmunoensayo para la cuantificación del complejo SC5b-9 presente en plasma o suero humanos MicroVue SC5b-9 Plus EIA Preparación del Reactivo y de la Muestra Diluya el Concentrado de Solución

Más detalles

PLATELIA HSV 1+2 IgM 96 PRUEBAS 72822. DETECCIÓN CUALITATIVA DE ANTICUERPOS IgM ANTI-HSV 1+2, EN SUERO O PLASMA HUMANO, POR MÉTODO INMUNOENZIMÁTICO

PLATELIA HSV 1+2 IgM 96 PRUEBAS 72822. DETECCIÓN CUALITATIVA DE ANTICUERPOS IgM ANTI-HSV 1+2, EN SUERO O PLASMA HUMANO, POR MÉTODO INMUNOENZIMÁTICO PLATELIA HSV 1+2 IgM 96 PRUEBAS 72822 DETECCIÓN CUALITATIVA DE ANTICUERPOS IgM ANTI-HSV 1+2, EN SUERO O PLASMA HUMANO, POR MÉTODO INMUNOENZIMÁTICO 1. CAMPO DE APLICACIÓN Platelia HSV 1+2 IgM es una prueba

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

Prospecto de QuantiFERON -CMV ELISA 2 96

Prospecto de QuantiFERON -CMV ELISA 2 96 Prospecto de QuantiFERON -CMV ELISA 2 96 Prueba de IFN-γ en sangre total para medir las respuestas a los antígenos peptídicos del citomegalovirus humano Para uso de diagnóstico in vitro 0350-0201 Cellestis,

Más detalles

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930

PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

DENV Detect TM IgM CAPTURE ELISA

DENV Detect TM IgM CAPTURE ELISA Detect TM IgM CAPTURE ELISA USO PREVISTO La prueba Detect IgM Capture ELISA está diseñada para la detección cualitativa de anticuerpos IgM contra antígenos recombinantes DEN (DENRA) en suero para diagnóstico

Más detalles

PTH RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN

PTH RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN PTH Un inmunoensayo enzimático para la determinación cuantitativa de la PTH (hormona paratiroidea) intacta en el suero humano RESUMEN Y EXPLICACIÓN USO UTILIZACIÓN El kit de inmunoensayo enzimático de

Más detalles

DiaSorin Inc 1951 Northwestern Ave Stillwater, MN 55082 USA Tel. +1.651.439.9710 Fax +1.651.351.5669

DiaSorin Inc 1951 Northwestern Ave Stillwater, MN 55082 USA Tel. +1.651.439.9710 Fax +1.651.351.5669 DiaSorin Inc 1951 Northwestern Ave Stillwater, MN 55082 USA Tel. +1.651.439.9710 Fax +1.651.351.5669 Ensayo LIAISON N-TACT PTH (310910) 1. FINALIDAD DEL ENSAYO El ensayo LIAISON N-TACT PTH emplea la tecnología

Más detalles

DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA:

DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: EQUIPO AUTOMÁTICO PARA LA DETECCIÓN DE PATÓGENOS minividas-vidas DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: Sistema automático de inmunodetección rápida de patógenos basado en la técnica ELFA (Enzyme

Más detalles

Cuantificación de Clorofila a

Cuantificación de Clorofila a Cuantificación de Clorofila a Clorofilas Las clorofilas son una familia de pigmentos de color verde que se encuentran en las cianobacterias y en todos aquellos organismos que contienen cloroplastos en

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 REF/ PROYECTO: PROMIS 2012 NÚMERO DE LOTES: UNICO Este pliego contempla la adquisición de un sistema

Más detalles

PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA

PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA PRÁCTICA 7 INSTRUMENTACIÓN BÁSICA EN QUÍMICA OBJETIVOS En esta práctica se tratarán aspectos de interés relacionados con la instrumentación básica utilizada en química, haciendo especial hincapié en la

Más detalles

Departamento de Bioquímica y Biología Molecular,

Departamento de Bioquímica y Biología Molecular, 18. Inmunoanálisis Aurora Galván Cejudo 1, Isaac Túnez Fiñana 2 Departamento de Bioquímica y Biología Molecular, 1 Campus Universitario de Rabanales, Edificio Severo Ochoa, 14071-Córdoba, 2 Facultad de

Más detalles

Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201)

Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201) Prospecto de QuantiFERON -TB Gold (QFT ) ELISA 2 x 96 (n.º de referencia 0594-0201) 20 x 96 (n.º de referencia 0594-0501) Ensayo de IFN-γ en sangre total que mide la reacción a los antígenos peptídicos

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA

TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1

Introducción a los Inmunoensayos. GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos GDS_0418723_McClelland_v4 1 Introducción a los Inmunoensayos Objetivos del Entrenamiento Una vez finalizado este capítulo, usted podrá: Definir inmunoensayo Describir la

Más detalles

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA.

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. El estudio INMA lleva asociado la toma de una serie de muestras biológicas según el momento o fase del estudio. Coincidiendo con el parto se recoge una muestra

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

Murex HIV Ag/Ab Combination

Murex HIV Ag/Ab Combination es 7G79-09/-11 GE41/42 Primera edición 08/2009 Murex HIV Ag/Ab Combination Enzimoinmunoanálisis para la detección mejorada de la seroconversión frente a los virus de la inmunodeficiencia humana tipo 1

Más detalles

AVANCE. Publicación de contenido científico editada por GT Laboratorio S.R.L. Necochea 3274 Rosario

AVANCE. Publicación de contenido científico editada por GT Laboratorio S.R.L. Necochea 3274 Rosario Publicación de contenido científico editada por GT Laboratorio S.R.L. Necochea 3274 Rosario AVANCE N 6 Julio 2012 Método enzimático directo. Colesterol ligado a lipoproteínas de baja densidad (LDL - colesterol)

Más detalles

INSULINA. Cat. DA-2425300 VER.1. Solo para diagnóstico In Vitro Para uso exclusivo de laboratorios clínicos o de gabinete Conservar entre 2 C a 8 C

INSULINA. Cat. DA-2425300 VER.1. Solo para diagnóstico In Vitro Para uso exclusivo de laboratorios clínicos o de gabinete Conservar entre 2 C a 8 C INSULINA Cat. DA-2425300 VER.1 Inmunoensayo de la ima para la Determinación Cuantitativa de la Concentración de Insulina en Suero Humano. + Ag Ins + Btn k a - Btn Solo para diagnóstico In Vitro Para uso

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

DEPARTAMENTO DE MEDICINA INTERNA HOSPITAL DE EXPLORACIÓN COLEGIO UNIVERSITARIO YONSEI DE MEDICINA 1- Test: Efectos de bloqueo por el filtro nasal Nosk, en la penetración de alérgenos. 2- Resumen: Certificamos

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

CARDIOCHEK y CARDIOCHEK P.A

CARDIOCHEK y CARDIOCHEK P.A CARDIOCHEK y CARDIOCHEK P.A NUEVA GENERACIÓN DE ANALIZADORES PORTÁTILES Introducción El Cardiochek y Cardiochek P.A son instrumentos portátiles que proporcionan medidas rápidas y precisas de múltiples

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La medición de nitratos en aguas residuales se hace en mg/l. El método es conocido usualmente con el nombre de Reducción de Cadmio, que es donde los iones de nitrito reaccionan

Más detalles

MR-12 Agitador de balanceo

MR-12 Agitador de balanceo MR-12 Agitador de balanceo Manual de funcionamiento Certificado para la versión V.2AW Contenidos 1. Precauciones de seguridad 2. Información general 3. Cómo empezar 4. Funcionamiento 5. Especificaciones

Más detalles

RIDASCREEN. Chlamydia IgG/IgM. Art. n.: KGM3101

RIDASCREEN. Chlamydia IgG/IgM. Art. n.: KGM3101 RIDASCREEN Chlamydia IgG/IgM Art. n.: KGM3101 R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Telf.: +49 61 51 81 02-0 / Fax: +49 61 51 81 02-20 1. Área de aplicación Para el diagnóstico

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

ANÁLISIS DE ELEMENTOS TRAZA EN ESPECÍMENES BIOLÓGICOS: Objetivo. Metodología

ANÁLISIS DE ELEMENTOS TRAZA EN ESPECÍMENES BIOLÓGICOS: Objetivo. Metodología FTTM07 Rev-1, 09/06/20119 INSTITUTO DE TOXICOLOGÍA DE LA DEFENSA Hospital Central de la Defensa. Glorieta del Ejército s/n. 28047 MADRID. Tel.: 914222625. Fax: 914222624 E- mails : jlopcol@oc.mde.es //mllobal@oc.mde.es//

Más detalles

USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH

USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH USO PRACTICO E INTERPRETACIÓN DE LA SEROLOGÍA EN CAMPO. Joaquín Girón, MSD AH El objetivo final de las empresas es tener lotes con muy buenas producciones y económicamente rentables, lógicamente un lote

Más detalles

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT SensPERT Canine Parvovirus Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis.

Laboratorio de Métodos Instrumentales I. Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis. Laboratorio de Métodos Instrumentales I Práctica No. 1 Determinación de fósforo en bebidas de cola por Espectrofotometría UV- Vis Equipo 1 Candy Lara Rentería Jessica Torres Gámez Salón 1 Mérida, Yucatán

Más detalles

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios:

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios: En muchos países, entre ellos Australia, Canadá, la Unión Europea, Corea, Japón, Nueva Zelanda, EEUU, existen leyes y sistemas de control para regular el etiquetado relativo a alergenos alimentarios. Las

Más detalles

INMUNOENSAYO VISUAL DE ENTEROTOXINA ESTAFILOCÓCICA

INMUNOENSAYO VISUAL DE ENTEROTOXINA ESTAFILOCÓCICA INSTRUCTIONS INMUNOENSAYO VISUAL DE ENTEROTOXINA ESTAFILOCÓCICA PARA DETECCIÓN DE LAS ENTEROTOXINAS ESTAFILOCÓCICAS A, B, C 1, C 2, C 3, D, E Y ESTAFILOCOCOS ENTEROTOXIGÉNICOS EN ALIMENTOS Y MUESTRAS RELACIONADAS

Más detalles

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular TP1: Diluciones Objetivos Familiarizarse con las unidades mas utilizadas en biología molecular y ser capaces de intercambiar ágilmente las distintas unidades. Familiarizarse con el material de uso corriente

Más detalles

INTRODUCCIÓN AL CULTIVO CELULAR

INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles

FeLV Ag / FIV Ab Test Kit

FeLV Ag / FIV Ab Test Kit SensPERT FeLV Ag / FIV Ab Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

3M Placas Petrifilm TM para el Recuento de Aerobios

3M Placas Petrifilm TM para el Recuento de Aerobios 3M Placas Petrifilm TM para el Recuento de Aerobios Recomendaciones de uso Para detallar información sobre PRECAUCIONES, COMPENSACIONES POR GARANTÍA / GARANTÍA LIMITADA, LIMITACIONES POR RESPONSABILIDAD

Más detalles

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE MURCIA 1 GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES

Más detalles

Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN

Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN Inmunoensayo enzimático para cuantificar in vitro la 25-hidroxivitamina D 2 y D 3 (25OH-D 2 y 25OH-D 3 ) en suero. RESUMEN EIA (inmunoensayo enzimático) de la 25-OH vitamina D de MicroVue Página 1 de 17

Más detalles

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68

APÉNDICE. Apéndice 1. Espectrofotómetro. (Users Manual 2100 Series Spectrophotometer) 68 APÉNDICE Apéndice 1. Espectrofotómetro (Users Manual 2100 Series Spectrophotometer) 68 El espectrofotómetro de la marca UNICO serie 2100 UV posee un rango de longitud de onda de 200-1000 nm. La técnica

Más detalles

PRÁCTICA 4. ESPECTROFOTOMETRÍA

PRÁCTICA 4. ESPECTROFOTOMETRÍA FUNDAMENTOS DE QUÍMCA-PRÁCTCA 4 PRÁCTCA 4. ESPECTROFOTOMETRÍA OBJETVOS Obtener el espectro de absorción del colorante E-124 y determinar, a partir del espectro, a) El coeficiente de absortividad molar

Más detalles

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY www.diasorin.com. Modificaciones: 11 Supresiones:

DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY www.diasorin.com. Modificaciones: 11 Supresiones: DiaSorin S.p.A. Via Crescentino snc - 13040 Saluggia (VC) - ITALY www.diasorin.com Modificaciones: 11 Supresiones: 1. FINALIDAD DEL ENSAYO Ensayo in vitro para determinación cuantitativa de alfafetoproteína

Más detalles

Diagnóstico del Dengue

Diagnóstico del Dengue Solución Total: Todo lo que usted necesita saber acerca del Diagnóstico del Dengue Prueba Rápida Dengue Duo ( + Ab Combo) Dengue IgG/IgM ELISA Dengue IgM capture ELISA Dengue IgG capture ELISA ELISA 2

Más detalles

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985.

PROCEDIMIENTO PARA DETERMINACIÓN DE SODIO, POTASIO y CALCIO EN ALIMENTOS. Método Espectrofotometría de Absorción Atómica de llama. Método AOAC 985. Página 1 de 8 1. OBJETIVO Determinar la concentración de sodio, potasio y calcio en muestras de alimentos con bajo contenido de grasa. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a alimentos

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

RIDASCREEN. HSV 2 IgG, IgM. Nº de artículo: K5221 (IgG) K5231 (IgM)

RIDASCREEN. HSV 2 IgG, IgM. Nº de artículo: K5221 (IgG) K5231 (IgM) RIDASCREEN HSV 2 IgG, IgM Nº de artículo: K5221 (IgG) K5231 (IgM) R-Biopharm AG, An der neuen Bergstraße 17, D-64297 Darmstadt, Alemania Teléfono: +49 61 51 81 02-0/Fax: +49 61 51 81 02-20 1. Uso previsto

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales

Universidad Tecnológica de Panamá Centro de Investigaciones Hidráulicas e Hidrotécnicas Laboratorio de Sistemas Ambientales Página: 1 de 5 1. Introducción: La prueba de Demanda Química de Oxígeno (DQO) se basa en la oxidación química de la materia orgánica e inorgánica, presente en las muestras de agua, con dicromato de potasio

Más detalles

El tipo de alteración observada también proporciona gran información:

El tipo de alteración observada también proporciona gran información: TEMA 5: ENZIMOLOGÍA CLÍNICA 1. Valor diagnóstico de las enzimas en el plasma. 2. Principios del análisis de enzimas 3. Análisis de isoenzimas. 4. Determinación enzimática de sustratos. 1. Valor diagnóstico

Más detalles

DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000

DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000 DETERMINACIÓN DE LA REACTIVIDAD AGREGADO / ALCALI (MÉTODO QUÍMICO) MTC E 217 2000 Este Modo Operativo está basado en la Norma ASTM C 289, la misma que se ha adaptado al nivel de implementación y a las

Más detalles

SEGURIDAD ALIMENTARIA: DETECCIÓN DE ALÉRGENOS Metodologías para la detección de alérgenos

SEGURIDAD ALIMENTARIA: DETECCIÓN DE ALÉRGENOS Metodologías para la detección de alérgenos SEGURIDAD ALIMENTARIA: DETECCIÓN DE ALÉRGENOS Metodologías para la detección de alérgenos Sra. Juliana Roca. Responsable departamento técnico, Bioser, S. A. DERIO, martes 16 de Junio de 2015 1 Alérgenos

Más detalles

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD

FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD FACULTAD DE QUÍMICA DEPARTAMENTO DE BIOLOGÍA REGLAMENTO INTERNO DE HIGIENE Y SEGURIDAD Artículo 1. Este Reglamento es complementario del Reglamento de Higiene y Seguridad de la Facultad de Química de la

Más detalles

NORMA MEXICANA NMX-F-501-SCFI-2011

NORMA MEXICANA NMX-F-501-SCFI-2011 NORMA MEXICANA NMX-F-501-SCFI-2011 INDUSTRIA AZUCARERA Y ALCOHOLERA - DETERMINACIÓN DE DIÓXIDO DE AZUFRE EN MUESTRAS DE AZÚCARES BLANCOS. (CANCELA A LA NMX-F-501-1987) SUGAR AND ALCOHOL INDUSTRY - DETERMINATION

Más detalles

UNIVERSIDAD COLEGIO MAYOR DE CUNDINAMARCA 65 Años COMUNICADO 01 RESPUESTA A OBSERVACIONES. INVITACIÓN A COTIZAR No.046 2010

UNIVERSIDAD COLEGIO MAYOR DE CUNDINAMARCA 65 Años COMUNICADO 01 RESPUESTA A OBSERVACIONES. INVITACIÓN A COTIZAR No.046 2010 COMUNICADO 01 RESPUESTA A OBSERVACIONES INVITACIÓN A COTIZAR No.046 2010 ADQUISICION DE EQUIPOS E IMPLEMENTOS DE LABORATORIO CON DESTINO AL PROGRAMA DE BACTERIOLOGIA CASA COMERCIAL QUIMICA MG LTDA Item

Más detalles

MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE

MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE CAPÍTULO 8 MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE Fuente: National Geographic - Noviembre 2000 INTRODUCCIÓN La medición de los contaminantes sirve para varias funciones tales como: Provee un criterio

Más detalles

4.2. Limpieza del material de laboratorio.

4.2. Limpieza del material de laboratorio. Química 4 Tema 4. Material de laboratorio 4.1. Material de uso frecuente en el laboratorio. 4.2. Limpieza del material de laboratorio. Clasificación: i) según su función ii) según el material de que está

Más detalles

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS

CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS CROMATOGRAFÍA DE GASES ACOPLADO A UN DETECTOR DE MASAS GC/MS La cromatografía es una técnica para separar las sustancias químicas que se basa en las diferencias en conductas partitivas de una fase móvil

Más detalles

J. Muestras 2015-871 - 2015-875 Proficiencia para Contaje de Espermatozoides.

J. Muestras 2015-871 - 2015-875 Proficiencia para Contaje de Espermatozoides. 5 de octubre de 2015 Laboratorios Participantes Laboratorios de Salud Pública De Puerto Rico Laboratorios de Salud Pública De Puerto Rico Laboratorios de Salud Pública de P.R. INSTRUCCIONES PARA LA PROFICIENCIA

Más detalles