Radón Cáncer de pulmón Bases moleculares

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Radón Cáncer de pulmón Bases moleculares"


1 Radón Cáncer de pulmón Bases moleculares UNIVERSIDAD SANTIAGO DE COMPOSTELA Curso de Verano 2008 Actualización del Gas Radón Como factor de riesgo ambiental para la salud humana: Implicaciones de las Administraciones, De los profesionales y los ciudadanos Director PROF. XOAN MIGUEL BARROS DIOS Área de Medicina Preventiva e Saúde Pública Fundación Centro Oncológico de Galicia José Antonio Quiroga y Piñeiro La Coruña Dra. Arantxa García Servicio de Genética Molecular y Radiobiología

2 Radón Conceptos básicos

3 Decaimiento del radón. Durante el proceso de desintegración del radón y sus progenies se emiten distintos tipos de radiación ionizante con distintos efectos: 1.-Radón-222: particulas alfa. 2.-Polonio-218: partículas alfa. 3.-Plomo-214: partículas beta y rayos gamma. 4.-Bismuto-214: partículas beta y rayos gamma. 5.-Polonio-214: partículas alfa.

4 Transferencia Lineal de Energía. LET. 1.- Indica la cantidad de energía "depositada" por la radiación en el medio continuo que es atravesado por ella, o la energía transferida por unidad de longitud. 2.- Se relaciona directamente con dos propiedades: - La capacidad de penetración - La cantidad de "dosis" que deposita. 3.- El valor de la LET depende: - Tipo de radiación - Medio material traspasado por ella

5 Radiaciones ionizantes. a.- Radiación alfa Flujos de partículas cargadas positivamente: núcleos de Helio 1.- Poco penetrantes. 2.- Muy ionizantes, LET, muy energéticas. 3.- Un haz deposita toda su energía en una región pequeña del medio perderá su energía rápidamente no podrá atravesar grosores dejará una dosis alta de energía en el material. b.- Radiación beta Tipos de Radiación Alfa c.- Radiación gamma Beta Rayos X Gamma Neutrones Aluminio Plomo Hormigón

6 Radiaciones ionizantes. a.- Radiación alfa b.- Radiación beta Flujos de electrones (beta negativas) o positrones (beta positivas) 1.- Más penetrante que la radiación alfa, aunque su poder de ionización no es tan elevado. Tipos de Radiación Alfa Beta Rayos X Gamma Neutrones Aluminio Plomo Hormigón c.- Radiación gamma

7 Radiaciones ionizantes. a.- Radiación alfa Tipos de Radiación Alfa b.- Radiación beta Beta Rayos X Gamma Neutrones Aluminio Plomo Hormigón c.- Radiación gamma Ondas electromagnéticas de longitud corta 1.- El tipo más penetrante de radiación. 2.- Se necesitan capas muy gruesas de plomo u hormigón para detenerlos, LET. 4.- Un haz deposita su energía ocasionalmente antes de haber perdido toda su energía atravesará un gran espesor de material dejará una dosis baja de energía en el medio que atraviesa.

8 Sonda de ADN global DBD-FISH Dosis de Radiación Sonda de ADN del locus DXZ1


10 Radiobiología. Una radiación alfa o beta es relativamente poco peligrosa fuera del cuerpo por el contrario es extremadamente peligrosa cuando se inhala Las radiaciones gamma son siempre dañinas xq se neutralizan con dificultad El riesgo para la salud depende de un conjunto de factores: -Intensidad de la radiación - Duración de la exposición - Factores de tipo físico, químico y biológico, como el tipo de tejido afectado y su capacidad de absorción. EN GENERAL, la radiación alfa externa no es peligrosa porque las partículas son absorbidas en unos pocos centímetros de aire o por la delgada capa de piel muerta de la persona. Tocar una fuente alfa no suele ser dañino, pero su ingestión, inhalación o introducción en el cuerpo puede serlo, dependiendo de la cantidad incorporada al organismo.


12 La célula Conceptos básicos

13 La célula. Su relación con el medio. Cascada de señalización molecular Receptor Ligando 1 er mensajero Precursor 2º mensajero Transductores de señales Respuesta celular

14 La célula. Transducción de señales. Ligando Receptor de membrana activo Proteínas señalizadoras efectores de la vía MEMBRANA Factor de transcripción activo CITOPLASMA Transcripción RESPUESTA CELULAR ADN ARN NUCLEO REGULACION DE LA ANGIOGENESIS REGULACION DE LA PROLIFERACION REGULACION DE LA APOPTOSIS

15 La célula. Control del ciclo celular.

16 Genética Conceptos básicos

17 Genética. Conceptos básicos. 1.- Cada ser vivo tiene un FENOTIPO o apariencia física debido a que tiene un GENOTIPO o composición genética única 2.- Todas las células de un mismo organismo contienen la misma información genética 3.- Independiente de cual sea la fuente de material genético vamos a obtener una ADN idéntico 4.- La diferenciación celular no implica perdida de material genético salvo en raras ocasiones 5.- Las células tumorales se originan de una célula normal que ha experimentado alteraciones genéticas 6.- El genotipo de la célula tumoral difiere sutilmente del genotipo de la célula normal de la cual se origina

18 El ADN. Transmisión de la información genética.

19 El gen: Unidad transcripcional. Transmisión de la información genética. Región promotora Intrón 1 Intrón 2 Intrón 3 Región 3 Exón 1 Exón 2 Exón 3 Exón ADN 5 Región de unión a Factores de transcrición TATA-box CCAAT-box Pto de inicio de la transcripción Transcripción Intrón 1 Intrón 2 Intrón 3 Región ARN Transcrito primario Exón 1 Exón 2 Exón 3 Exón 4 AUG Codón de inicio de traducción GT AG GT AG GT AG UGA, UAA, UAG Codón de stop de la traducción 3.- ARNm Transcrito maduro 4.- Proteína Splicing Maduración CAP 5 AUG Región 5 UTR Traducción Cola Poli-A Región 3 UTR

20 Cáncer Bases moleculares Conceptos básicos

21 Cáncer. Qué es? Cáncer Es una expansión clonal que incumple las "normas del comportamiento social" celular La base patogénica de la enfermedad se basa en la acumulación progresiva de alteraciones genéticas y epigenéticas en múltiples etapas que actúan de forma cooperativa, no letal y les confiere una ventaja selectiva frente al resto de la población celular que da lugar a la expansión clonal incontrolada Bishop JM. Science 1987 Volgenstein B and Kinzler KW, Trends Gen 1993

22 1.- Cuál es la base del desarrollo tumoral? 2.- Que genes están implicados en la oncogénesis? 3.- Qué funciones celulares se alteran en las células tumorales?

23 1.- Cuál es la base de la oncogénesis o desarrollo tumoral? la acumulación progresiva de lesiones genéticas cooperativas y NO letales Se alteran las funciones celulares normales y proporcionan una ventaja selectiva que conduce al crecimiento celular CLONAL descontrolado Epitelio normal Adenoma precoz Adenoma intermedio Adenoma tardío Desequilibrio entre crecimiento y muerte celular Carcinoma M E T A S T A S I S

24 2.- Que genes están implicados en la oncogénesis? 1.- Gatekeeper o porteros Promueven DIRECTAMENTE el desarrollo tumoral COMO? Promoviendo el crecimiento celular o inhibiendo la muerte celular programada -apoptosis- 2.- Caretakers o guardianes Promueven INDIRECTAMENTE el desarrollo tumoral COMO? aumentan la tasa global de mutación y la inestabilidad del material genético pudiendo afectar a un gen portero

25 Tipos de genes Gatekeeper o porteros 1.- Oncogenes 1.- Gatekeeper o porteros 2.- Genes supresores de tumores

26 Tipos de genes Gatekeeper o porteros. Oncogenes 1.- Gatekeeper o porteros 1.- Oncogenes 1a.- Codifican proteínas PROMOTORAS de la proliferación celular 1b.- Efecto DOMINANTE: La ALTERACION de UNA de las copias o ALELOS supone una GANANCIA función 2.- Genes supresores de tumores

27 Tipos de genes Gatekeeper o porteros. Oncogenes a.- Los protooncogenes y el crecimiento normal de las células b.- Los oncogenes son formas mutantes de los protooncogenes

28 Tipos de genes Gatekeeper o porteros. Oncogenes Oncogenes

29 Tipos de genes Gatekeeper o porteros. Genes Supresores de Tumores GST- 1.- Oncogenes 1.- Gatekeeper o porteros 2.- Genes supresores de tumores 2a.- Codifican proteínas INHIBIDORAS de la proliferación celular 2b.- Efecto RECESIVO es necesaria ALTERACION de las DOS copias o ALELOS (Hipótesis de Knudson)

30 Tipos de genes Gatekeeper o porteros. Genes Supresores de Tumores GST- Genes Supresores de Tumores (GST)

31 Tipos de genes Gatekeeper o porteros. Genes Supresores de Tumores GST- Los GST actúan como pedal de freno

32 Hipótesis de Knudson. A.- CANCER ESPORADICO. Ambos alelos del GST son normales Ventaja selectiva Deleción de la 2ª copia Progresión tumoral Ambos cromosomas portan alelos wildtype 1 3r evento Mutación de una de las copias del gen 2º evento Alteración de la segunda copia del gen por mecanismos genéticos o epigenéticos B.- CANCER FAMILIAR. Porta una alteración en una de las copias del GST en línea germinal Ventaja selectiva Deleción de la 2ª copia Progresión tumoral 1 3r evento Se hereda en línea germinal una copia defectuosa del GST 2º evento Alteración de la segunda copia del gen por mecanismos genéticos o epigenéticos

33 Mecanismo de la patogenia neoplásica. Origen y evolución clonal Tejido normal alteración de uno de los alelos 2 a mutación del 2º alelo del gen caretaker aumento de inestabilidad genética 1 a mutación del 1 er alelo del gen gatekeeper 2 a mutación del 2º alelo del gen gatekeeper Caretaker Gen guardian promueve el desarrollo tumoral de forma INDIRECTA Gatekeeper Ventaja selectiva Gen portero promueve 2 a mutación el desarrollo del 2º alelo tumoral del de gen forma gatekeeper DIRECTA Tejido neoplásico

34 Cáncer Bases Moleculares Alteraciones genéticas

35 Alteraciones genéticas. A.- Como se alteran los genes Gatekeeper o porteros y los Caretakers o guardianes implicados en la oncogénesis? 1. - Alteraciones numéricas Perdidas/ganancias parciales/totales 2.- Alteraciones estructurales Translocaciones, inversiones, delecciones

36 Alteraciones genéticas. 3.- Alteraciones en la secuencia del ADN Mutaciones puntuales, deleciones, inserciones, amplificaciones

37 Alteraciones genéticas. Ejemplos. GEN EGFR en el NSCLC. Marcador genético de respuesta a tto con terapias dirigidas: Inhibidores TyrK (gefitinib Iressa- y erlotinib Tarceva-). Ejemplo: alteración genética, polimorfismo y mutación puntual. Mutación puntual Transición: ctc ccc Cambio aac: de Leu Pro Polimorfismo Transición: cag caa Ambos codifican Glu No altera el ORF

38 Alteraciones genéticas. Ejemplos. GEN EGFR en el NSCLC. Marcador genético de respuesta a tto con terapias dirigidas: Inhibidores TyrK (gefitinib Iressa- y erlotinib Tarceva-). Ejemplo: alteración genética, inserción de un triplete. ins TTG inserción 1 val

39 Cáncer Bases Moleculares Alteraciones epigenéticas Conceptos básicos

40 Alteraciones epigenéticas. Conceptos básicos. La genética clásica NO explica la variedad de fenotipos presentes en la población. La epigenética proporciona una explicación parcial. Mecanismos epigenéticos normales alterados Diferenciación celular: Células embrionarias, hematopoyéticas Célula Neoplasia Precursora maligna Waddintong CH PNAS 1939

41 Alteraciones epigenéticas. Conceptos básicos. Los mecanismos epigenéticos afecta a la integridad del genoma la estabilidad cromosómica y la regulación de la expresión de genes implicados en la diferenciación, el ciclo y supervivencia celular La alteración induce, una ventaja selectiva que puede conducir al desarrollo tumoral Mecanismos epigenéticos normales alterados Diferenciación celular: Células embrionarias, hematopoyéticas Célula Precursora maligna Neoplasia

42 Alteraciones epigenéticas. Conceptos básicos. Mecanismos epigenéticos cambios en las pautas de expresión génica mediante modificaciones químicas que NO AFECTAN a la secuencia nucleotídica primaria de un gen ADN GENOMA Cromatina (ADN + Proteínas) EPIGENOMA PUENTE Son cambios de carácter hereditario cualitativos (±) y cuantitativos potencialmente reversible Gene Expression FENOTIPO 1.- Goldberg AD et al. Cell Bernstein BE et al. Cell 2007

43 Alteraciones epigenéticas. Conceptos básicos. Principales mecanismos epigenéticos 1.- Modificación de las proteínas que conforman la cromatina (histonas y proteínas no histónicas) 2.- Metilación de la mólecula de ADN Acetilación de Histonas Modificaciones post-traduccionales Metilación de Histonas Ac Me Me Me DNA Methylation 1.- Jones PA, Baylin SB. Cell Kouzarides T. Cell Esteller M. Nat Rev Genet 2007

44 Cáncer Bases Moleculares Alteraciones epigenéticas Modificaciones en la estructura de la cromatina

45 La cromatina. El ADN celular en eucariotas se empaqueta en forma de nucleoproteína la cromatina Implicada en: transcripción, replicación y reparación del ADN En función de su estado, laxo o compactado, permitirá acceder a los factores necesarios para tales funciones Histonas ADN Nucleosoma Cromatina

46 La expresión génica o transcripción requiere que el ADN sea físicamente accesible cromatina compactada FT NO acceden al ADN cromátina laxa FT acceden al ADN FT FT Ac Ac Ac Ac Ac Ac Ac Ac Ac expresión génica silenciamiento génico Los cambios que alteran la estructura de la cromatina determinan si el ADN es accesible o no para ser transcrito.

47 Balance entre en el nivel de acetilación de las histonas Es un factor clave en la regulación de la transcripción en las células normales Histonas Desacetiladas Cromatina cerrada Los FT NO acceden al ADN Histonas Acetiladas Cromatina abierta Los FT acceden al ADN Silenciamiento HAT Expresión FT Acetilación de histonas De-acetilación de histonas Ac Ac Ac FT Ac Ac Ac Ac Ac Ac HDAC El incremento en la actividad de las enzimas HDAC o disminución de la actividad HAT puede inducir la expresión anómala de un gen contribuyendo al desarrollo tumoral

48 Cáncer Bases Moleculares Alteraciones epigenéticas Modificaciones en la molécula de ADN

49 Cáncer. Metilación del ADN. Metilación del promotor en línea germinal Metilación del promotor diferenciación Célula stem Célula somática stem Célula diferenciada Hipometilación genómica Hipermetilación de los promotores y mutaciones genética Célula Tumoral -Hipometilación genómica global - Hipermetilación de promotores específicos -metilomacélula diferenciada célula indiferenciada célula pretumoral Célula neoplásica

50 2.- Alteraciones epigenéticas. Alteraciones en la molécula de ADN. Metilación del ADN Metilación de las Citosinas ppalm en las regiones ricas en CpG IRREGULAR en baja % a lo largo del genoma INTERCALANDOSE regiones con una concentración (Islas CpG) Región promotora INACTIVACION hipermetilación de las islas CpG

51 2.- Alteraciones epigenéticas. Hipermetilación de las islas CpG y cáncer. 1.- Célula Normal Promotor Exón 1 Exón 2 Exón 3 Intrón 1 Intrón 2 EXPRESIÓN GÉNICA 2.- Célula Tumoral Promotor Exón 1 Exón 2 Exón 3 Intrón 1 Intrón 2 INHIBICIÓN DE EXPRESIÓN GÉNICA CpG NO metilado en regiones PROMOTORAS CpG metilado en regiones PROMOTORAS CpG NO metilado en regiones NO REGULADORAS CpG metilado en regiones NO REGULADORAS

52 Cáncer Bases Moleculares Alteraciones genéticas y epigenéticas Diferencias y correlaciones

53 Cáncer. Bases moleculares: Alteraciones genética y epigenéticas. Alteraciones genéticas Molécula de ADN Alteraciones epigenéticas Cromatina (ADN + histonas) Ejemplo Errores en la replicación Secuencia de ADN alterada El cambio en la secuencia del ADN se trasmite desde el ADN RNAm proteína Efectos cooperativos Oncogénesis Se altera la expresión del gen sin modificar la secuencia del ADN Ejemplo Metilación del ADN Modificación de histonas Incrementa/disminuye el nivel de RNAm proteína Neoplasia 1.- Bolden JE et al. Nat Rev Drug Discov Rieger PT Semin Oncol Nurs Croce CM N Engl J Med Bolden JE et al. Nat Rev Drug Discov Miranda E et al. Br J Cancer Esteller M. N Engl J Med Feinberg AP. Nature 2007

54 Cómo interactúan las alteraciones genéticas y epigenéticas? Los cambios GENETICOS Los cambios EPIGENETICOS cualitativos (±) y cuantitativos (%) Cualitativos (±) PROCESO REVERSIBLE y e potencialmente reversibles irreversibles El tto debe ser administrado (tto con terapias dirigidas) a lo largo de la vida Tanto las alteraciones genéticas como epigenéticas del paciente son estables para ser heredadas sus efectos son similares Incremento de la función de oncogenes Inhibición de la función de GST por tanto, alterar o anular el producto final: la proteína Diferencia significativa los cambios genéticos son irreversibles los cambios epigenéticos son potencialmente reversibles mediante tratamientos específicos. 1.- Jones PA, Baylin SB. Cell Esteller M. Eur J Cancer Miranda E et al. Br J Cancer 2006

55 Cáncer Funciones alteradas Conceptos básicos

56 Funciones alteradas de las células tumorales Hanahan D & Weinberg RA, Cell 2000

57 Existe una clara correlación entre el perfil genético-epigenético y tipo tumoral El efecto de estas va a depender del tipo celular concreto en el cual se exprese xq? Hipótesis Una población de un tipo celular concreto en continua renovación un gen o genes son los principales responsables de mantener la proporción celular constante Una mutación en un gen gatekeeper o portero conduciría a la pérdida del equilibrio entre crecimiento y muerte celular. Las mutaciones en otros genes dentro de un tipo celular específico NO tendrían efecto a largo plazo siempre cuando su gen/es gatekeeper/s específico/s funcionasen correctamente. Kinzler K, Volgenstein B, Cell 1996

58 Radón Cáncer de pulmón Epigenética Traslación clínica Detección temprana Pronóstico Terapia epigenética

59 Análisis de los promotores de genes implicados en el desarrollo y conducta biológica de los tumores de pulmón NSCLC. 1.- Detección Seguimiento de la enfermedad 2.- Pronóstico 3.- Terapia epigenética 1.- Brock et al, Genes: p16, CDH13, APC, MGMT, RASSF1A, ASC/PYCARD y DAPK. Metiotipo asociado Metilación p16, CDH13, RASSF1 y APC Factor pronóstico independiente asociado con recurrencia Se duplica si esta presente en los ganglios del mediastino Detección temprana de micrometástasis 1.- p16. Evento temprano en el proceso de desarrollo del cáncer de pulmón (Belinsky SA et al, 1998). Implicado en el control del ciclo celular. La falta de proteína p16 se asocia a un incremento de la proliferación. 2.- CDH13 (H-cadherina). Media, entre otras funciones, en la adhesión celular: El silenciamiento de este gen se asocia a la adquisición de capacidad invasiva y metástasis. 3.- RASSF1A. La alteración de la expresión de este gen es un evento que se produce en las fases iniciales del desarrollo tanto del cáncer de pulmón de células pequeñas como no pequeñas. Actúa como regulador negativo de ciclo celular y positivo de la apoptosis; el silenciamiento génico de este locus induce los efectos contrarios a los descritos. 4.- APC. La modificación epigenética de su región reguladora se ha descrito como suceso temprano en el inicio del desarrollo tumoral. Al igual que el anterior, la inhibición de la transcripción de este gen se correlaciona con invasión y metástasis. 5.- MGMT. Esta implicado en los mecanismos de reparación del ADN, en concreto, en eliminar los aductos generados por los agentes alquilantes. 6.- ASC/PYCARD. Este gen codifica una proteína proapoptótica mediante el reclutamiento de caspasas, mediadoras esenciales en la muerte celular programada. Las caspasas son responsables del procesamiento de productos que desencadenan cambios celulares que incluyen la degradación del ADN, condensación de cromatina y la desintegración de la membrana plasmática. 7.- DAPK. La alteración epigenética de este gen también es un evento temprano de la tumorogénesis. Este gen codifica una proteína que actúa en un punto de control en el inicio del proceso de apoptosis. Es capaz de eliminar células premalignas evitando el posible desarrollo tumoral

60 Análisis de los promotores de genes implicados en el desarrollo y conducta biológica de los tumores de pulmón NSCLC. 2.- Su S et al, 2006b. Genes: p16, MGMT y RASSF1A en esputo Incremento del riesgo de desarrollo de NSCLC asociado con metilación p16 pero no con RASSF1 3.- Su S et al, 2006a. Genes: p16, MGMT y RASSF1A en trabajdores de minas de uranio Subdivididos en 4 grupos en función del nivel de dosis expuestos Incremento del riesgo de desarrollo de NSCLC asociado con metilación p16 y MGMT y nivel de exposición Marcadores precoz de daño celular 4.- Belinsky SA, 2004 versus Hsu HS et al, 2007 Correlación entre las dosis de radón y el incremento de la hipermetilación de RASSF1 5.- Yanagawa N et al, Genes: RASSF1A y RUNX3. Metilación de RASSF1A NO vs SI Ambos asociados a menor supervivivencia

61 Análisis de los promotores de genes implicados en el desarrollo y conducta biológica de los tumores de pulmón NSCLC. 6.- Zheng Z et al, Genes: RRM1, ERCC1 y PTEN. Correlación con RRM1 y ERCC1 pero no con PTEN 7.- Ruano-Ravina et al, 2008; Vahakangas K et al 1992; Vahakangas K, 2003 Ygvenson A et al Análisis de la metilación del promotor de p53 No se ha demostrado correlación con p Chan EC et al, 2005; Ruano-Ravina et al, Análisis de la metilación del promotor de los genes GSTM1 y GSTT1 Resultados contradictorios NO hay ninguna referencia que los asocie con mecanismos epigenéticos en LC - p53. Clave en control de reparación proliferación y apoptosis. - Familia GST. Genes detoxificantes responsables del metabolismo de múltiples agentes xenobióticos y carcinogénicos. Estos genes presentan diversos polimorfismos, entre los cuales una de las variantes es el genotipo nulo, presente en el 50% y del 20% de la población caucásica (Steven A et al, 2004). Se cree los individuos homocigotos para estas variantes tienen un mayor riesgo de de padecer entre otros tipos de tumores, cáncer de pulmón.

62 Cáncer. Metilación del ADN. Citosina Citosina metilada C NO Metilada C (U) T Timina Uracilo Tto con BiSulfito C Metilada 5 CpG 3 C (U) T 5metil-C C Citosina metilada

63 Análisis de la metilación tras ttocon BiSulfitopor MS-PCR Secuencia primaria del promotor Dirección gtcggccttacgccggaccg 3 3 CtgCCggaatgCggCCtggC 5 Dirección 3 5 CpGs susceptibles de metilación 1.- CpGs NO METILADAS (UM) 2.- CpGs susceptibles de metilación (M) 3.- C no susceptibles de metilación Promotor NO Metilado (UM) 5 gtcggccttacgccggaccg 3 3 CtgCCggaatgCggCCtggC 5 Promotor Metilado (M) 5 CpG 3 -CH 3 5 gtcggccttacgccggaccg 3 3 CtgCCggaatgCggCCtggC 5 3 HC- -CH 3 3 HC- -CH 3 3 HC- -CH 3 3 HC-

64 Análisis de la metilación tras tto con BiSulfito por MS-PCR CpG (U) T Tratamiento Con BiSulfito 5 metilcpg (U) T 5metil-C C Promotor NO Metilado (UM) 5 gtcggccttacgccggaccg 3 5 T TT T T T T T 3 3 T T T T T T T 5 3 CtgCCggaatgCggCCtggC 5 Cadena ADN UM tras tto con BiS 5 gttggttttatgttggattg 3 3 TtgTTggaatgTggTTtggT 5 Promotor Metilado (M) 5 CpG 3 -CH 3 5 gtcggccttacgccggaccg 3 5 C TT C T C T C 3 3 T C T C C T C 5 3 CtgCCggaatgCggCCtggC 5 3 HC- -CH 3 3 HC- -CH 3 3 HC- Cadena ADN M tras tto con BiS -CH 3 3 HC- 5 gtcggttttacgtcggatcg 3 3 TtgCTggaatgCggCTtggC 5

65 Análisis de los promotores de genes implicados en el desarrollo y conducta biológica de los tumores de pulmón NSCLC. 1.- Detección Seguimiento de la enfermedad 2.- Pronóstico 3.- Terapia epigenética Detección de hipermetilación en el promotor de p16 en pacientes con NSCLC Paciente 1 TT U M ESP U M Paciente 2 TT U M ESP U M Paciente 3 TT U M ESP U M Control ADN Metilado (M) Control ADN No Metilado (UM) H 2 O U M U M U M TT diagnóstico ESP evolución Ambas muestras tomadas al diagnóstico TT: Tejido Tumoral. Tejido fijado e incluido ESP: Esputo Gel agarosa 2% teñido con SyberSafe

66 1.- Detección Seguimiento de la enfermedad 2.- Pronóstico 3.- Terapia epigenética Tto con inhibidores de DNMT La célula neoplásica continua la diferenciación celular o induce apoptosis Represor transcripcional ADN metilado Activadores de la transcripción DNA NO metilado

67 1.- Detección Seguimiento de la enfermedad 2.- Pronóstico 3.- Terapia epigenética Terapias dirigidas Ttos epigenéticos 1a.-Análogos de nucleósidos 5-aza-citidina (Vidaza) PROCESO 5-aza-2 -deoxicitidina REVERSIBLE ADN Metilado (Decitabina) Inhibidores de DNMTs El tto debe ser administrado a lo largo Zebularine de la vida del 1b.- paciente Otros Oligonucleotidos antisense o modificados Análogos de SAM Procainamina Procaina Se incorporan al ADN impidiendo su replicación Quimicamente estable Baja toxicidad

68 Estudio genómicos globales. Búsqueda de genes GST y mirna candidatos. A ADNc referencia B Marcaje del ADNc de referencia con Cy3 C Microarray ARN tumoral retro-transcrito a ADNc Marcaje del ADNc tumoral con Cy5 Hibridación competitiva entre los ADNc marcados D El coeficiente de expresión se calcula del nivel de intensidad tras la hibridación la muestra problema rojo Cy5 la muestra referencia verde Cy3 Pocillo verde 0.5 = 2x por debajo del nivel normal de expresión Pocillo amarillo el nivel de expresión es el mismo en ambas muestras Pocillo rojo 2 = 2x sobre-expresado en la muestra problema ADNc de referencia marcado Rojo Sobre-expresión ADNc del gen en la tumoral muestra tumoral marcado en cada pocillo se analiza la expresión de distintos genes

69 Conclusiones

70 Conclusiones 1.- Los conocimientos actuales describen una ínfima parte de quienes son los protagonistas y cómo actúan en el desarrollo del cáncer. Sin embargo, han supuesto un desarrollo exponencial en la Medicina Predictiva, la Oncología Médica y Radioterápica. 2.- Es imprescindible asumir la inversión en dichos proyectos de los cuales se nutre la investigación básica cuyos resultados son trasladados a la práctica clínica. 3.- El objetivo final es conseguir "que cada paciente se trate de forma individualizada utilizando para ello el perfil genético del paciente y del tumor". 4.- Para ello es necesaria la existencia de equipos interdisciplinares integrados por múltiples especialistas de diversas áreas, que incluya investigadores, clínicos y personal sanitario.




74 1.- Nivel de metilación génica en pacientes con Linfoma Difuso de Célula Grande XXIII CONGRESO NACIONAL SETH XLIX REUNIÓN NACIONAL AEHH Octubre 2007 Pamplona, España 2.- Promoter Methylation of Multiple Genes in Diffuse Large Cell Lymphoma (DLCL), Follicular Lymphoma (FL) and Bening Follicular Hyperplasia (BFH) The American Society of Hematology, 49th Annual Meeting and Exposition 8-11 December 2007 Atlanta, USA 3.- Promoter Methylation of Multiple Genes in Diffuse Large Cell Lymphoma (DLCL), Follicular Lymphoma (FL) and Bening Follicular Hyperplasia (BFH) 10Th International Conference on Malignant (ICML) 4-7 June 2008 Lugano, Switzerland. 4.- Follicular lymphoma (FL) differs from follicular hyperplasia LOS METILADORES (FH) at the epigenetic level (FH) Dra. Raquel 13Th Congress Losada of European Hematology Association (EHA) Dr. Jose Paz June 2008 Copenhagen, Denmark. Dra. Arantxa Garcia Fundación Centro Oncológico de Galicia José Antonio Quiroga y Piñeiro La Coruña

Análisis de la. como parte del diagnóstico general del cáncer de mama. Karla Elizabeth Flores Martínez* Rafael González Alvarez** Entretextos.

Análisis de la. como parte del diagnóstico general del cáncer de mama. Karla Elizabeth Flores Martínez* Rafael González Alvarez** Entretextos. ISSN: 2007-5316 40 Entretextos Análisis de la metilación del ADN como parte del diagnóstico general del cáncer de mama Karla Elizabeth Flores Martínez* Rafael González Alvarez** Frutos Rojos (fragmento)

Más detalles

CÁNCER DE MAMA. Modelo de aplicación de la genética y biología molecular. Dr. Abelardo Arias Velásquez

CÁNCER DE MAMA. Modelo de aplicación de la genética y biología molecular. Dr. Abelardo Arias Velásquez V SIMPOSIO ANDINO DE LABORATORIO Y MEDICINA CÁNCER DE MAMA Modelo de aplicación de la genética y biología molecular Dr. Abelardo Arias Velásquez Jefe de la Unidad de Genética y Biología Molecular Instituto

Más detalles

La Regulación del Ciclo Celular, la Apoptosis y el Cáncer

La Regulación del Ciclo Celular, la Apoptosis y el Cáncer La Regulación del Ciclo Celular, la Apoptosis y el Cáncer Bio 112 La proliferación celular tiene lugar de un modo controlado de acuerdo a las necesidades generales del organismo. Las células de algunos

Más detalles

Cancer Genome Anatomy Project. www.ncbi.nlm.nih.gov/ncicgap/

Cancer Genome Anatomy Project. www.ncbi.nlm.nih.gov/ncicgap/ Cancer Genome Anatomy Project www.ncbi.nlm.nih.gov/ncicgap/ Tomado de: Molecular Cell Biology 4a edición. Lodish Características del cáncer como enfermedad Gen-ética Boveri, 1914: defecto en la mitosis.

Más detalles

Nutrigenómica y Cáncer

Nutrigenómica y Cáncer Simposio XXV Aniversario "Nutrición a la Vanguardia" Asociación Mexicana de Nutriología, A.C. Nutrigenómica y Cáncer Dr. Óscar A. Pérez González Instituto Nacional de Pediatría Nutrigenómica Vs. Nutrigenética

Más detalles

Cáncer: malos números BASES MOLECULARES DEL CANCER. C. pulmón: malos resultados. Cáncer de pulmón: problemas. Carcinogénesis Origen de las mutaciones

Cáncer: malos números BASES MOLECULARES DEL CANCER. C. pulmón: malos resultados. Cáncer de pulmón: problemas. Carcinogénesis Origen de las mutaciones BASES MOLECULARES DEL CANCER Miguel Carrera Lamarca Hospital U. Son Dureta Fundación Caubet-CIMERA Palma de Mallorca Cáncer: malos números Cáncer Segunda causa de muerte; la primera entre los 45 y 60 años

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles


REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA Niveles de organización de los seres humanos Biología Molecular Básica e Ingeniería Genética T.M. Claudia Troncoso M. Regulación expresión génica Diversidad

Más detalles

Marta Hergueta Redondo Dic. -2005

Marta Hergueta Redondo Dic. -2005 Perfil de expresión genética en el carcinoma no microcítico de pulmón: utilidad de las biopsias endoscópicas, correlación con la histología y predicción pronóstica en pacientes operables. FIS 04/2641 Marta

Más detalles

Blga. María Leticia Amésquita Cárdenas. GENETICA MEDICA Departamento Morfología Humana. Facultad de Medicina Universidad Nacional de Trujillo

Blga. María Leticia Amésquita Cárdenas. GENETICA MEDICA Departamento Morfología Humana. Facultad de Medicina Universidad Nacional de Trujillo Blga. María Leticia Amésquita Cárdenas GENETICA MEDICA Departamento Morfología Humana. Facultad de Medicina Universidad Nacional de Trujillo Cáncer Enfermedad neoplásica con transformación de las células

Más detalles

Enfermedades genéticas

Enfermedades genéticas Enfermedades genéticas Desórdenes genéticos Mutaciones Rearreglos genómicos Variación en número de cromosomas Monogenéticas, heredables en forma mendeliana. Enfermedades genéticas Poligenéticas o complejas,

Más detalles

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico Radiación y Cáncer Karel van Wely 23-10 - 2012 -) Una definición del cáncer -) El cáncer, consecuencia de un problema biológico -) el ambiente, donde aparece el cáncer? -) estadios diferentes de la carcinogénesis

Más detalles


LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER Genética Molecular 10/11 Ana Serrano Puebla LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER En este trabajo se dispusieron a investigar sobre el desarrollo y mantenimiento de células cancerígenas en

Más detalles

Qué es la epigenética y para qué sirve?

Qué es la epigenética y para qué sirve? Qué es la epigenética y para qué sirve? Antonio González Instituto Investigacion Sanitaria-Hospital Clinico Universitario de Santiago Santiago de Compostela 25/10/2014, A. González 1 Notas No tengo conflictos

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles


CAPÍTULO 4 INTERACCIÓN DE LA RADIACIÓN CON EL TEJIDO BIOLÓGICO CAPÍTULO 4 INTERACCIÓN DE LA RADIACIÓN CON EL TEJIDO BIOLÓGICO El tejido biológico está formado por células, la radiación al interaccionar con el tejido puede tener como blanco de interacción cualquiera

Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

La Regulación del Ciclo Celular, la Apoptosis y el Cáncer

La Regulación del Ciclo Celular, la Apoptosis y el Cáncer La Regulación del Ciclo Celular, la Apoptosis y el Cáncer Compilado por Prof. F. Arturo Russell Las células proliferan aumentando su contenido de moléculas y organelos (crecimiento en masa o tamaño) y

Más detalles

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Classification of Normal and Tumor Colon Tissues Using Linear Classifiers and Microarray Data Análisis Inteligente de

Más detalles



Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

Qué sabemos de la naturaleza física del gen?

Qué sabemos de la naturaleza física del gen? LAS BASES MOLECULARES DE LA HERENCIA - Genes como entidades abstractas - Se duplican y pasan a la generación siguiente - De algún modo controlan los caracteres hereditarios HERENCIA DE LOS GENES ANÁLISIS

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles


FASES DE LA APARICIÓN DE UN CÁNCER Tejido normal I. AUMENTO DE LA PROLIFERACIÓN. Tumor primario benigno. Tumor maligno INVASIVIDAD Y METÁSTASIS TEMA 19. CARCINOGÉNESIS. 1.- PERSPECTIVA HISTORICA E INTRODUCCION Dos de las primeras observaciones realizadas acerca de la relación entre exposición de las personas a ciertos agentes químicos y aumento

Más detalles

TEMA 5 TEMA 6. 7. La célula tiene que saber la ruta a emplear en cada momento, cómo regula estos procesos de manera primaria?.

TEMA 5 TEMA 6. 7. La célula tiene que saber la ruta a emplear en cada momento, cómo regula estos procesos de manera primaria?. TEMA 1 1. El agua es uno de los principales elementos de los seres vivos, por qué es tan importante?. 2. Las proteínas son polímeros de aminoácidos, cuáles son las características básicas de los aminoácidos

Más detalles

con cáncer tipo basal podrían requerir terapias sistémicas más agresivas (Gradishar, 2005; Neve et al., 2006).

con cáncer tipo basal podrían requerir terapias sistémicas más agresivas (Gradishar, 2005; Neve et al., 2006). I. INTRODUCCIÓN El cáncer de mama (CaMa) ocupa el primer lugar en causa de muerte por cáncer en mujeres a nivel mundial, con más de 410,000 defunciones cada año (Ferlay et al., 2001). En México y según

Más detalles

Recomendaciones para adolescentes con historia familiar de cáncer de mama. Dr. Octavio Peralta M

Recomendaciones para adolescentes con historia familiar de cáncer de mama. Dr. Octavio Peralta M Recomendaciones para adolescentes con historia familiar de cáncer de mama Dr. Octavio Peralta M Facultad Medicina Universidad de Chile Centro Integral de la Mama. Clínica Las Condes Edad Hiperplasia atípica

Más detalles


COOPERACIÓN DE ONCOPROTEÍNAS EN EL DESARROLLO DE LA LEUCEMIA COOPERACIÓN DE ONCOPROTEÍNAS EN EL DESARROLLO DE LA LEUCEMIA Investigador principal: Dr. Luciano di Croce Centre de Regulació Genòmica Duración: 3 años 1. Resumen La desregulación de los factores de transcripción,

Más detalles


TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles


NOTICIAS CIENTÍFICAS: ANÁLISIS NOTICIAS CIENTÍFICAS: ANÁLISIS José M. Ortiz Melón Editor científico e- mail: edicion@ranf.com Lecciones de Genómica del Cáncer En la ultima década los esfuerzos realizados en la secuenciación de muchos

Más detalles

Represión epigenética de tumores por BRCA1

Represión epigenética de tumores por BRCA1 Represión epigenética de tumores por BRCA1 Elsa Cortés Montero Grado en Biología Represión epigenética de tumores por BRCA1 1. Introducción Brca1 fue el primer gen que se descubrió asociado al cáncer de

Más detalles


GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

Inmunidad Antitumoral

Inmunidad Antitumoral Inmunidad Antitumoral Conceptos a desarrollar 1- Transformación celular y cáncer 2- Mecanismos celulares de supresión tumoral 3- Antígenos tumorales 4- El Sistema inmune ante el desarrollo tumoral 5- Mecanismos

Más detalles

Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona

Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona Diagnóstico Genético Diagnóstico de una enfermedad causada por una alteración en el material genético Constitucional: afecta a todas

Más detalles

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia 5 JUN9.- Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles


www.absmexico.com.mx La epigenética en una cáscara de nuez Por MVZ. Fernando Cavazos García Veterinario de Servicio Técnico ABS México S.A. de C.V. Qué es la EPIGENÉTICA? Seguramente muchos de Ustedes recientemente han escuchado

Más detalles



Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

Investigación en cáncer, esperanza para muchos

Investigación en cáncer, esperanza para muchos Investigación en cáncer, esperanza para muchos José Luis Carrillo Aguado* El cáncer en el mundo llegó a ser una causa importante en el mundo hasta el siglo XX. Antes de 1900, la mayoría de las muertes

Más detalles

Generalidades. La malignidad depende de que pueda salir de su lugar de origen y pueda ser autónoma del resto del tejido.

Generalidades. La malignidad depende de que pueda salir de su lugar de origen y pueda ser autónoma del resto del tejido. Cáncer y Sintergética Claudio Méndez Brieres Generalidades Es una exageración de una estrategia de supervivencia normal de la célula. Utilizan normalmente factores de crecimiento. i Su usodescontrolado

Más detalles


CARACTERISTICAS DE LAS CELULAS NORMALES EN CULTIVO CARACTERISTICAS DE LAS CELULAS NORMALES EN CULTIVO 1. La duración del ciclo celular en una célula determinada es aleatoria 2. Para poder dividirse las células requieren de la actuación de diversos factores

Más detalles

Fuentes variación genética

Fuentes variación genética Reparación de ADN Fuentes variación genética Mutación: fuente primaria de variación genética Recombinación: reacomodo de la variación genética Mutaciones de punto Consecuencia de mutaciones de punto en

Más detalles

2. Los organizadores nucleares aportan información para la síntesis de: a- ARNm b- ARNr c- ARNt d- Histonas

2. Los organizadores nucleares aportan información para la síntesis de: a- ARNm b- ARNr c- ARNt d- Histonas CBC UBA 2º Parcial Biología (54) Paseo Colon Apellido y Nombre:... DNI...Comisión Nº... Lea atentamente cada pregunta con sus opciones de respuesta. Marque en su grilla la opción correspondiente a la respuesta

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles


QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

Biología: una ciencia de la información. Aplicaciones en la Medicina del Futuro

Biología: una ciencia de la información. Aplicaciones en la Medicina del Futuro Biología: una ciencia de la información. Aplicaciones en la Medicina del Futuro II Congreso del Futuro Ciencia, Tecnología, Humanidades y Ciudadanía Salón de Honor, Congreso Nacional 17-19 de Enero 2013

Más detalles


INTERACCION DE LA RADIACION CON LA MATERIA Pág. 1 de 11 INTERACCION DE LA RADIACION CON LA MATERIA Cuando se habla de reacciones nucleares se hace referencia a todo tipo de interacción con los núcleos atómicos. Un tema más general, que engloba

Más detalles

Carcinogénesis pulmonar

Carcinogénesis pulmonar Carcinogénesis pulmonar P. Iniesta Serrano Departamento de Bioquímica y Biología Molecular. Facultad de Farmacia. Universidad Complutense. Madrid INTRODUCCIÓN El cáncer de pulmón es el resultado final

Más detalles

Complejo de iniciación de la transcripción Fosforilación de el CTD de la ARN pol II

Complejo de iniciación de la transcripción Fosforilación de el CTD de la ARN pol II Complejo de iniciación de la transcripción Fosforilación de el CTD de la ARN pol II FACTORES DE ELONGACIÓN TFII S Reduce el tiempo de pausa Lectura de prueba ptefb Fosforila a la ARNp Fosforila a hspt5

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles

personalizado del cáncer de pulmón y la importancia de las determinaciones moleculares para oncovida

personalizado del cáncer de pulmón y la importancia de las determinaciones moleculares para oncovida Tratamiento personalizado del cáncer de pulmón y la importancia de las determinaciones moleculares para optimizar el tratamiento 22 oncovida C o l e c c i ó n 1 Qué es el cáncer de pulmón y cuales son

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles



Más detalles

La oficina de farmacia y el cáncer Terapias oncológicas. Manipulación de antineoplásicos, recomendaciones al paciente

La oficina de farmacia y el cáncer Terapias oncológicas. Manipulación de antineoplásicos, recomendaciones al paciente La oficina de farmacia y el cáncer Terapias oncológicas. Manipulación de antineoplásicos, recomendaciones al paciente que recibe quimioterapia Farmacéuticos: Coassolo Alicia - Imhoff Andrea Schonfeld Jose

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

Estructura Genoma Procariota. Estructura Genoma Eucariota

Estructura Genoma Procariota. Estructura Genoma Eucariota Estructura Genoma Procariota Organización compacta (poco espacio entre genes) Información adicional en plásmidos DNA no codificante en pequeños segmentos dispersos en el genoma (

Más detalles



Más detalles

Actualización en Marcadores Moleculares Su utilidad en Cáncer de Próstata

Actualización en Marcadores Moleculares Su utilidad en Cáncer de Próstata Actualización en Marcadores Moleculares Su utilidad en Cáncer de Próstata Bioq. María Eugenia Ibañez Biología Molecular Laboratorio Domecq & Lafage Hospital Alemán Biomarcadores moleculares de Cáncer

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

ARN mensajero. Síntesis y procesamiento. Corte y empalme. Capping. Poliadenilación. Estabilidad. Genética 1 er Curso. Facultad de Medicina TEMA 0-3

ARN mensajero. Síntesis y procesamiento. Corte y empalme. Capping. Poliadenilación. Estabilidad. Genética 1 er Curso. Facultad de Medicina TEMA 0-3 Facultad de Medicina Genética 1 er Curso TEMA 0-3 EXPRESIÓN GÉNICA: TRANSCRIPCIÓN Y TRADUCCIÓN ARN mensajero. La transcripción en eucariotas. Ribosomas. La traducción. ARN mensajero Apartados Síntesis

Más detalles

TESIS DOCTORAL. Regulación transcripcional durante la activación de los linfocitos T por la enzima Poli-ADP-ribosa polimerasa-1.

TESIS DOCTORAL. Regulación transcripcional durante la activación de los linfocitos T por la enzima Poli-ADP-ribosa polimerasa-1. Unidad de Cirugía Experimental. Hospital Universitario Virgen de la Arrixaca. Universidad de Murcia Dpto. Bioquímica, Biología Molecular B e Inmunología, Facultad de Medicina TESIS DOCTORAL Regulación

Más detalles

Estructura y estabilidad de un dominio proteico BRCT. Obregón Mansilla, Alexandra J. I. CAPÍTULO II ANTECEDENTES

Estructura y estabilidad de un dominio proteico BRCT. Obregón Mansilla, Alexandra J. I. CAPÍTULO II ANTECEDENTES CAPÍTULO II ANTECEDENTES Frecuentemente se observa alteraciones en la abundancia de proteínas reguladoras críticas en células cancerosas (20). La pérdida de proteínas supresoras de tumores o el incremento

Más detalles

Bases moleculares y estudios genéticos

Bases moleculares y estudios genéticos II Jornada Genética Clínica para Médicos de Familia Bases moleculares y estudios genéticos María García-Barcina Unidad de Genética del H. Universitario de Basurto Osakidetza Sede SVMFIC Valencia, 2 de

Más detalles

Apoptosis en Otorrinolaringología

Apoptosis en Otorrinolaringología Apoptosis en Otorrinolaringología Teolinda Morales y Myrian Adriana Pérez García Definición La apoptosis es un proceso biológico que existe en todas las células de nuestro organismo, conocida desde 1950

Más detalles

Cáncer de Mama Resistencia a tratamientos anti- HER2 en pacientes con Cáncer de mama.

Cáncer de Mama Resistencia a tratamientos anti- HER2 en pacientes con Cáncer de mama. Cáncer de Mama Resistencia a tratamientos anti- HER2 en pacientes con Cáncer de mama. Dr. Atanasio Pandiella, Centro Investigación Cáncer, Salamanca Dr. Alberto Ocaña, Complejo Hosp. Univeristario de Albacete

Más detalles


I CURSO ANDALUZ DE ONCOLOGÍA CLÍNICA BÁSICA PARA ATENCIÓN PRIMARIA I CURSO ANDALUZ DE ONCOLOGÍA CLÍNICA BÁSICA PARA ATENCIÓN PRIMARIA INTRODUCCIÓN. Uno de cada tres varones y una de cada cuatro mujeres se diagnosticarán de cáncer a lo largo de su vida. La incidencia de

Más detalles


DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

Efectos de las radiaciones en los seres vivos

Efectos de las radiaciones en los seres vivos Efectos de las radiaciones en los seres vivos Curso sobre Protección Radiológica para residentes H.U.C.A. 17 de mayo Miguel A. Peinado Montes Sº Física Médica y PR - HUCA Efectos de las radiaciones Evidencias

Más detalles



Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

La radiación es el transporte o la propagación de energía en forma de partículas u

La radiación es el transporte o la propagación de energía en forma de partículas u La radiación es el transporte o la propagación de energía en forma de partículas u ondas. Si la radiación es debida a fuerzas eléctricas o magnéticas se llama radiación electromagnética. Pero la materia

Más detalles

La piel tiene memoria. Prevención y avances en investigación del melanoma.

La piel tiene memoria. Prevención y avances en investigación del melanoma. SEMANA DE LA CIENCIA 2009 La piel tiene memoria. Prevención y avances en investigación del melanoma. Diagnóstico y tratamiento del cáncer de piel y melanoma Dr. Luis Ríos, Hospital Ramón y Cajal de Madrid.

Más detalles

Jesús Romero Fernández H.Universitario Puerta de Hierro jesusromerofernandez@terra.com

Jesús Romero Fernández H.Universitario Puerta de Hierro jesusromerofernandez@terra.com Jesús Romero Fernández H.Universitario Puerta de Hierro jesusromerofernandez@terra.com Índice Aspectos históricos Concepto Metodología Identificación marcador Validación Aplicación clínica potencial Virus

Más detalles


NIVELES DE ORGANIZACIÓN DEL ADN. TEMA 4. Modos de información genética. Acidos nucleicos: ADN y ARN. Estructura polarizada del ADN. Cromatina, cromosomas, gen, cistrón, genotipo y fenotipo. Duplicación semiconservativa de la información

Más detalles

Curso Respuesta Médica a Emergencias Radiológicas

Curso Respuesta Médica a Emergencias Radiológicas Curso Respuesta Médica a Emergencias Radiológicas Efectos Biológicos de las Radiaciones Ionizantes Parte II: radiocarcinogénesis y alteraciones genéticas radioinducidas Agentes oncogénicos en general Químicos

Más detalles

3 er Curso Genética Humana Sociedad Española de Genética Valencia 24-26 Enero de 2008 Los micrornas como genes de susceptibilidad en cáncer por José

3 er Curso Genética Humana Sociedad Española de Genética Valencia 24-26 Enero de 2008 Los micrornas como genes de susceptibilidad en cáncer por José 3 er Curso Genética Humana Sociedad Española de Genética Valencia 24-26 Enero de 2008 Los micrornas como genes de susceptibilidad en cáncer por José Fernández Piqueras Catedrático de Genética Universidad

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REGULACIÓN DE LA EXPRESIÓN GENÉTICA INTRODUCCIÓN La transmisión de la información genética (transcripción), posibilita la formación de proteínas, cuyas funciones van a caracterizar la actividad y morfología

Más detalles



Más detalles


FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General 1- Diga si son falsas o verdaderas las siguientes afirmaciones con respecto al núcleo celular: I. La envoltura nuclear presenta dos

Más detalles

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica Terapia Génica Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica 5/8/2015 Gen Esta en un cromosoma Es la unidad base de la Herencia Codificación, proteína DNA RNA proteins Proteínas,

Más detalles


INFORMACIÓN BASICA SOBRE CANCER PARA LA COMUNIDAD. preparado por SERVICIO DE SALUD VALDIVIA INFORMACIÓN BASICA SOBRE CANCER PARA LA COMUNIDAD preparado por SERVICIO DE SALUD VALDIVIA Dra.M.Enriqueta Bertrán V. Prof.B.Q. M. Elena Flores G. Resumen realizado de información http://training.seer.cancer.gov

Más detalles

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre.

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Glúcidos, lípidos, proteínas, ácidos nucleicos. Oxígeno, calcio,

Más detalles

Valor predictivo de la Timilidato Sintetasa (TS) determinada por qpcr en pacientes con cáncer avanzado tratados con Pemetrexed

Valor predictivo de la Timilidato Sintetasa (TS) determinada por qpcr en pacientes con cáncer avanzado tratados con Pemetrexed Valor predictivo de la Timilidato Sintetasa (TS) determinada por qpcr en pacientes con cáncer avanzado tratados con Pemetrexed C. Chamizo, S. Zazo, N. Pérez-González, CL Aúz, Lina Daud, J. Madoz, M. Domine,,

Más detalles

Patología molecular del cáncer urotelial (Francisco X. Real) Por: Mauricio Lema Medina

Patología molecular del cáncer urotelial (Francisco X. Real) Por: Mauricio Lema Medina Patología molecular del cáncer urotelial (Francisco X. Real) Por: Mauricio Lema Medina Consideraciones iniciales sobre los cánceres uroteliales El urotelio es un epitelio estratificado no queratinizante

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles



Más detalles

Nutrición y salud en grupos específicos de población (adultos de edad avanzada). Interacción entre I+D y Cadena Alimentaria.

Nutrición y salud en grupos específicos de población (adultos de edad avanzada). Interacción entre I+D y Cadena Alimentaria. XV F XV Foro de Colaboración Público Privada d C l b ió Públi P i d Nutrición y salud en grupos específicos de población y g p p f p (adultos de edad avanzada). Interacción entre I+D y Cadena Alimentaria.

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge CRECIMIENTO Y DIFERENCIACIÓN CELULAR CICLO CELULAR El ciclo celular se describe como la secuencia general de acontecimientos que se producen durante la vida de una célula eucariota y se divide en cuatro

Más detalles


EL CANCER:MITOS Y REALIDADES El Cáncer hoy ANTONIO LLOMBART BOSCH Dep. PATOLOGIA UNIVERSITAT VALENCIA EL CANCER:MITOS Y REALIDADES Cancer-Neoplasia-Tumor maligno Cancer es un termino común para todas las neoplasias (tumor maligno).

Más detalles

Aplicación de los microarrays de DNA al estudio de la resistencia a isoniazida en Mycobacterium tuberculosis

Aplicación de los microarrays de DNA al estudio de la resistencia a isoniazida en Mycobacterium tuberculosis Aplicación de los microarrays de DNA al estudio de la resistencia a isoniazida en Mycobacterium tuberculosis PNAS, 22: 12833-12838 (1999) Tuberculosis La tuberculosis es una enfermedad crónica infecciosa

Más detalles



Más detalles


BIOTECNOLOGÍA CONTRA EL CÁNCER BIOTECNOLOGÍA CONTRA EL CÁNCER DEDICATORIA PREFACIO Página BIOTECNOLOGÍA CONTRA EL CÁNCER 3 Introducción 4 Genes cancerígenos y cambios fisiológicos requeridos para que se presente el cáncer Virus asociados

Más detalles



Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles


FACULTAD DE MEDICINA FACULTAD DE MEDICINA Cáncer colorrectal hereditario no polipósico: caracterización clínica y molecular, aplicación de modelos predictivos y evaluación del cumplimiento de las estrategias de seguimiento

Más detalles

UNIDAD 1: Introducción a la biología


Más detalles

Patologías asociadas a defectos en la reparación del DNA

Patologías asociadas a defectos en la reparación del DNA Patologías asociadas a defectos en la reparación del DNA Xeroderma pigmentosa (XP) Ataxia-telangiectasia (A-T) Defectos en los mecanismos de reparación del DNA se traducen en una gran probabilidad de desarrollar

Más detalles