Estas prácticas tienen por objeto aprender a manejar la información contenida en el NCBI de una forma más o menos sencilla o elemental.

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Estas prácticas tienen por objeto aprender a manejar la información contenida en el NCBI de una forma más o menos sencilla o elemental."

Transcripción

1 NCBI. Bases de Datos: Pubmed, Nucleotide, Protein, Structure A lo largo de los últimos 15 o 20 años, se ha ido acumulando una gran cantidad de información de naturaleza molecular (secuencias de genes, genomas, proteínas, etc.), procedente de los distintos proyectos genoma de diferentes especies (Homo sapiens, Pan troglodytes, Gallus gallus, Drosophila melanogaster, Takifugu rubripes, Caenorhabditis elegans, etc. etc.). Toda esta información se ha ido depositando en grandes almacenes de información de secuencias, organizadas en bases de datos, con la intención de que científicos y público en general, pudiera acceder a ella a través de internet. Como complemento a esa información de tipo molecular, estos almacenes han incorporado toda una colección de publicaciones y textos científicos de tipo biomédico. En este sentido, el que un biólogo sepa cómo acceder y explotar esta información de un modo eficiente, resulta hoy en día algo absolutamente imprescindible y necesario. De todos estos almacenes de información de secuencias, el correspondiente al National Center for Biotechnology Information (NCBI) puede considerarse como el de referencia en lo que a obtención de secuencias moleculares y publicaciones biomédicas se refiere. Estas prácticas tienen por objeto aprender a manejar la información contenida en el NCBI de una forma más o menos sencilla o elemental. La URL (Uniform Resource Locator) del NCBI es y su página inicial es a día de hoy la siguiente: En ella hemos indicado los enlaces que nos llevan a los contenidos de información relativos a publicaciones de índole biomédica (1), de secuencias de nucleótidos (2) y proteínas (3), y de la estructura tridimensional de moléculas (4). 1

2 ENLACES A PUBLICACIONES DE ÍNDOLE BIOMÉDICA. Pubmed: PubMed comprende más de 24 millones de citas de la literatura biomédica, revistas de ciencias biológicas, y los libros en línea. Las citas pueden incluir vínculos al texto completo de artículos de PubMed Central (ver más abajo) y sitios web de editoriales, o solamente al resumen de dichos artículos. Bookshelf: Proporciona acceso gratuito a textos en línea y documentos en ciencias de la vida y de la salud. PubMed Central: Es un archivo de revistas de carácter biológico y biomédico, de libre acceso, y depositado en la Biblioteca Nacional de Medicina, de los Institutos Nacionales de Salud (NIH/NLM). PubMed Health: Proporciona información a médicos y público en general sobre la prevención y tratamiento de enfermedades y afecciones. Veamos brevemente cómo buscar referencias biomédicas a través de PubMed, sobre, por ejemplo, la organización del promotor de eucariotas. El punto de partida de la búsqueda puede realizarse desde distintos sitios, pero para sistematizar este procedimiento, vamos a realizar la búsqueda desde la página inicial de PubMed. Para ello pinchamos en el enlace PubMed que vemos en la figura de más arriba, situado en la columna encabezada por Popular Resources, lo que nos lleva a la siguiente página: 2 1 En la ventana de búsqueda (señalada con una flecha -1) podemos incluir los términos de búsqueda (generalmente, en inglés): eukaryotic promoter organization, lo que nos da una relación de más de 250 artículos en los que aparecen cualquiera de los términos anteriores, que posteriormente podemos reordenar de acuerdo a distintos criterios: relevancia, tipo de artículo (revisiones, descripciones completas de un paciente o enfermedad - case report -, carta, noticia, etc.), periodo de publicación en años, etc. etc. 2

3 Alternativamente, podemos realizar una búsqueda avanzada de artículos (señalada con la flecha 2 ver más atrás), en la que podemos incluir términos específicos para campos concretos de la base de datos de PubMed (autor, fecha de publicación, idioma de la publicación, revista, etc.), con lo que la búsqueda se vuelve más específica y precisa. La búsqueda de información en las restantes bases de datos PubMed Central, Bookshelf o PubMed Health, es similar a lo mostrado anteriormente. Conviene que practiques, buscando en estas bases de datos la información que sea de tu interés. 3

4 BÚSQUEDA Y OBTENCIÓN DE SECUENCIAS NUCLEOTÍDICAS El procedimiento es muy similar al indicado para buscar información en PubMed, sólo que ahora trabajaremos en una base de datos del NCBI diferente; en este caso será la base datos de Nucleotide. En la página principal de NCBI pinchamos en el enlace correspondiente a Nucleotide ( Popular resources, columna de la derecha), y entramos en la página inicial de NUCLEOTIDE. 2 1 Al igual que veíamos en PubMed, podemos introducir los términos de búsqueda, bien la ventanita (flecha 1) o bien a través del procedimiento de búsqueda avanzad (flecha 2). Esto último es generalmente preferible, puesto que podemos afinar mucho más nuestra búsqueda. Imaginemos que queremos buscar la secuencia del mensajero del gen de la Tirosinasa en el ratón (mutaciones en el gen de la tirosinasa, producen albinismo) usando el procedimiento de búsqueda avanda. Introduciremos sucesivamente los términos Mus musculus y tyrosinase en los campos de organism y protein name 4

5 La respuesta tendría el siguiente aspecto: Recuadrado en rojo aparece la entrada de Nucleotide correspondiente a la secuencia buscada. Si pinchamos en el enlace Fasta, tendremos la secuencia en un formato utilizable en distintos programas bioinformáticos. Una secuencia en formato FASTA, bien de nucleótidos o de aminoácidos, tiene una sintaxis caracterizada por una primera línea que obligatoriamente empieza por el símbolo mayor que (>) seguido por una identificación de la secuencia en cuestión; esta línea es meramente informativa. A partir de la segunda línea y siguientes aparece la secuencia de la molécula propiamente dicha. Por ejemplo, la secuencia de nucleótidos ATTGCCGTTATGCAATTGAT en formato FASTA aparecería como sigue: >Ejemplo de secuencia en FASTA ATTGCCGTTATGCAATTGAT BÚSQUEDA Y OBTENCIÓN DE SECUENCIAS DE PROTEÍNAS El procedimiento de búsqueda es totalmente equiparable al de las búsquedas de secuencias nucleotídicas, sólo que la base de datos del NCBI sobre la que se ha de trabajar es la de Protein. Podemos acceder a ella desde la página principal de NCBI; pinchamos en el enlace 5

6 correspondiente a Protein ( Popular resources, columna de la derecha), y entramos en la página inicial de PROTEIN. 2 1 Podemos introducir los términos de búsqueda, bien la ventanita (flecha 1) o bien a través del procedimiento de búsqueda avanzad (flecha 2), lo que es preferible, puesto que podemos afinar mucho más nuestra búsqueda. La búsqueda de la secuencia proteica de la tirosinasa (tyrosynase) del ratón (Mus musculus) a través del procedimiento de búsqueda avanzada, nos daría el siguiente resultado: A partir de cualquiera de las entradas señaladas, podríamos obtener la secuencia de la proteína buscada. 6

7 BÚSQUEDA Y OBTENCIÓN DE ESTRUCTURAS TRIDIMENSIONALES El punto partida para obtener la estructura tridimensional de macromoléculas es el enlace Domains & Structures situado la página principal del NCBI, en la columna de la izquierda. Pinchando en él, llegaremos a la página que nos permite acceder a las bases de datos de estructuras moleculares tridimensionales. Estas dos bases de datos que vemos recuadradas en la figura, se refieren a la colección de estructuras 3D de una serie de dominios de proteínas conservados a lo largo de la evolución (CDD), y a la colección de estructuras 3D de macromoléculas. Para buscar información en ellas se operaría exactamente igual que en el caso de PubMed, Nucleotide, y Protein. Por ello, no vamos a hacer ninguna indicación especial en ese sentido. No obstante, para poder visualizar estas estructuras en modo 3D, se necesitan programas específicos. NCBI utiliza el visualizador Cn3D ( See n 3D ) como estándar. 7

8 PROGRAMA DE VISUALIZACIÓN DE ESTRUCTURAS: Cn3D La descarga del programa Cn3D se realiza desde la misma página Domains & Structures accesible desde la página principal del NCBI. Una vez en ella, activamos la pestaña Tools, y desde aquí pinchamos en el enlace al programa Cn3D Una vez descargado e instalado en nuestro ordenador, ya estaremos en disposición de ver estructuras moleculares, bien moléculas completas o bien dominios de proteínas conservados durante la evolución. Durante el desarrollo de la práctica, veremos algún ejemplo de estructura molecular a través de este programa, así como algunos aspectos básicos de su manejo. En la figura que sigue, tan sólo mostraremos las dos ventanas principales que se abren cuando cargamos una estructura molecular en Cn3D. La molécula que vamos a ver es la que corresponde a los dominios BRCT (BReast cancer C-Terminal domain) de la proteína BRCA1. 8

9 Como podemos ver, se nos abren 2 ventanas que contienen por un lado la estructura 3D de los 2 dominios BCRT, y por otro la ventana correspondiente a la secuencia aminoacídica de dichos dominios (1Y98_A) y la secuencia del péptido fosforilado Ctip, que interactúa con la proteína BRCA1 (1Y98_B). Como se ha dicho, trabajaremos en la sesión de prácticas con esta estructura a través de Cn3D. En el enlace https://galter.northwestern.edu/guides-and-tutorials/structure-viewers.pdf se puede seguir una guía de utilización del programa (menús, opciones, etc.). 9

10 BÚSQUEDA DE ORF s (MARCOS ABIERTOS DE LECTURA) El término ORF se refiere a una parte de una secuencia nucleotídica que tiene la potencialidad de codificar un péptido o una proteína; es decir, que debe contener un codón o triplete de iniciación y un codón de terminación. La búsqueda de ORF s en una secuencia de nucleótidos tiene muchas utilidades en genética molecular. Por ejemplo, puede ayudar a la predicción de genes, a la determinación del origen de pseudogenes, etc. Veamos el siguiente ejemplo: Se trata de buscar posibles funciones de una secuencia anónima de nucleótidos y buscar si presenta alguna relación con otras secuencias depositadas en la base datos de genes. Supongamos que se ha rescatado una secuencia de cdna y queremos saber si presenta alguna relación con secuencias de genes ya conocidos, y si es así, tratar de deducir su posible función fisiológica, metabólica, celular. Imaginemos que la secuencia de cdna problema es la siguiente: 1 TTGCGCGAGG GCCGCCCCAG CCGCCCGATC AGCGTCGGCC CCTGCGCTGG 51 CTGAGGGGGA ATCACCCCCC GCTGCCAAAC GCAGGCACGG ACCCCAGTCC 101 TGCGGCGCGC TGGCGGGCAG GTCAGACCGA GCCCTCCAGT GAATCAGGCG 151 ACAAATACAA CGCCAGGGAT CAGCGACGGC AGCGCTACAA GAATCGACGG 201 CGTGTTGGAG GGACCCAGCT CTATGCCGAG TTCAGTCGCC AGCAGAGGTA 251 CTGCCGTGAC TGGGAAGGCG GACCCCAGTA GCGCCTGTGA CGCGGGGACG 301 GGTCAGCGTC TGCCGGTAGC CGGACCGCCC AGGCAGGCTG ACCAAGCGGC 351 GCCTGTGGCA GTTGGCCCAA CAAACGAGCA CGTCCCCCGA ACCACGACGC 401 TGAGCGACAG TCTAGGCCGT GCTAGTGAAC GCACGTGAGC CACGAGACAC 451 TGCAAGTCAG CCGGACTCCT CGTCGGGTCG CCCGCTAGCC CTACCTCGAG 501 TGTCACCCCA GACCTTAAGC GCTGGCTCAT TAGGGTAGGC TCAATCGGGC 551 GGCGACGGCT CTGGCCCCAC AGACTGGGTA ACCTTGCCAA CCAGGCCTCG 601 ATGAAGTGGG TGTGGGCCCT GGCCCTGCTG GCCGCCTGGG CCGCCGCCGA 651 GCGCGACTGC CGCGTGAGCA GCTTCCGCGT GAAGGAGAAC TTCGACAAGG 701 CCCGCTTCAG CGGCACCTGG TTCGCCTTGG CCAAGAAGGA CCCCGAGGGC 751 CTGTTCCTGC AGGACAACTT CGTGGCCGAG TTCAGCGTGG ACGAGACCGG 801 CCAGATGAGC GCCACCGCCA AGGGCCGCGT GTGCCTGCTG AACAACTGGG 851 ACGTGTGCGC CGACAAGGTG GGCACCTTCA CCGACACCGA GGACCCCGCC 901 AAGTTCAAGA TGAAGTACTG GGGCGTGGCC AGCTTCCTGC AGAAGGGCAA 951 CGACGACCAC TGGATCGTGG ACACCGACTA CGACACCTAC GCCGTGCAGT 1001 ACAGCTGCCG CCTGCTGAAC CTGGACGGCA CCTGCGCCGA CGACTACAGC 1051 TTCGTGTTCA GCCGCGACCC CAACGGCCTG CCCCCCGAGG CCCAGAAGAT 1101 CGTGCGCCAG CGCCAGGAGG AGCTGTGCCT GGCCCGCCAG TACCGCCTGA 1151 TCGGCCACAA CGGCTACTGC GACGGCCGCA GCGAGCGCAA CCTGCTGTAA 1201 GGTGCGGCGC GTCTACTCTC CCCCATCCCG CTAGGGCCTG CGGTGTCGCC 1251 GGACCAGGGT CACACCAACC ATCTCACGTG CGGCCCTGTC GTTCACCCTC 1301 CCATCCACTG ACGGCGCGGC AGACCCGGGA GGCCGGCCGA CAGCTGGCGG 1351 CGCGCGCGCC AAGGGAGCTG GCGACGACTC CCGCCACCGG CTGGACGAAA 1401 ATGGCAAGTC TAGGCGCCAG CGTCGCCGTA GAAGGGGTCG TTTTCAGCCG 1451 GACATGGCCG GACACAGTGG CCAGTGGCCG ATCGTCAAGG CCTGATGCCC 1501 GTAAATGGCT TCGTTAGTTT GGCGCCCAGG CGCTCGGCCA GCCGGGCGTT 1551 AGAGCAACAC AGAGTTCGCC GCACCGCCCG CCCGAACGCA GAGAAGGCGA 1601 GAGCGAGTTT GGCCTATAGG AGCCGCCGCT CACGGCAACC GCGCACAAAC 1651 GGGTAAGCCC TCGGCCCAAC CCCGGAGTGC TTAACCCGGC TTCGCGAAGG 1701 CCGAAGTCCG GAGAGGACAG CATGGGTCGT GCGTCAGGGC CTGGCGTTCG 1751 TCGCAAAAAC GCACAAGCTA CCGGAGGATC ACAATGCCCA GACCACCCTA 10

11 1.- Búsquedas de Open Reading Frames (ORF s). Lo primero que vamos a hacer es tratar de ver si contiene algún marco abierto de lectura (Open Reading Frame ORF), es decir, si contiene un conjunto de codones que son capaces de traducirse a proteína. Para ello vamos a utilizar la utilidad ORF Finder que se encuentra en el NCBI (http://www.ncbi.nlm.nih.gov). Hacemos clic en el vínculo correspondiente a esa utilidad, que se encuentra en la solapa Tools de la entrada Sequence analysis y entramos en la página correspondiente a la búsqueda de ORF s. La nueva página te presenta el programa, pudiendo introducir la clave de una de las secuencias ya contenidas en las bases de datos, o una propia. Esto último es lo que vamos a hacer nosotros. En el cuadro grande en blanco vamos a introducir la secuencia problema en formato FASTA (Formato muy utilizado en bioinformática, pues todos los programas bioinformáticos reconocen este formato). Para ello escribimos en la primera línea del cuadro en blanco una línea de identificación de nuestra secuencia problema; dicha línea empieza siempre con el símbolo mayor que (>) y a continuación un texto descriptivo, por ejemplo: > secuencia problema 11

12 En las siguientes líneas irá la secuencia de nucleótidos propiamente dicha. No importa que vayan números al principio de las líneas, ni que haya espacios en blanco. Una vez que se haya pegado la secuencia hacemos click en OrfFind para ejecutar el programa. El resultado del programa da los posibles ORF s en las dos cadenas (aparecen 3 posibilidades para una cadena y otras 3 para la otra). De todas las ORF s que aparecen en cada una de las 3 pautas de lectura de las hebras plus (+) y minus (-), empezaremos por investigar con la mayor de todas (presenta 600 nucleótidos). En la figura siguiente está recuadrada en rojo y marcada con una flecha. Pinchamos en élla, y aparecerá una nueva pantalla con la ORF seleccionada, ya aislada y con su traducción a proteína. 12

13 Traducción a proteína de la ORF (parte) Nos quedaremos con la secuencia de la proteína que se codificaría a partir de este ORF. Para ello copiaríamos la secuencia y la editaríamos convenientemente utilizando el bloc de notas, cuidando de ponerla en formato FASTA. Nos quedaría algo así como: >ORF M K W V W A L A L L A A W A A A E R D C R V S S F R V K E N F D K A R F S G T W F A L A K K D P E G L F L Q D N F V A E F S V D E T G Q M S A T A K G R V C L L N N W D V C A D K V G T F T D T E D P A K F K M K Y W G V A S F L Q K G N D D H W I V D T D Y D T Y A V Q Y S C R L L N L D G T C A D D Y S F V F S R D P N G L P P E A Q K I V R Q R Q E E L C L A R Q Y R L I G H N G Y C D G R S E R N L L Este archivo lo utilizaremos en un paso posterior, para ilustrar el uso de la herramienta BLAST 2.- BÚSQUEDAS DE HOMOLOGÍAS Hasta ahora lo que tenemos es una secuencia de proteína, pero no sabemos nada de ella, ni su función, ni su familia ni el parentesco que guarda con otras proteínas de la misma especie o de otras especies. 13

14 Conocer la función de una proteína es un trabajo duro de laboratorio; una forma aproximada para saber algo de un proteína problema es buscar en las bases de datos, otras proteínas que tengan parecido (homología) con ella, es decir, tratar de deducir en la medida de lo posible y por comparación, la familia de proteínas a la que pertenece y su posible función. Uno de los programas más utilizados para buscar parecidos u homologías es BLAST (Basic Local Alignment Search Tool). Este programa compara una secuencia de proteína o de nucleótidos con una base de datos (de proteínas o de nucleótidos). Nosotros vamos a utilizar la variante BLASTP que compara una proteína contra una base de datos de proteínas. Este BLAST lo podemos hacer directamente en la página web en la que hemos realizado la búsqueda de ORF s. Para ello seleccionamos Blastp como programa, y como database seleccionamos Swissprot (Ver figura de la página anterior). Nosotros utilizaremos directamente la herramienta BLAST desde su página de inicio. El enlace lo tenemos en la página inicial del NCBI, en la columna de la derecha (Recursos populares). Puesto que se trata de una posible proteína, utilizaremos la opción Protein blast. 14

15 Aquí copiamos la secuencia problema Copiamos la secuencia de la proteína problema en la ventana en blanco, y seleccionamos una base de datos de proteínas contra la que comparar (Buscar secuencias similares homólogas- a la nuestra. En este caso hemos elegido la base de datos Refseq de proteínas, aunque podríamos haber utilizado otra distinta. Refseq tiene la ventaja de que se trata de una colección exhaustiva de secuencias de proteínas no redundantes y bien anotadas. Una vez incluida la secuencia de trabajo pincharemos en el botón BLAST que aparecerá más abajo en la misma página. Con ello se iniciará el proceso de búsqueda de secuencias similares a la nuestra. (En el siguiente enlace: ftp://ftp.ncbi.nlm.nih.gov/pub/factsheets/howto_blastguide.pdf podremos ver una guía explicativa acerca de la herramienta BLAST del NCBI y sus posibilidades de utilización). Durante el proceso de búsqueda de secuencias nos aparecen unas pantallas que ya nos indican de qué tipo de proteína se trata nuestra proteína problema. Una de esas pantallas tiene el siguiente aspecto: 15

16 Como se puede ver, se ha detectado un dominio de Lipocalinas. Si pinchamos en el esquema que muestra el dominio de lipocalina podremos obtener información sobre esas proteínas, e incluso quizá su estructura en 3 dimensiones. Las lipocalinas son pequeñas proteínas con forma de cesta que portan en su interior moléculas hidrofóbicas, y sus funciones son muy variadas. Una vez que esté terminada la búsqueda aparece una pantalla con los resultados. Bajamos la página hasta ver un listado de las secuencias encontradas. Podremos ver que las primeras que se han encontrado son todas "Retinol Binding Proteins", es decir lipocalinas que transportan retinol. Luego aparecen más lipocalinas. Cada proteína homóloga aparece marcada en azul, si pinchamos en los enlaces que aparecen bajo la columna Accession podremos ver la información sobre esa proteína, la secuencia, quién la secuenció, otras bases de datos que tengan información sobre esa proteína etc. En resumen, podemos concluir de este análisis, que nuestra secuencia es una lipocalina, y que pertenece al grupo de las Proteínas que unen retinol (Retinol Binding Proteins). Lo más probable, por tanto es que nuestra secuencia corresponda a una proteína que también transporte retinol. 16

BASES DE DATOS DE INTERÉS EN BIOQUÍMICA

BASES DE DATOS DE INTERÉS EN BIOQUÍMICA BASES DE DATOS DE INTERÉS EN BIOQUÍMICA Las técnicas de alto rendimiento desarrolladas en las últimas décadas han permitido la adquisición masiva de información de biología molecular que se depositan en

Más detalles

BASES DE DATOS DE INTERÉS EN BIOQUÍMICA

BASES DE DATOS DE INTERÉS EN BIOQUÍMICA BASES DE DATOS DE INTERÉS EN BIOQUÍMICA Las técnicas de alto rendimiento desarrolladas en las últimas décadas han permitido la adquisición masiva de información de biología molecular que se depositan en

Más detalles

Creación paso a paso de Formularios con Google (Parte I) (AKA: no corrijo nunca más!)

Creación paso a paso de Formularios con Google (Parte I) (AKA: no corrijo nunca más!) Creación paso a paso de Formularios con Google (Parte I) (AKA: no corrijo nunca más!) por Rodrigo Martínez Gazoni La idea de este tutorial es meternos en una de los servicios que ofrece Google en forma

Más detalles

Página principal de Ensembl. Especies para las que mantiene información.

Página principal de Ensembl. Especies para las que mantiene información. EL GENOMA HUMANO VISTO POR ENSEMBL El objetivo de estas prácticas consistirá en analizar una región del genoma humano de aproximadamente 1 Mb de extensión. Se indicará, entre otras cosas, las características

Más detalles

GUÍA RÁPIDA DEL PROCESO DE IDENTIFICACIÓN Y ANÁLISIS FILOGENÉTICO DE RECURSOS GENÉTICOS, BASADO EN LA COMPARACIÓN DE SECUENCIAS DE ADN.

GUÍA RÁPIDA DEL PROCESO DE IDENTIFICACIÓN Y ANÁLISIS FILOGENÉTICO DE RECURSOS GENÉTICOS, BASADO EN LA COMPARACIÓN DE SECUENCIAS DE ADN. 1 GUÍA RÁPIDA DEL PROCESO DE IDENTIFICACIÓN Y ANÁLISIS FILOGENÉTICO DE RECURSOS GENÉTICOS, BASADO EN LA COMPARACIÓN DE SECUENCIAS DE ADN. CASO PARTICULAR DE BACTERIAS. Programas CHROMAS, DNA Star, EZ-TAXON,

Más detalles

Pasamos ahora a definir brevemente cual es el método de conexión más habitual usando un entorno gráfico.

Pasamos ahora a definir brevemente cual es el método de conexión más habitual usando un entorno gráfico. Clientes de FTP en modo gráfico Introducción Ya vimos en la primera parte de nuestro curso de FTP, que la conexión a servidores inicialmente se realizaba (y aún se sigue haciendo) en modo texto. Aunque

Más detalles

Introducción a Mozilla Navegador

Introducción a Mozilla Navegador 20021125 Universidad de Navarra Introducción a Mozilla Navegador Versión 1.1. cti Centro de Tecnología Informática Tabla de contenidos 1. Mozilla Navegador...3 1.1.Establecer las preferencias de Navigator...4

Más detalles

Instalación del programa PSPP y obtención de una distribución de frecuencias.

Instalación del programa PSPP y obtención de una distribución de frecuencias. Práctica 2. Instalación del programa PSPP y obtención de una distribución de frecuencias. Con esta práctica instalaremos el programa PSPP. El programa es un software específico para el análisis estadístico

Más detalles

Para trabajar este tema vamos a situarlo un poco más en el lenguaje común:

Para trabajar este tema vamos a situarlo un poco más en el lenguaje común: Curso de Internet a distancia para sacerdotes, religiosos y religiosas Material de apoyo para las teleclases - Viernes,18 de noviembre2011 Vea los vídeos resúmenes en: www.medioscan.es y www.teleiglesia.es

Más detalles

Guia de realización de un GIG personal en nuestra página web (http://zunzuneguibhi.net):

Guia de realización de un GIG personal en nuestra página web (http://zunzuneguibhi.net): Crear un GIG en la web del instituto Zunzunegui (v2) Guillermo Hierrezuelo Guia de realización de un GIG personal en nuestra página web (http://zunzuneguibhi.net): PREÁMBULO: entrar a nuestra página; navegadores

Más detalles

TEMA 20 EXP. WINDOWS PROC. DE TEXTOS (1ª PARTE)

TEMA 20 EXP. WINDOWS PROC. DE TEXTOS (1ª PARTE) 1. Introducción. TEMA 20 EXP. WINDOWS PROC. DE TEXTOS (1ª PARTE) El Explorador es una herramienta indispensable en un Sistema Operativo ya que con ella se puede organizar y controlar los contenidos (archivos

Más detalles

UPR RECINTO DE RÍO PIEDRAS FACULTAD DE CIENCIAS NATURALES DEPARTAMENTO DE BIOLOGÍA LABORATORIO DE BIOTECNOLOGÍA (BIOL. 3365)

UPR RECINTO DE RÍO PIEDRAS FACULTAD DE CIENCIAS NATURALES DEPARTAMENTO DE BIOLOGÍA LABORATORIO DE BIOTECNOLOGÍA (BIOL. 3365) UPR RECINTO DE RÍO PIEDRAS FACULTAD DE CIENCIAS NATURALES DEPARTAMENTO DE BIOLOGÍA LABORATORIO DE BIOTECNOLOGÍA (BIOL. 3365) Análisis del gen AmyE mediante el uso de herramientas de bioinformática A. Objetivos

Más detalles

Herramientas Informáticas para la Documentación Práctica 1. Introducción al navegador Netscape

Herramientas Informáticas para la Documentación Práctica 1. Introducción al navegador Netscape Herramientas Informáticas para la Documentación Práctica 1. Introducción al navegador Netscape Introducción y objetivos De modo muy resumido Internet es una red que interconecta redes de ordenadores. Conectándose

Más detalles

Configuración de un sitio local

Configuración de un sitio local Configuración de un sitio local Un sitio web es un conjunto de archivos y carpetas, relacionados entre sí, con un diseño similar o un objetivo común. Es necesario diseñar y planificar el sitio web antes

Más detalles

Programa diseñado y creado por 2014 - Art-Tronic Promotora Audiovisual, S.L.

Programa diseñado y creado por 2014 - Art-Tronic Promotora Audiovisual, S.L. Manual de Usuario Programa diseñado y creado por Contenido 1. Acceso al programa... 3 2. Opciones del programa... 3 3. Inicio... 4 4. Empresa... 4 4.2. Impuestos... 5 4.3. Series de facturación... 5 4.4.

Más detalles

Manual de Inicio Enero 2014 Versión 1.0

Manual de Inicio Enero 2014 Versión 1.0 Manual de Inicio Enero 2014 Versión 1.0 Introducción En este sencillo manual mostramos los pasos para empezar a trabajar con Røter. Lo primero que debemos tener en cuenta es que se trata de una herramienta

Más detalles

AGREGAR UN EQUIPO A UNA RED Y COMPARTIR ARCHIVOS CON WINDOWS 7

AGREGAR UN EQUIPO A UNA RED Y COMPARTIR ARCHIVOS CON WINDOWS 7 Tutoriales de ayuda e información para todos los niveles AGREGAR UN EQUIPO A UNA RED Y COMPARTIR ARCHIVOS CON WINDOWS 7 Como agregar a una red existente un equipo con Windows 7 y compartir sus archivos

Más detalles

Lic. Saidys Jiménez Quiroz Tecnología e Informática Grado 7 CESCOJ 2011

Lic. Saidys Jiménez Quiroz Tecnología e Informática Grado 7 CESCOJ 2011 Lic. Saidys Jiménez Quiroz Tecnología e Informática Grado 7 CESCOJ 2011 NÚCLEO BÁSICO N 2: INTRODUCCIÓN A LA INFORMÁTICA. SESIÓN DE APRENDIZAJE N 2.4: GENERALIDADES DE WINDOWS XP EL EXPLORADOR DE WINDOWS.

Más detalles

MANUAL APLICACIÓN. SOFTWARE GESTIÓN DE CLÍNICAS DENTALES

MANUAL APLICACIÓN. SOFTWARE GESTIÓN DE CLÍNICAS DENTALES 1. ÍNDICE MANUAL APLICACIÓN. SOFTWARE GESTIÓN DE CLÍNICAS DENTALES 1. INTRODUCCIÓN...4 2 INSTALACIÓN DE LA APLICACIÓN...4 3 PANTALLA DE ACCESO...5 4 SELECCIÓN DE CLÍNICA...6 5 PANTALLA PRINCIPAL...7 6.

Más detalles

GUÍA DEL USUARIO INSTRUCTOR

GUÍA DEL USUARIO INSTRUCTOR INSTRUCTOR INTRODUCCIÓN Estimado instructor: Gracias por descargar esta guía del usuario de Ephorus. Si tiene alguna pregunta, póngase en contacto con el usuario principal de Ephorus correspondiente a

Más detalles

INTRODUCCIÓN a la Web 2.0

INTRODUCCIÓN a la Web 2.0 INTRODUCCIÓN a la Web 2.0 Exámenes on line con that quiz Otra opción para realizar exámenes on line, en algunos casos ya creados es That quiz. Vamos a analizar su funcionamiento y las posibilidades que

Más detalles

RESUMEN. Solución web usable para la gestión de dispositivos móviles en empresas

RESUMEN. Solución web usable para la gestión de dispositivos móviles en empresas Agradecimientos RESUMEN. Solución web usable para la gestión de dispositivos móviles en empresas ... 1... 1... 1... 2... 3... 4... 4... 5... 6... 6... 9... 12... 13... 24... 25... 29... 30... 32... 33...

Más detalles

MANUAL DE USUARIO CMS- PLONE www.trabajo.gob.hn

MANUAL DE USUARIO CMS- PLONE www.trabajo.gob.hn MANUAL DE USUARIO CMS- PLONE www.trabajo.gob.hn Tegucigalpa M. D. C., Junio de 2009 Que es un CMS Un sistema de administración de contenido (CMS por sus siglas en ingles) es un programa para organizar

Más detalles

Manual: Gestor de contenidos e-gim cms. 6 abril 2010

Manual: Gestor de contenidos e-gim cms. 6 abril 2010 Manual: Gestor de contenidos e-gim cms 6 abril 2010 Índice 1 ACCESO AL GESTOR DE CONTENIDOS...3 2 ADMINISTRACIÓN...5 2.1 USUARIOS...5 2.2 ÁREAS...6 3 TIPOS DE CONTENIDO...9 3.1 DIRECTORIO...9 3.2 EVENTOS...10

Más detalles

ESCUELA SUPERIOR DE INFORMATICA Prácticas de Estadística UNA SESIÓN EN SPSS

ESCUELA SUPERIOR DE INFORMATICA Prácticas de Estadística UNA SESIÓN EN SPSS UNA SESIÓN EN SPSS INTRODUCCIÓN. SPSS (Statistical Product and Service Solutions) es un paquete estadístico orientado, en principio, al ámbito de aplicación de las Ciencias sociales, es uno de las herramientas

Más detalles

ICARO MANUAL DE LA EMPRESA

ICARO MANUAL DE LA EMPRESA ICARO MANUAL DE LA EMPRESA 1. ENTRANDO EN ICARO Para acceder al Programa ICARO tendremos que entrar en http://icaro.ual.es Figura 1 A continuación os aparecerá la página de Inicio del aplicativo ICARO.

Más detalles

Inscribirme en un nuevo Curso

Inscribirme en un nuevo Curso Para poder inscribirnos en un Curso de Natación de la FMD, tendremos que haber realizado previamente: 1. Crear nuestra Cuenta de Usuario, mediante el registro en la aplicación. (ver Crear mi cuenta de

Más detalles

UAM MANUAL DE EMPRESA. Universidad Autónoma de Madrid

UAM MANUAL DE EMPRESA. Universidad Autónoma de Madrid MANUAL DE EMPRESA Modo de entrar en ÍCARO Para comenzar a subir una oferta de empleo, el acceso es a través del siguiente enlace: http://icaro.uam.es A continuación, aparecerá la página de inicio de la

Más detalles

1 Itinerario. 2 Descripción y funcionalidades principales. Google Docs. 1.1 Qué vamos a hacer? 1.2 Qué pasos vamos a seguir?

1 Itinerario. 2 Descripción y funcionalidades principales. Google Docs. 1.1 Qué vamos a hacer? 1.2 Qué pasos vamos a seguir? Google Docs 1 Itinerario 1.1 Qué vamos a hacer? En este tutorial aprendemos a manejar la herramienta Google Docs, de esta forma nos introduciremos en el llamado cloud computing, que podemos traducir como,

Más detalles

Insertar Estadísticas de Google Analytics. Tutorial

Insertar Estadísticas de Google Analytics. Tutorial Insertar Estadísticas de Google Analytics Tutorial ÍNDICE 1. Cuentas de usuario de Google... 3 2. Acceder a Google Analytics... 3 3. Insertar el código en nuestra web... 7 4. Visualización de las Estadísticas...

Más detalles

Documentación del Terminal

Documentación del Terminal Documentación del Terminal 1. Descripción El Programa de Preventa-Autoventa FacturaPlus está diseñado para su utilización en PDAs incluyendo en este paquete además una aplicación para PC con la que gestionar

Más detalles

CATIE Manual de Administrador

CATIE Manual de Administrador CATIE Manual de Administrador En este manual comprende las instrucciones que debe seguir el administrador para ejecutar las acciones básicas que puede realizar en el panel de administración de la página

Más detalles

Manual básico para poner un Enlace Web en el Aula Virtual de Helvia.

Manual básico para poner un Enlace Web en el Aula Virtual de Helvia. Manual básico para poner un ENLACE WEB en el Aula Virtual de Helvia. (PASITO a PASITO) Por supuesto, lo primero que debemos hacer es, como ya sabemos, entrar en Helvia. Para ello debemos escribir en el

Más detalles

Para crear formularios se utiliza la barra de herramientas Formulario, que se activa a través del comando Ver barra de herramientas.

Para crear formularios se utiliza la barra de herramientas Formulario, que se activa a través del comando Ver barra de herramientas. Formularios TEMA: FORMULARIOS. 1. INTRODUCCIÓN. 2. CREACIÓN DE FORMULARIOS. 3. INTRODUCIR DATOS EN UN FORMULARIO. 4. MODIFICAR UN FORMULARIO 5. MANERAS DE GUARDAR UN FORMULARIO. 6. IMPRIMIR FORMULARIOS.

Más detalles

Manual CMS Mobincube

Manual CMS Mobincube Manual CMS Mobincube CMS Mobincube Qué es? El CMS (Sistema de Gestión de Contenidos) es un completo website que permite la creación y actualización de contenido remoto. De esta forma, una vez creada una

Más detalles

Título: Manual Básico de Calc. Parte I: Introducción a Calc de OpenOffice.org

Título: Manual Básico de Calc. Parte I: Introducción a Calc de OpenOffice.org Título: Manual Básico de Calc. Parte I: Introducción a Calc de OpenOffice.org Autora: Mª del Pilar Pavón Rosano DNI: 52.923.715-W INTRODUCCIÓN Este manual está dirigido a los alumnos y alumnas del módulo

Más detalles

TUTORIAL PARA REDIMENSIONAR FOTOS

TUTORIAL PARA REDIMENSIONAR FOTOS TUTORIAL PARA REDIMENSIONAR FOTOS Es extremadamente importante cuidar las imágenes con las que trabajamos en nuestro sitio Web y no subir fotografías a cualquier tamaño. Esto puede ralentizar considerablemente

Más detalles

Qué es una máquina virtual?

Qué es una máquina virtual? Instalación de Windows XP en una máquina virtual utilizando Sun VirtualBox. Vamos a empezar este tutorial dando una pequeña explicación acerca de que es una máquina virtual y luego vamos a proceder a instalar

Más detalles

Fuente: http://www.kzgunea.net

Fuente: http://www.kzgunea.net APRENDE A NAVEGAR INTERNET EXPLORER El navegador Internet Explorer ya lo tenemos integrado en el Sistema Operativo, en sus diferentes versiones desde Windows 95, por lo cual no tendremos que instalarlo.

Más detalles

Manual del Usuario de correo Webmail Consejo General de Educación INDICE

Manual del Usuario de correo Webmail Consejo General de Educación INDICE INDICE INDICE... 1 WEBMAIL... 3 QUE ES EL WEBMAIL?...3 COMO INGRESAR AL WEBMAIL?...3 1º Paso:...3 2º Paso:...4 3º Paso:...5 Bandeja de Entrada...5 De:...6 Fecha:...6 Asunto:...6 Tamaño:...6 CÓMO ESCRIBIR

Más detalles

MÓDULO 2: Manejar las ventanas de Windows. Antes de comenzar

MÓDULO 2: Manejar las ventanas de Windows. Antes de comenzar MÓDULO 2: Manejar las ventanas de Windows Antes de comenzar El funcionamiento de Windows está relacionado con su nombre, ventanas. El funcionamiento de las ventanas en Windows se mantiene invariable a

Más detalles

DESCARGA E INSTALACIÓN DE LA DOCUMENTACIÓN PARA LAS CLASES DEL API DE JAVA. CONSULTAR EN LOCAL O EN INTERNET? (CU00910C)

DESCARGA E INSTALACIÓN DE LA DOCUMENTACIÓN PARA LAS CLASES DEL API DE JAVA. CONSULTAR EN LOCAL O EN INTERNET? (CU00910C) APRENDERAPROGRAMAR.COM DESCARGA E INSTALACIÓN DE LA DOCUMENTACIÓN PARA LAS CLASES DEL API DE JAVA. CONSULTAR EN LOCAL O EN INTERNET? (CU00910C) Sección: Cursos Categoría: Lenguaje de programación Java

Más detalles

Presentaciones compartidas con Google Docs (tutorial)

Presentaciones compartidas con Google Docs (tutorial) Presentaciones compartidas con Google Docs (tutorial) G oogle Docs es una muy sencilla suite ofimática online que nos permite crear nuevos documentos, planillas de cálculo y presentaciones multimedia,

Más detalles

Año: 2008 Página 1 de 36

Año: 2008 Página 1 de 36 Lección 5. Entrada de cuentas de explotación 5.1. Proveedores y/o acreedores 5.1.1. Tipo Proveedor (400) 5.1.2. Tipo Acreedor (410) 5.1.3. Proveedor o acreedor ocasional 5.1.4. Copia del actual 5.1.5.

Más detalles

LAS CONSULTAS ACCESS 2007. Manual de Referencia para usuarios. Salomón Ccance CCANCE WEBSITE

LAS CONSULTAS ACCESS 2007. Manual de Referencia para usuarios. Salomón Ccance CCANCE WEBSITE LAS CONSULTAS ACCESS 2007 Manual de Referencia para usuarios Salomón Ccance CCANCE WEBSITE LAS CONSULTAS En esta unidad veremos cómo crear consultas y manejarlas para la edición de registros de tablas

Más detalles

HOOTSUITE: GESTOR DE CUENTAS EN REDES SOCIALES

HOOTSUITE: GESTOR DE CUENTAS EN REDES SOCIALES HOOTSUITE: GESTOR DE CUENTAS EN REDES SOCIALES Índice del curso 1. HootSuite Qué es?... 3 QUÉ ES?... 3 2. HootSuite Por qué?... 5 POR QUÉ?... 5 3. Registro... 6 REGISTRO... 6 4. Interfaz... 7 INTERFAZ...

Más detalles

Cómo comenzar a utilizar Dropbox

Cómo comenzar a utilizar Dropbox QUÉ ES DROPBOX? Dropbox es un programa que une todos los ordenadores que se quiera a través de una única carpeta, permitiendo hacer copias de seguridad y sincronizar archivos entre ordenadores. Dentro

Más detalles

Se accede pinchando en la opción Gestor bibliográfico Refworks del menú Aprendizaje e Investigación de la página WEB de la BURJC:

Se accede pinchando en la opción Gestor bibliográfico Refworks del menú Aprendizaje e Investigación de la página WEB de la BURJC: REFWORKS FORMAS DE ACCESO Se accede pinchando en la opción Gestor bibliográfico Refworks del menú Aprendizaje e Investigación de la página WEB de la BURJC: Los usuarios que se conecten por primera vez

Más detalles

MANUAL DEL PROGRAMA DE ASESORAMIENTO (Asesores) Navegador y limpiar caché/cookies...2 Acceso al programa de Asesoramiento... 7

MANUAL DEL PROGRAMA DE ASESORAMIENTO (Asesores) Navegador y limpiar caché/cookies...2 Acceso al programa de Asesoramiento... 7 MANUAL DEL PROGRAMA DE ASESORAMIENTO (Asesores) Índice Pasos previos a la visualización del programa: Navegador y limpiar caché/cookies...2 Acceso al programa de Asesoramiento... 7 Conceptos e información

Más detalles

Ministerio de Educación,Cultura y Deporte. Aulas en Red.Aplicaciones y servicios Windows. Módulo 3: Gestión de equipos.

Ministerio de Educación,Cultura y Deporte. Aulas en Red.Aplicaciones y servicios Windows. Módulo 3: Gestión de equipos. Ministerio de Educación,Cultura y Deporte. Aulas en Red.Aplicaciones y servicios Windows Módulo 3: Gestión de equipos. Escritorio Remoto Aulas en red. Aplicaciones y servicios. Windows Escritorio Remoto

Más detalles

ASÍ CONSIGUES QUE TU WEB FUNCIONE EN BUSCADORES:

ASÍ CONSIGUES QUE TU WEB FUNCIONE EN BUSCADORES: Tener una web no es sinónimo de aparecer en las primeras posiciones de los buscadores, ya que esto es una tarea complicada que lleva mucho tiempo. Para lograr una buena posición es necesario utilizar técnicas

Más detalles

Voy a intentar explicar por encima cómo funciona el Foro.

Voy a intentar explicar por encima cómo funciona el Foro. Voy a intentar explicar por encima cómo funciona el Foro. Cuando entráis al foro desde NUESTRA PAGINA o desde donde sea, por ejemplo a través de esta URL: http://server3.foros.net/index2.php?mforum=bmwcruisers

Más detalles

2. Seleccionar Insertar función:

2. Seleccionar Insertar función: Estadística I Curso 2014/2015 Guión de la Práctica 1 Introducción a la Estadística con Excel; Estadística Descriptiva En el siguiente guión vamos a ver cómo realizar Estadística Descriptiva con el software

Más detalles

Implementación de widgets Avaibook en Blogger

Implementación de widgets Avaibook en Blogger Implementación de widgets Avaibook en Blogger Introducción Blogger es un sistema de blogs como cualquier otro. Permite la publicación de entradas, páginas, etc. Mucha gente lo utiliza como página web personal

Más detalles

Contenido 1 INTRODUCCIÓN. Universidad Pablo de Olavide, de Sevilla Vicerrectorado de TIC, Calidad e Innovación

Contenido 1 INTRODUCCIÓN. Universidad Pablo de Olavide, de Sevilla Vicerrectorado de TIC, Calidad e Innovación GUÍA PARA INICIAR UN TRÁMITE ELECTRÓNICO Contenido 1 INTRODUCCIÓN... 1 2 PRESENTACIÓN DEL TRÁMITE ELECTRÓNICO... 2 2.1 Requisitos Técnicos... 3 2.2 Iniciación... 3 2.3 Firmar un documento... 9 2.4 Adjuntar

Más detalles

Gobierno del Estado de México

Gobierno del Estado de México Gobierno del Estado de México Escuela Preparatoria Oficial No. 82 José Revueltas Hay que alcanzar la exaltación verdadera, para lograrlo, hay que ser serenos, sin prisas, estudiar, trabajar y disciplinarse

Más detalles

TEMA 2 WINDOWS XP Lección 4 BLOC DE NOTAS

TEMA 2 WINDOWS XP Lección 4 BLOC DE NOTAS TEMA 2 WINDOWS XP Lección 4 BLOC DE NOTAS 1) EL PEQUEÑO EDITOR El Bloc de notas de Windows XP es un básico editor de texto con el que podemos escribir anotaciones, de hasta 1024 caracteres por línea y

Más detalles

Mejoras introducidas MARKETING GIO

Mejoras introducidas MARKETING GIO Mejoras introducidas MARKETING GIO El proceso lógico para hacer uso de la utilidad de marketing se tendrán en cuenta 3 puntos: 1. Segmentación de la base de datos de clientes, para determinar a quién va

Más detalles

Editor de textos para Drupal: TinyMCE

Editor de textos para Drupal: TinyMCE Editor de textos para Drupal: TinyMCE Cuando vayamos a editar el texto de una página, normalmente nos encontraremos con un editor de textos, similar a Word, pero para la web. Donde podamos usarlo encontraremos

Más detalles

Tutorial de Introducción a la Informática Tema 0 Windows. Windows. 1. Objetivos

Tutorial de Introducción a la Informática Tema 0 Windows. Windows. 1. Objetivos 1. Objetivos Este tema de introducción es el primero que debe seguir un alumno para asegurar que conoce los principios básicos de informática, como el manejo elemental del ratón y el teclado para gestionar

Más detalles

Prácticas de Introducción al uso de Computadores Curso 2001-2002 1 POWER POINT

Prácticas de Introducción al uso de Computadores Curso 2001-2002 1 POWER POINT Prácticas de Introducción al uso de Computadores Curso 2001-2002 1 POWER POINT Introducción PowerPoint es un programa para presentaciones gráficas que pueden incluir texto, imágenes, voz, sonido y vídeo.

Más detalles

TRABAJANDO CON BLOGGER

TRABAJANDO CON BLOGGER TRABAJANDO CON BLOGGER 1 La utilización de las etiquetas y la opción buscar pág.2 2 Cómo añadir autores y lectores a un blog pág.5 3 Añadir elementos a tu blog pág.7 a. Una barra de vídeo b. Una lista

Más detalles

Una plantilla es un modelo que puede servir como base para muchas hojas de cálculo. Puede incluir tanto datos como formatos.

Una plantilla es un modelo que puede servir como base para muchas hojas de cálculo. Puede incluir tanto datos como formatos. USAR PLANTILLAS Vamos a conocer y manejar con más precisión las opciones disponibles en Excel2010 a la hora de empezar un libro de trabajo, como puede ser el uso de plantillas como modelos que usaremos

Más detalles

DROPBOX. Qué es Dropbox? Cómo instalar el programa Dropbox?

DROPBOX. Qué es Dropbox? Cómo instalar el programa Dropbox? DROPBOX. Qué es Dropbox? Dropbox es una herramienta para archivar y sincronizar documentos utilizando Internet, donde los cambios a los documentos compartidos son realizados a tiempo real, siempre y cuando

Más detalles

Unidad 1. Introducción. Elementos de Excel

Unidad 1. Introducción. Elementos de Excel 1 Unidad 1. Introducción. Elementos de Excel Excel es un programa del tipo Hoja de Cálculo que permite realizar operaciones con números organizados en una cuadrícula. Es útil para realizar desde simples

Más detalles

Manual de usuario de Solmicro BI. Página 1

Manual de usuario de Solmicro BI. Página 1 Manual de usuario de Solmicro BI Página 1 Índice 1. Estructura general del sistema, 2. Estructura de presentación de la información, 3. Acceso a Solmicro BI y los diferentes cuadros de mando, 4. Partes

Más detalles

CÓMO CREAR NUESTRO CATÁLOGO

CÓMO CREAR NUESTRO CATÁLOGO CÓMO CREAR NUESTRO CATÁLOGO Mediante la aplicación (http://www.prensasoft.com/programas/conline) podemos crear nuestros propios catálogos. Para crear un catálogo necesitamos: - Varios productos que mostrar,

Más detalles

Guía N 1: Fundamentos básicos(i)

Guía N 1: Fundamentos básicos(i) 1 Guía N 1: Fundamentos básicos(i) Objetivos Generales: Ver una breve descripción de las capacidades más comunes de Excel Objetivos específicos: Descripción de los elementos de un libro: Hojas, iconos,

Más detalles

MANUAL PARA GESTIÓN DE INCIDENCIAS INFORMÁTICAS

MANUAL PARA GESTIÓN DE INCIDENCIAS INFORMÁTICAS MANUAL PARA GESTIÓN DE INCIDENCIAS INFORMÁTICAS En este manual aprenderemos a introducir un Ticket de Soporte (Incidencia Informática) y ver todo el proceso hasta que se resuelve. Para poder escribir Tickets

Más detalles

Bloque 2 EL AULA MOODLE DESDE EL PUNTO DE VISTA DEL ALUMNO(I) Utilidades básicas y acceso a recursos de aprendizaje

Bloque 2 EL AULA MOODLE DESDE EL PUNTO DE VISTA DEL ALUMNO(I) Utilidades básicas y acceso a recursos de aprendizaje EL AULA MOODLE DESDE EL PUNTO DE VISTA DEL ALUMNO(I) Utilidades básicas y acceso a recursos de aprendizaje Cuando un alumno entra en su aula moodle, dispone de unas utilidades básicas, definidas por la

Más detalles

Una App para Facebook

Una App para Facebook Una App para Facebook Static HTML: Iframes Tabs Laboratorio de Excelencia Digital Facebook Marketing 1 Una App para Facebook. Static HTML: Iframes Tabs Facebook Marketing El objetivo de este articulo es

Más detalles

GUÍA DE USUARIO DEL CORREO

GUÍA DE USUARIO DEL CORREO REPÚBLICA BOLIVARIANA DE VENEZUELA MINISTERIO DEL PODER POPULAR PARA LA EDUCACIÓN DIRECCIÓN GENERAL DE LA OFICINA DE ADMINISTRACIÓN Y SERVICIOS DIVISIÓN DE SOPORTE TÉCNICO Y FORMACIÓN AL USUARIO GUÍA DE

Más detalles

MANUAL DE USO PROGRAMA DE GESTIÓN AGENCIAS DE VIAJES

MANUAL DE USO PROGRAMA DE GESTIÓN AGENCIAS DE VIAJES MANUAL DE USO PROGRAMA DE GESTIÓN AGENCIAS DE VIAJES Estructura general... 2 Pantalla General de Reservas... 3 Alta de una reserva Pantalla de un expediente... 5 Manejo de Documentos... 7 Ejemplo de un

Más detalles

Manual de guía para Clientes Sistema MoTrack

Manual de guía para Clientes Sistema MoTrack Manual de guía para Clientes Sistema MoTrack Contenido 1) introducción 2) Ingresar 3) Principal 4) Mapas 4.1) Mapa de los Móviles 4.2) Mapa de Flota de Móviles 5) Reportes 5.1) Reportes Detallados Reportes

Más detalles

Accesibilidad web GUÍA FUNCIONAL

Accesibilidad web GUÍA FUNCIONAL Accesibilidad web GUÍA FUNCIONAL 0 _ ÍNDICE 01_Introducción 02_Primeros pasos 03_Conceptos 04_Navegación por voz 05_Navegación por teclado 06_Navegación por sonido 07_Compatibilidad con lectores de pantalla

Más detalles

Manual Wikispaces. Seminario Especializado 2009 PRONIE MEP FOD. A. Otárola Villalobos. Asesor Informática Educativa III Ciclo

Manual Wikispaces. Seminario Especializado 2009 PRONIE MEP FOD. A. Otárola Villalobos. Asesor Informática Educativa III Ciclo 1 Manual Wikispaces Seminario Especializado 2009 PRONIE MEP FOD A. Otárola Villalobos Asesor Informática Educativa III Ciclo 2 Contenido Crear un wiki educativo en wikispaces...3 Administrar espacio: configuración

Más detalles

1. CREAR UNA CUENTA GRATUITA DE MOODLE

1. CREAR UNA CUENTA GRATUITA DE MOODLE 1. CREAR UNA CUENTA GRATUITA DE MOODLE Para poder operar con la plataforma Moodle deberemos disponer de un servidor externo donde cobijemos nuestros cursos; existen diversas formas para ello: utilizar

Más detalles

COMO CREAR UNA PÁGINA WEB 2-INTRODUCCIÓN A DREAWEAVER

COMO CREAR UNA PÁGINA WEB 2-INTRODUCCIÓN A DREAWEAVER 2011 2012 COMO CREAR UNA PÁGINA WEB 2-INTRODUCCIÓN A DREAWEAVER WWW.FAUBELL.COM vicente@faubell.com Hasta ahora hemos visto una pequeña introducción a la creación de las páginas web. No te preocupes por

Más detalles

3.4. Reload Editor ( Guía de Uso).

3.4. Reload Editor ( Guía de Uso). 3.4. Reload Editor ( Guía de Uso). Anterior 3. Lors Management Siguiente 3.4. Reload Editor ( Guía de Uso). 3.4.1. Preguntas básicas sobre Reload Editor. - Qué hace el programa Reload Editor? RELOAD Editor

Más detalles

Archivo de correo con Microsoft Outlook contra Exchange Server

Archivo de correo con Microsoft Outlook contra Exchange Server Archivo de correo con Microsoft Outlook contra Exchange Server Resumen Con este proceso de archivado, lo que pretendemos es guardar nuestro correo en un archivo de datos, para así poder realizar una copia

Más detalles

vbnmqwertyuiopasdfghjklzxcvbnmrty uiopasdfghjklzxcvbnmqwertyuiopasdf ghjklzxcvbnmqwertyuiopasdfghjklzxc

vbnmqwertyuiopasdfghjklzxcvbnmrty uiopasdfghjklzxcvbnmqwertyuiopasdf ghjklzxcvbnmqwertyuiopasdfghjklzxc vbnmqwertyuiopasdfghjklzxcvbnmrty uiopasdfghjklzxcvbnmqwertyuiopasdf ghjklzxcvbnmqwertyuiopasdfghjklzxc COMBINACIÓN DE CARTAS Y CORRSPONDENCIA vbnmqwertyuiopasdfghjklzxcvbnmqw ertyuiopasdfghjklzxcvbnmqwertyuiop

Más detalles

Manual de configuración de Thunderbird ÍNDICE

Manual de configuración de Thunderbird ÍNDICE Manual de configuración de Thunderbird ÍNDICE 1. ARRANCANDO THUNDERBIRD POR PRIMERA VEZ... 2 2. ARRANCANDO THUNDERBIRD POR N-ÉSIMA VEZ... 2 3. CONFIGURACIÓN DE CUENTA DE CORREO... 4 4. SERVICIO DE DIRECTORIO

Más detalles

15 CORREO WEB CORREO WEB

15 CORREO WEB CORREO WEB CORREO WEB Anteriormente Hemos visto cómo funciona el correo electrónico, y cómo necesitábamos tener un programa cliente (Outlook Express) para gestionar los mensajes de correo electrónico. Sin embargo,

Más detalles

Informática. Cómo haría yo un blog y un moodle?

Informática. Cómo haría yo un blog y un moodle? 1 Informática Cómo haría yo un blog y un moodle? El paso más complicado es la búsqueda y organización de la información que vamos a incluir en nuestro blog o en el moodle. Para facilitar el trabajo es

Más detalles

FILTRO ANTISPAM GUÍA DE CONFIGURACIÓN PARA CUENTAS POP

FILTRO ANTISPAM GUÍA DE CONFIGURACIÓN PARA CUENTAS POP FILTRO ANTISPAM GUÍA DE CONFIGURACIÓN PARA CUENTAS POP Paseo de la Innovación, 3 PARQUE CIENTÍFICO Y TECNOLÓGICO DE CLM ALBACETE. 902 014 537. info@areaproject.com. www.areaproject.com MANUAL DE CONFIGURACIÓN

Más detalles

- saber qué son la World Wide Web y las páginas Web - aprender a usar el navegador Explorer - conocer el sitio Web del Portal EDUCANTABRIA

- saber qué son la World Wide Web y las páginas Web - aprender a usar el navegador Explorer - conocer el sitio Web del Portal EDUCANTABRIA Objetivos: - saber qué son la World Wide Web y las páginas Web - aprender a usar el navegador Explorer - conocer el sitio Web del Portal EDUCANTABRIA Contenidos: 1.- La World Wide Web 2.- El navegador

Más detalles

INTRODUCCION al software DS WINSLOT con DS Live WEB SERVER instalado.

INTRODUCCION al software DS WINSLOT con DS Live WEB SERVER instalado. El sistema de cronometraje utilizado en la mayoría de clubes y las mejores competiciones españolas incluidas todas las 24h de Resistencia, expande su uso a los pasados Campeonatos Italianos, donde también

Más detalles

Instalación del programa PSPP y obtención de una distribución de frecuencias.

Instalación del programa PSPP y obtención de una distribución de frecuencias. Práctica 2. Instalación del programa PSPP y obtención de una distribución de frecuencias. Con esta práctica instalaremos el programa PSPP. El programa es un software específico para el análisis estadístico

Más detalles

Capítulo 9. Archivos de sintaxis

Capítulo 9. Archivos de sintaxis Capítulo 9 Archivos de sintaxis El SPSS permite generar y editar archivos de texto con sintaxis SPSS, es decir, archivos de texto con instrucciones de programación en un lenguaje propio del SPSS. Esta

Más detalles

TUTORIAL PARA GESTIONAR EL ESPACIO PERSONALIZADO DE UNA ASOCIACIÓN

TUTORIAL PARA GESTIONAR EL ESPACIO PERSONALIZADO DE UNA ASOCIACIÓN TUTORIAL PARA GESTIONAR EL ESPACIO PERSONALIZADO DE UNA ASOCIACIÓN SOMOS PACIENTES ENERO 2012 1 Introducción Este tutorial pretende ser una guía sencilla y rápida, dirigida a las organizaciones de pacientes

Más detalles

Ideas. Imágenes. Recursos. Entramos en www.popplet.com. O buscamos en google: popplet.

Ideas. Imágenes. Recursos. Entramos en www.popplet.com. O buscamos en google: popplet. Recursos Imágenes Ideas Vídeos Fotos Entramos en www.popplet.com. O buscamos en google: popplet. Si es nuestra primera vez y por lo tanto no tenemos cuenta, nos registramos pinchando aquí: Sign up Completaremos

Más detalles

TUTORIAL ENVIO SMS MASIVOS. 1. Segmentación de la base de datos de clientes

TUTORIAL ENVIO SMS MASIVOS. 1. Segmentación de la base de datos de clientes TUTORIAL ENVIO SMS MASIVOS Para hacer uso de la utilidad de envío de SMS se tendrán en cuenta 3 puntos: 1. Segmentación de la base de datos de clientes, para determinar a quién va dirigido 2. Diferentes

Más detalles

Una plantilla es un documento de Word 2003 con la característica de que el tipo de documento es plantilla de documento (.dot).

Una plantilla es un documento de Word 2003 con la característica de que el tipo de documento es plantilla de documento (.dot). Unidad 3. Plantillas Objetivos de la unidad: Una plantilla es un documento prediseñado que usted puede usar para crear nuevos documentos con el mismo formato. A través de una plantilla, el aspecto de un

Más detalles

PLATAFORMA EDUCATIVA DE LA JCYL ENLACES A TUTORIALES DE INTERÉS:

PLATAFORMA EDUCATIVA DE LA JCYL ENLACES A TUTORIALES DE INTERÉS: PLATAFORMA EDUCATIVA DE LA JCYL ENLACES A TUTORIALES DE INTERÉS: CURSO PLATAFORMA JCYL http://soporte.centros.educa.jcyl.es/sitio/ http://auvja.blogspot.com.es/search/label/manuales Entramos como administradores

Más detalles

OpenOffice Writer LA PÁGINA

OpenOffice Writer LA PÁGINA 4: CONFIGURARC LA PÁGINA Cuando se escribe de forma manual se empieza por elegir el tamaño del papel, su orientación y los márgenes. En un procesador de texto, como Writer, estas operaciones que habitualmente

Más detalles

Descarga e instalación de Visual Basic. Entorno de programación (IDE). Visual Studio (CU00304A)

Descarga e instalación de Visual Basic. Entorno de programación (IDE). Visual Studio (CU00304A) aprenderaprogramar.com Descarga e instalación de Visual Basic. Entorno de programación (IDE). Visual Studio (CU00304A) Sección: Cursos Categoría: Curso Visual Basic Nivel I Fecha revisión: 2029 Autor:

Más detalles

Una breve introducción a Excel c

Una breve introducción a Excel c Una breve introducción a Excel c Martes 22 de febrero de 2005 Curso de Formación continua en Matemáticas UAM Curso 2004/2005 1. Introducción Excel c es una aplicación de hojas de cálculo electrónicas:

Más detalles

Servicio WWW World Wide Web Office Express

Servicio WWW World Wide Web Office Express Servicio WWW World Wide Web Office Express 2000 Ciclo de Cursos Abiertos a la Comunidad Facultad de Ciencias Exactas, Ingeniería y Agrimensura. Rosario. Servicios de Internet Qué es el servicio WWW (World

Más detalles

Capítulo 2. Google Calendar

Capítulo 2. Google Calendar Capítulo 2. Google Calendar Google Calendar es un espacio personal gratuito que ofrece Google a todos aquellos que disponen de una cuenta de GMail para que puedan crear, gestionar y compartir eventos dentro

Más detalles

Mi correo con OUTLOOK

Mi correo con OUTLOOK Mi correo con OUTLOOK En este manual vamos a ver los pasos necesarios para configurar nuestra cuenta de correo. En primer lugar, ejecutaremos nuestro cliente outlook. Si es la primera vez que ejecutamos

Más detalles