Tamaño: px
Comenzar la demostración a partir de la página:



1 Avda. Conocimiento, 100 P.T. Ciencias de la Salud Granada Fax: Tlf.: MASTER DUAL STAINING KIT DESCRIPCIÓN: Master Dual Staining Kit contiene reactivos para llevar a cabo de forma manual o automatizada la doble tinción immunohistoquimica sobre secciones de tejidos humanos fijados en formalina tamponada e incluidos en parafina. Este kit contiene un sistema de revelado basado en el sistema de Micropolímeros y es suficiente para la realización de 30 determinaciones siguiendo el protocolo recomendado. Presentación : La referencia/presentación general para este Kit es: MAD QK 30 test Esta referencia es para presentación en envases de Polietileno de Baja Densidad (LDPE) con gotero. En caso de que el usuario desee otro tipo de presentaciones (referencias/volúmenes diferentes) deberá contactar con el proveedor. Uso Previsto : Diagnóstico in vitro en la especie humana Condiciones de almacenamiento : Frigorífico entre 2 y 8ºC. Periodo de validez : El envase una vez abierto puede conservarse hasta la fecha de caducidad del reactivo señalada en la etiqueta. Si el reactivo ha sido almacenado en otras condiciones a las señaladas en este documento el usuario deberá chequear previamente su correcto funcionamiento teniendo en cuenta que la garantía del producto ya no es válida. Instrucciones especiales de manipulación: Este reactivo está especialmente diseñado para su manejo en los inmunoteñidores LabVision Autostainer 480 y 780. Advertencias y precauciones: 1) El producto solo debe ser manejado por usuarios entrenados y en laboratorios autorizados. Para su manejo en investigación existen otras presentaciones igualmente idóneas. 2) Téngase en cuenta que la última responsabilidad en la optimización e interpretación de las hibridaciones cromogénicas practicadas corresponde al facultativo responsable y los técnicos que emplean el kit y que, asimismo, este conjunto de reactivos no es más que una herramienta útil para la interpretación de los hallazgos morfológicos de cada caso en conjunción con otros tests diagnósticos y los pertinentes datos clínicos del paciente. 3) El reactivo contiene azida sódica (NaN3) como conservante. Aunque este producto es altamente tóxico y si se mezcla con agua o ácidos, principalmente en presencia de metales, existe peligro de explosión, estos riesgos están minimizados al máximo cuando se emplea a concentraciones inferiores al 0,05% como ocurre en este caso. No obstante para el manejo de este reactivo deben tomarse las siguientes precauciones: a) Uso de guantes y del equipo de protección establecido para las técnicas de hibridación e inmunohistoquímicas del laboratorio así como estricto respeto de las prácticas generales de seguridad existentes en el mismo; b) No almacenar los reactivos en envases metálicos ni emplear utillaje de esta naturaleza para su manejo; c) Almacenar los residuos para su eliminación reglada en contenedores apropiados según la normativa vigente en cada laboratorio. Nunca arrojarlos por el desagüe. POSIBLES COMBINACIONES DE ANTICUERPOS Y SUS APLICACIONES DIAGNÓSTICAS 1 : Mix anticuerpos Utilidad Foto MelanA+PHH3 (MAD MAD QD) Identificar con facilidad el número de mitosis en una lesión melánica 1 los anticuerpos utilizados no están incluidos en el kit Página 1 de 5

2 CK7+CDX2 (MAD QD+ MAD QD) Posible utilidad en diferenciar un tumor metastásico de origen intestinal de un tumor de origen pulmonar, pancreático, mamario o con origen primitivo en el ovario p504 (racemasa)+p63 (MAD QD) PIN cóctel diferenciar las áreas de próstata normal, PIN y adenocarcinoma acinar de próstata p63+c-erbb2 (MAD QD+ MAD QD) Valoración simultanea de la expresión proteica del gen HER2 tanto en el componente in situ como en el infiltrativo p501(prosteína)+p63 (MAD QD+ MAD QD) Diferenciar entre carcinoma urotelial y de próstata en posibles casos pobremente diferenciados y con morfología semejante p16 (RUO)+PHH3 (MAD QD+ MAD QD) Identificar el nivel de las mitosis en un epitelio cervical displásico. Página 2 de 5

3 p16(ruo)+ki67 (MAD QD+ MAD QD) Valoración del índice mitótico en un epitelio displásico cervical. Útil en la valoración de los extendidos citológicos cervicales CD20+CD3 (MAD QD+ MAD QD) Diferenciar entre el componente B y T de una proliferación linfoide CD4+CD8 (MAD QD+ MAD QD) Visualización simultanea de los linfocitos CD4 y CD8 positivos; de utilidad en proliferaciones linfoides de linfocitos T cutáneas CD10+Bcl2 (MAD QD+ MAD QD) Diferenciar entre el componente linfoide de tipo centro germinal benigno y maligno LIMITACIONES Y PRECAUCIONES DEL REACTIVO El uso sobre tejido congelado no ha sido evaluado. Las mezclas de anticuerpos usadas en la doble tinción inmunohistoquímica deben ser las recomendadas y suministradas por el proveedor. En caso contrario debe tenerse en cuenta que los dos anticuerpos tienen que proceder de animales diferentes (ratón/conejo). Debido a la presencia de un cromógeno soluble en soluciones alcohólicas, la deshidratación debe ser realizada al aire o mediante temperatura y el montaje hecho con medios de montaje acuosos. TIPOS DE MUESTRA Página 3 de 5

4 Secciones de 4 micras de espesor montadas sobre portaobjetos especiales para inmunohistoquímica y obtenidas de tejidos incluidos en parafina, preferiblemente fijados en formalina tamponada. PRINCIPIO DEL MÉTODO ANALÍTICO El objeto de la tinción inmunohistoquímica es convertir en una tinción visible la reacción anticuerpo-antígeno específica de las moleculas que se pretenden a estudiar en células o tejidos. De esta manera el Master Dual Staining Kit presenta un conjunto de reactivos altamente específicos y sensibles que permite la doble visualización de la unión de dos anticuerpos a sus antígenos específicos. El funcionamiento de este kit se basa en el uso de un mix de dos micropolímeros marcados cada uno con enzimas diferentes (Peroxidasa y Fosfatasa Alcalina), que reconocen cada uno a las inmunoglobulinas (anticuerpos) desarrolladas en conejo y ratón respectivamente. En el caso de haber ocurrido reacción entre los anticuerpos primarios y sus antígenos, los micropolimeros se unen específicamente a cada uno de ellos y debido al marcaje enzimático, añadiendo los cromógenos y los substratos correspondientes, se obtienen precipitados de diferentes colores que permiten detectar al microscopio la presencia de los antígenos específicos. En el caso del Master Dual Staining Kit, los precipitados obtenidos serán de color marrón para los anticuerpos desarrollados en Ratón y de color rojo/purpura para anticuerpos de Conejo. COMPONENTES Y REACTIVOS SUBMINISTRADOS EN EL KIT: Bloqueante de la Peroxidasa Endógena MAD Q-10 10ML Ultrabloqueante MAD QK-A 10ML Mix de Polímeros MAD QK-C 10ML Cromógeno DAB: Tampón substrato MAD QK-Q1 10ML DAB MAD QK-B 1ML Cromógeno Rojo Tampón substrato MAD QK-A 10ML Cromógeno rojo MAD QK-B 1ML EQUIPAMIENTO Y MATERIAL NECESARIO PERO NO SUMINISTRADO EN EL KIT Módulo PT Buffers para el Módulo PT - CITRATO ph6 - EDTA ph8 - TRIS EDTA ph9 Portaobjetos tratados con silano o tratados eléctricamente Cubreobjetos Estufa Batería de desparafinado-hidratación (Xileno, etanol absoluto y a concentraciones del 80% y 70%) Tampón TBS - Tween 20 Hematoxilina de contraste Microscopio óptico PROTOCOLO TÉCNICO PARA LA DOBLE TINCIÓN INMUNOHISTOQUIMICA SOBRE TEJIDOS INCLUIDOS EN PARAFINA UTILIZANDO EL MASTER DUAL STAINING KIT 1. Desparafinado y Recuperación antigénica por Calor a. Incubar los portaobjetos con las secciones de tejido parafinado en la estufa a 60ºC toda la noche. b. Colocar los portaobjetos en el módulo PT usando las siguientes condiciones: - Precalentar a 65ºC - Desparafinación y recuperación 20 minutos a 95ºC 2. Detección y revelado (manual o automático) Página 4 de 5

5 a. Lavar en Tampón TBS - Tween 20 a TA b. Aplicar sobre el tejido 200 µl del bloqueante de la Peroxidasa e incubar 10 min a TA c. Lavar 3 veces en tampón TBS Tween 20. d. Aplicar sobre el tejido 200 µl del Ultrabloqueante e incubar 8 min a TA. e. Desechar sin lavar. f. Aplicar sobre el tejido 200 µl del Mix de Anticuerpos e incubar* 10 min a TA. g. Lavar 3 veces en tampón TBS Tween 20. h. Aplicar sobre el tejido 200 µl del Mix de Polímeros e incubar 30 min a TA. i. Lavar 3 veces en Agua Destilada j. Mezclar una gota del cromógeno DAB en 1 ml de Substrato del DAB y aplicar la solución resultante sobre el tejido; incubar 5 min a TA k. Lavar 3 veces en tampón TBS Tween 20. l. Mezclar una gota del cromógeno Rojo en 2.5 ml de Substrato del Crómogeno Rojo y aplicar la solución resultante sobre el tejido; incubar 10 min a TA m. Lavar 3 veces en Agua destilada. 5. Tinción de Contraste y montaje a. Teñir con Hematoxilina de Contraste 30 segundos. b. Azular en agua corriente. c. Deshidratar (secar al aire o con temperatura). d. Montar con medio de montaje acuoso e interpretar los resultados al microscopio. (*) Entre 10 y 20 minutos. Para conocer las condiciones adecuadas de cada mix de anticuerpos debe contactar con el proveedor. INCIDENCIAS Y RECLAMACIONES Se recomienda seguir exhaustivamente todas las indicaciones contenidas en estas instrucciones técnicas. En caso de que se produzcan resultados atípicos o no esperados se ruega contacten con el delegado comercial de la zona representante de Vitro S.A. En su defecto, pueden dirigirse a Master Diagnóstica en la dirección comercial, telefónica o electrónica arriba indicada. LIMITACIONES DEL REACTIVO Si se han cumplido todas las condiciones de almacenamiento y manejo en el laboratorio, este reactivo está garantizado durante todo su tiempo de caducidad. Master Diagnóstica no es responsable de los daños, lesiones personales o pérdidas económicas en que este reactivo pueda encontrarse implicado. BIBLIOGRAFÍA: 1. Xiao Chen, Dan-Bi Cho, Ping-Chang Yang. Double staining immunohistochemistry. N Am J Med Sci May; 2(5): Chris M. van der Loos. Multiple Immunoenzyme Staining: Methods and Visualizations for the Observation With Spectral Imaging. J Histochem Cytochem April; 56(4): T. van Agthoven, M. Timmermans, J. A. Foekens, L. C. Dorssers, S. C. Henzen-Logmans. Differential expression of estrogen, progesterone, and epidermal growth factor receptors in normal, benign, and malignant human breast tissues using dual staining immunohistochemistry. Am J Pathol June; 144(6): Ritu Bhalla, Lakshmi P Kunju, Scott A Tomlins, Kelly Christopherson, Connie Cortez, Shannon Carskadon, Javed Siddiqui, Kyung Park, Juan Miguel Mosquera, Gary Pestano, Mark A Rubin, Arul Chinnaiyan, Nallasivam Palanisamy. Novel Dual Color Immunohistochemical methods for detecting ERG-PTEN and ERG-SPINK1 status in prostate carcinoma. Mod Pathol. Author manuscript; available in PMC 2013 December 1.Published in final edited form as: Mod Pathol June; 26(6): Página 5 de 5

Kit completo para la determinación del virus de Epsteín-Barr (EBER1) mediante hibridación in situ cromogénica

Kit completo para la determinación del virus de Epsteín-Barr (EBER1) mediante hibridación in situ cromogénica Avda. Conocimiento, 100 P.T. Ciencias de la Salud 18016 Granada Fax: 958.27.14.34 Tlf.: 958.27.14.49 Kit completo para la determinación del virus de Epsteín-Barr (EBER1) mediante

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles

Los productos prediluídos están diluido óptimamente para utilizarse con una amplia variedad de kits de detección que ofrecen otros fabricantes.

Los productos prediluídos están diluido óptimamente para utilizarse con una amplia variedad de kits de detección que ofrecen otros fabricantes. Identificación del Producto N.º de ref. Descripción 45179 IMPATH CD3 (MRQ-39) Definiciones De Los Símbolos P A E S DOC# DIS listo para usar ascitis suero sobrenadante documento número distribuido por Uso

Más detalles

Módulo de PATOLOGÍA QUIRURGICA. Ronda nº 9. Tejido probado: Tumor Estromal Gastronintestinal (GIST)

Módulo de PATOLOGÍA QUIRURGICA. Ronda nº 9. Tejido probado: Tumor Estromal Gastronintestinal (GIST) SEAP Calle Ancora,, 2º B 28 MADRID Tfno. y Fax 9 9 86 28 MAIL: SEAP@SEAP.ES Programa de Garantía de Calidad en Patología Módulo de PATOLOGÍA QUIRURGICA Antígeno probado: c-kit (CD7) Ronda nº 9 Tejido probado:

Más detalles

(ICAPI) tiene como objetivo fundamental el ofrecer un

(ICAPI) tiene como objetivo fundamental el ofrecer un El Instituto Canario de Anatomía Patológica Integral (ICAPI) tiene como objetivo fundamental el ofrecer un diagnóstico de calidad en Anatomía Patológica, integrando las distintas disciplinas que en esta

Más detalles

Módulo de PATOLOGÍA QUIRÚRGICA GENERAL. Ronda nº 5. Antígeno probado: CEA (Antígeno Carcinoembrionario)

Módulo de PATOLOGÍA QUIRÚRGICA GENERAL. Ronda nº 5. Antígeno probado: CEA (Antígeno Carcinoembrionario) SEAP Calle Ancora, 3, º B MADRID Tfno. y Fax 9 39 Mail: Programa de Garantía de Calidad en Patología Módulo de PATOLOGÍA QUIRÚRGICA GENERAL Ronda nº Antígeno probado: CEA (Antígeno Carcinoembrionario)

Más detalles

Selección de pacientes

Selección de pacientes 2 Selección de pacientes MENSAJES CLAVE Aproximadamente entre el 20% y el 30% de las pacientes con cáncer de mama presentan tumores HER2 positivos. Hasta un 24% de los tumores con receptores de estrógenos

Más detalles

Calcitonin (Polyclonal)

Calcitonin (Polyclonal) Identificación del Producto N.º de ref. Descripción 45170 IMPATH Calcitonin RTU R (Poly) Definiciones De Los Símbolos P A E S DOC# DIS listo para usar ascitis suero sobrenadante documento número distribuido

Más detalles

Detección de IgE específica.

Detección de IgE específica. Detección de IgE específica. Una forma de identificar los alérgenos responsables de los síntomas alérgicos es la detección de anticuerpos IgE específicos frente a dichos alérgenos. Estos anticuerpos están

Más detalles

Principios Y Procedimientos

Principios Y Procedimientos Identificación del Producto N.º de ref. Descripción 46931 EGFR 0,1 R (SP84) 46932 EGFR 1 R (SP84) 46930 EGFR RTU R (SP84) Definiciones De Los Símbolos P C A E S DIL DOC# DIS listo para usar concentrado

Más detalles

Principios Y Procedimientos

Principios Y Procedimientos Identificación del Producto N.º de ref. Descripción 45283 IMPATH E-cadherin RTU R (EP700Y) Definiciones De Los Símbolos P A E S DOC# DIS listo para usar ascitis suero sobrenadante documento número distribuido

Más detalles


FICHA DE DATOS DE SEGURIDAD (MSDS) KIT CLART CMA KRAS BRAF PI3K 1. Identificación de la sustancia y proveedor Nombre comercial CLART CMA KRAS BRAF PI3K Referencias: Amplificación KRAS 8 determinaciones Ref.: CS-0412-8 24 determinaciones Ref.: CS-0412-24 Amplificación

Más detalles

Principios Y Procedimientos

Principios Y Procedimientos Identificación del Producto N.º de ref. Descripción 45273 IMPATH CD117 RTU R (YR145) Definiciones De Los Símbolos P A E S DOC# DIS listo para usar ascitis suero sobrenadante documento número distribuido

Más detalles

Ep-CAM/Epithelial Specific Antigen (MOC-31)

Ep-CAM/Epithelial Specific Antigen (MOC-31) Ep-CAM/Epithelial Specific Antigen (MOC- Identificación del Producto N.º de ref. Descripción 44588 EP-CAM 0,1 M (MOC- 44589 EP-CAM 1 M (MOC- 44283 EP-CAM RTU M (MOC- Definiciones De Los Símbolos P C A

Más detalles

Principios Y Procedimientos

Principios Y Procedimientos Identificación del Producto N.º de ref. Descripción 45616 Her2/Neu 0,1 R (EP3) 45617 Her2/Neu 1 R (EP3) 45636 Her2/Neu RTU R (EP3) Definiciones De Los Símbolos P C A E S DIL DOC# DIS listo para usar concentrado

Más detalles

Epstein-Barr Virus (MRQ-47)

Epstein-Barr Virus (MRQ-47) Identificación del Producto N.º de ref. Descripción 44590 Epstein-Barr Virus 0,1 R (MRQ- 47) 44591 Epstein-Barr Virus 1 R (MRQ-47) 44284 Epstein-Barr Virus RTU R (MRQ- 47) Definiciones De Los Símbolos

Más detalles

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D.

Control de Calidad en la Técnica de ELISA. Lic. Valentina Bastidas D. Control de Calidad en la Técnica de ELISA Lic. Valentina Bastidas D. TÉCNICA DE ELISA DEFINICIÓN E L I S A Ensayo Inmunoabsorbente Ligado a Enzimas Enzime-Linked ImmunoSorbent Assay TIPOS DE ELISA: ELISA

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

o c Insertos Tinciones Hematológicas 01 (55) 2163 4127 Lerdo # 30 Cuajimalpa México, D.F 05000 TINCIÓN DE WRIGHT WRIGHT BUFFER

o c Insertos Tinciones Hematológicas 01 (55) 2163 4127 Lerdo # 30 Cuajimalpa México, D.F 05000 TINCIÓN DE WRIGHT WRIGHT BUFFER c ma o c TINCIÓN DE WRIGHT WRIGHT BUFFER ANTES DE USAR: a) Dejar madurar el colorante de Wright 5 días después de su elaboración. Insertos Tinciones Hematológicas. Colocar el frotis perfectamente seco

Más detalles

Principios Y Procedimientos

Principios Y Procedimientos Identificación del Producto N.º de ref. Descripción 45339 IMPATH TFE3 RTU R (MRQ-37) Definiciones De Los Símbolos P A E S DOC# DIS listo para usar ascitis suero sobrenadante documento número distribuido

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles


PROCESAMIENTO DE MUESTRAS SANGUÍNEAS PARA PROCESAMIENTO DE MUESTRAS SANGUÍNEAS PARA DIAGNÓSTICO Proyecto AECID 2012 Nuevos procedimientos para el diagnóstico de enfermedades olvidadas utilizando tele-microscopía de bajo coste. 1 TABLA DE CONTENIDOS

Más detalles

patológico en cáncer de mama

patológico en cáncer de mama Actualizaciones en diagnóstico patológico en cáncer de mama Dra. Leonor Moyano Sch Dra. Laura Carreño T Dra. Valeria Cornejo Dr. Arturo Espinoza N Dr. Pablo Matamala Dra. Verónica Sanhueza L Temario 1.

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

4. Preparación de muestras para microscopía óptica

4. Preparación de muestras para microscopía óptica para microscopía óptica Criterios en las técnicas de preparación Técnicas para luz transmitida Técnicas para luz reflejada El objetivo de la preparación de muestras para microscopía óptica es permitir

Más detalles



Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles


PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

EGFR pharmdx. Nº de catálogo K1494 50 pruebas para uso en el Dako Autostainer Edición 9/27/2006. Uso previsto Para uso en diagnóstico in vitro.

EGFR pharmdx. Nº de catálogo K1494 50 pruebas para uso en el Dako Autostainer Edición 9/27/2006. Uso previsto Para uso en diagnóstico in vitro. EGFR pharmdx Nº de catálogo K1494 50 pruebas para uso en el Dako Autostainer Edición 9/27/2006 Uso previsto Para uso en diagnóstico in vitro. El ensayo EGFR pharmdx es un kit inmunohistoquímico (IHQ) para

Más detalles

Principios Y Procedimientos

Principios Y Procedimientos Identificación del Producto N.º de ref. Descripción 44736 p21 0,1 M (DCS-60.2) 44737 p21 1 M (DCS-60.2) 44358 p21 RTU M (DCS-60.2) Definiciones De Los Símbolos P C A E S DIL DOC# DIS listo para usar concentrado

Más detalles

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

ELISA. Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes ELISA Enzyme Linked Immuno Sorbent Assay Dra Morella Bouchard Instituto de Inmunología Clínica Universidad de Los Andes

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Procesamiento de los frotis de Papanicolaou en el Laboratorio de Citopatología

Procesamiento de los frotis de Papanicolaou en el Laboratorio de Citopatología Procesamiento de los frotis de Papanicolaou en el Laboratorio de Citopatología Carlos Zamorano 1 & Julieta Sepúlveda 1 1 Licenciado en Tecnología Médica, U. de Concepción, Concepción, Chile Introducción

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Mercodia Ultrasensitive C-peptide ELISA

Mercodia Ultrasensitive C-peptide ELISA Mercodia Ultrasensitive C-peptide ELISA Instrucciones para el uso 10-1141-01 REACTIVOS PARA 96 DETERMINACIONES Para uso diagnóstico in vitro ATENCIÓN! Protocolo de actualización Fabricado por Mercodia

Más detalles


TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles

Frases-R y -S. Introducción.

Frases-R y -S. Introducción. Frases-R y -S Introducción Las llamadas Frases-R indican riesgos especiales que pueden surgir durante el manejo de sustancias o formulaciones peligrosas. La letra R es abreviatura de Riesgo. Según la Ordenanza

Más detalles


INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN

25. Perfil lipídico. Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 RESUMEN 25. Perfil lipídico Isaac Túnez Fiñana 1, Aurora Galván Cejudo 2 1 Departamento de Bioquímica y Biología Molecular, Avda. Menéndez Pidal s/n, 14071- Córdoba, 2 Campus de Rabanales, Edif. Severo Ochoa 14071-Córdoba

Más detalles



Más detalles

Analizador portátil til CD4. Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos

Analizador portátil til CD4. Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos Analizador portátil til CD4 Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos Qué es PIMA? Es la primer solución point-of-care para el análisis de CD4. Diseñado para desempeñarse

Más detalles

Departamento de Bioquímica y Biología Molecular,

Departamento de Bioquímica y Biología Molecular, 18. Inmunoanálisis Aurora Galván Cejudo 1, Isaac Túnez Fiñana 2 Departamento de Bioquímica y Biología Molecular, 1 Campus Universitario de Rabanales, Edificio Severo Ochoa, 14071-Córdoba, 2 Facultad de

Más detalles

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente.

Componentes 1. MCPL MICROPLACA: 12 x 8 pocillos recubiertos con antígenos recombinantes de HCV (E. coli). Pocillos separables individualmente. bioelisa HCV 4.0 3000-1115 LEER CAMBIOS SOMBREADOS 96 tests 3000-1116 480 tests Test de ELISA para la detección de anticuerpos contra el virus de la hepatitis C (HCV) en suero o plasma humano para ser

Más detalles



Más detalles


ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Página 1 de 9 ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Elaborado por: CNSP Blgo. Manuel Céspedes Zambrano Revisado por: CNSP TM. Julia I. Espinoza Soto CNSP MV Gladys Malásquez Mendoza Aprobado por: RD

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

Leica HER2 FISH System - 30 Test Instrucciones de uso

Leica HER2 FISH System - 30 Test Instrucciones de uso Leica HER2 FISH System - 30 Test Instrucciones de uso Para el uso en el sistema Leica Biosystems BOND-MAX and BOND-III TA9217 es un producto de hibridación in situ de fluorescencia diseñado para la tinción

Más detalles

Test Filaria Dirophilaria Canina

Test Filaria Dirophilaria Canina - 4 - Test Filaria Dirophilaria Canina Ref: AI01 DESCRIPCIÓN Detección de Antígenos específicos del Gusano del Corazón Filaria PRINCIPIO Ensayo Inmunocromatográfico en un solo paso DECTECCIÓN DE Antígenos

Más detalles

Cèl lules Mare i Càncer. Què són les cèl lules mare?

Cèl lules Mare i Càncer. Què són les cèl lules mare? Cèl lules Mare i Càncer Què són les cèl lules mare? Tipus de cèl lula mare a) Cèl lula mare embrionària (ES) b) Cèl lula mare adulta - Cèl lula mare adulta en un teixit sa - Cèl lula mare tumoral (CSC)

Más detalles



Más detalles

Técnicas. Transferencia de las proteínas a la membrana. Bloqueo de los sitios de unión inespecíficos.

Técnicas. Transferencia de las proteínas a la membrana. Bloqueo de los sitios de unión inespecíficos. Técnicas Transferencia de las proteínas a la membrana. Bloqueo de los sitios de unión inespecíficos. Lavado de la membrana. Anticuerpos primarios y secundarios. Marcaje de anticuerpos. Sustratos cromogénicos.

Más detalles



Más detalles

Obsevación y recuento de células sanguíneas. Semestre B-2010

Obsevación y recuento de células sanguíneas. Semestre B-2010 1 Práctica 2 Obsevación y recuento de células sanguíneas Semestre B-2010 Introducción En la sangre se encuentran los leucocitos o glóbulos blancos que son las células móviles del sistema inmunitario. Todos

Más detalles



Más detalles

Hoja de datos de seguridad del material

Hoja de datos de seguridad del material Conforme a ANSI Z400.1 Standard (México) 1. Hoja de datos de seguridad del material Identificación del producto y la compañía Nombre del producto Usos del material Proveedor/Fabricante Número Del Producto

Más detalles



Más detalles

Principios Y Procedimientos

Principios Y Procedimientos Identificación del Producto N.º de ref. Descripción 45322 IMPATH PAX-8 RTU M (MRQ- 50) Definiciones De Los Símbolos P A E S DOC# DIS listo para usar ascitis suero sobrenadante documento número distribuido

Más detalles

Conservar según el tipo de muestra hasta proceder a su envío al laboratorio.

Conservar según el tipo de muestra hasta proceder a su envío al laboratorio. Lunes a viernes 9:30 20 h/ Sábado 9:00 13:30 h Tlf: Envío de muestras La hoja de petición del laboratorio debe de cumplimentarse indicando las pruebas

Más detalles

Ficha de Datos de Seguridad según la Directiva (CE) nº 1907/2006

Ficha de Datos de Seguridad según la Directiva (CE) nº 1907/2006 Ficha de Datos de Seguridad según la Directiva (CE) nº 1907/2006 página 1 de 5 LOCTITE 2400 Nº SDB : 402939 V001.2 Revisión: 13.12.2011 Fecha de impresión: 22.04.2014 SECCIÓN 1: Identificación de la sustancia

Más detalles


FLOTA VAJILLAS 1,25L 1.- IDENTIFICACIÓN DE LA SUSTANCIA O LA MEZCLA Y DE LA SOCIEDAD O LA EMPRESA 1.1. Identificador del producto: Flota vajillas 1.2. Usos pertinentes identificados de la sustancia o de la mezcla y usos desaconsejados:

Más detalles

Kit TOP2A FISH pharmdx Nº de catálogo K5333

Kit TOP2A FISH pharmdx Nº de catálogo K5333 101752-001 / 20-01-03 Kit TOP2A FISH pharmdx Nº de catálogo K5333 3ª edición Para uso en diagnóstico in vitro El kit contiene reactivos suficientes para realizar 20 pruebas. (115086-002) K5333/ES/KVN/24.05.07

Más detalles



Más detalles

Cartera tecnológica de i-deals. Medicina. Substratos bioactivos para ingeniería de tejidos. Sistemas inyectables autogelificables y bioactivos

Cartera tecnológica de i-deals. Medicina. Substratos bioactivos para ingeniería de tejidos. Sistemas inyectables autogelificables y bioactivos Substratos bioactivos para ingeniería de tejidos Tecnología patentada de substratos bioactivos para ingeniería de tejidos. Cuatro productos de características y propiedades muy superiores a las que existen

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles


NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA Este laboratorio será acreditado en conjunto con el Laboratorio de Embriología cuando aquel funciones dentro del Centro. Cuando el laboratorio

Más detalles

Ficha de Datos de Seguridad

Ficha de Datos de Seguridad Ficha de Datos de Seguridad Conforme al Reglamento (CE) Nº 1907/2006 (REACH) ACOFARMA 1.- Identificación de la sustancia o del preparado y de la sociedad o empresa Identificación de la sustancia o del

Más detalles



Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

TP6: Western blot. Objetivos. Introducción

TP6: Western blot. Objetivos. Introducción TP6: Western blot Objetivos Familiarizarse con la técnica de western blot. Determinar los niveles de IgG en sueros murinos Comparar la sensibilidad del western blot vs el SDS page Introducción La transferencia

Más detalles


FLOTA LIMPIAHOGAR PINO 1.- IDENTIFICACIÓN DE LA SUSTANCIA O LA MEZCLA Y DE LA SOCIEDAD O LA EMPRESA 1.1. Identificador del producto: Flota Limpiahogar Pino 1.2. Usos pertinentes identificados de la sustancia o de la mezcla y

Más detalles


TÉCNICAS DE IMAGEN EN BIOLOGÍA TÉCNICAS DE IMAGEN EN BIOLOGÍA TÉCNICAS DE IMAGEN EN BIOLOGÍA Juan Luis Martínez (Ed.) N. Anadón, A.M. Coto, J.M. Fraga, A. González, J.L. Martínez, A.M. Nistal, D. Tolivia Vicerrectorado de Postgrado

Más detalles

Ficha de Datos de Seguridad Conforme a la Directiva 91/155/CEE de la Comisión Fecha de emisión: 03.02.2005 Reemplaza la emisión del 19.07.

Ficha de Datos de Seguridad Conforme a la Directiva 91/155/CEE de la Comisión Fecha de emisión: 03.02.2005 Reemplaza la emisión del 19.07. Ficha de Datos de Seguridad Fecha de emisión: 03.02.2005 Reemplaza la emisión del 19.07.2001 1. Identificación de la sustancia o del preparado y de la sociedad o empresa Identificación de la sustancia

Más detalles

-Test Parvovirus Canino (C.P.V.)

-Test Parvovirus Canino (C.P.V.) -Test Parvovirus Canino (C.P.V.) Ref: AI03 DESCRIPCIÓN Detección de Antígenos específicos Del Parvovirus Canino en 10 min PRINCIPIO Ensayo Inmunocromatográfico en un solo paso DECTECCIÓN DE Antígenos Parvovirus

Más detalles

Ficha de Datos de Seguridad Conforme al Reglamento (CE) Nº 1907/2006 (REACH)

Ficha de Datos de Seguridad Conforme al Reglamento (CE) Nº 1907/2006 (REACH) Ficha de Datos de Seguridad Conforme al Reglamento (CE) Nº 1907/2006 (REACH) AMONIACO 22-24.FDS ACOFARMA 1.- Identificación de la sustancia o del preparado y de la sociedad o empresa Identificación de

Más detalles


SEPARACIÓN DE ALUMINIO A PARTIR DE MATERIAL DE DESECHO Actividad Experimental SEPARACIÓN DE ALUMINIO A PARTIR DE MATERIAL DE DESECHO Investigación previa 1.- Investigar las medidas de seguridad que hay que mantener al manipular KOH y H SO, incluyendo que acciones

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Sulfato de Magnesio Heptahidratado

Sulfato de Magnesio Heptahidratado Empresa: Industrias Emu S.A. Teléfono (4)3732 Identificación del producto Sinónimos: Sal de Epsom, Sulfato Acido de Magnesio. N º CAS: 34-99-8 Peso molecular: 246,32 Fórmula química: MgSO47H2O 2 Composición

Más detalles

LIMPIEZA DEL MATERIAL DE LABORATORIO. La limpieza del material de laboratorio es un proceso que implica la eliminación de impurezas.

LIMPIEZA DEL MATERIAL DE LABORATORIO. La limpieza del material de laboratorio es un proceso que implica la eliminación de impurezas. LIMPIEZA DEL MATERIAL DE LABORATORIO Importancia de la limpieza del material de laboratorio. La limpieza del material de laboratorio es un proceso que implica la eliminación de impurezas. Una adecuada

Más detalles

KEYWORDS: immunity, cellular response, immunohistochemistry, paraffin inclusion, ethanol, cattle


Más detalles


HOJA DE DATOS DE SEGURIDAD Pag. 1 / 6 1. IDENTIFICACION DE LA SUSTANCIA /PREPARACION Y DE LA COMPAÑIA Detalles del producto: Nombre Comercial: Papel lustre Aplicación del producto: Papel para la elaboración de manualidades y envolturas.

Más detalles


SACARINA SÓDICA E - 954 FICHA DE DATOS DE SEGURIDAD Según Reglamento CE 1907/2006 (REACH), Reglamento CE 1272/2008 (CLP) y Reglamento CE 453/2010 SACARINA SÓDICA E - 954 Emitido: Febrero 2003 Versión: 09(03/12/12) \\server\docs\public\calidad\compartida\i

Más detalles


HOJA DE DATOS DE SEGURIDAD AGUA DESTILADA 1. Identificación de la sustancia/preparado y de la sociedad o empresa 1.1 Identificación de la sustancia o del preparado Denominación: Agua Destilada. 1.2 Uso de la sustancia o preparado: Para usos de

Más detalles

Principios Y Procedimientos

Principios Y Procedimientos Identificación del Producto N.º de ref. Descripción 44753 PAX-8 0,1 M (MRQ-50) 44754 PAX-8 1 M (MRQ-50) 44367 PAX-8 RTU M (MRQ-50) Definiciones De Los Símbolos P C A E S DIL DOC# DIS listo para usar concentrado

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Servicio Prevención de Riesgos Laborales

Servicio Prevención de Riesgos Laborales NORMAS DE TRABAJO SEGURO. PREPARACIÓN DE CITOSTÁTICOS. Nº 15 (Art. 18 Ley 31/1995 de Prevención de Riesgos Laborales. Deber de información) Los riesgos más comunes para la seguridad y salud así como las

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

Ficha de Datos de Seguridad Conforme al Reglamento (CE) Nº 1907/2006 (REACH) Denominación: Levadura cerveza polvo

Ficha de Datos de Seguridad Conforme al Reglamento (CE) Nº 1907/2006 (REACH) Denominación: Levadura cerveza polvo 1.- Identificación de la sustancia o del preparado y de la sociedad o empresa Identificación de la sustancia o del preparado Denominación: Levadura cerveza polvo Identificación de la sociedad o empresa:

Más detalles


REACCIONES DE IONES METÁLICOS Actividad Experimental 4 REACCIONES DE IONES METÁLICOS Investigación previa -Investigar las medidas de seguridad para trabajar con amoniaco -Investigar las reglas de solubilidad de las sustancias químicas.

Más detalles

Citología Forense A G O S T O 2 0 1 5. Generalidades

Citología Forense A G O S T O 2 0 1 5. Generalidades Citología Forense O M A R V I L L A C O R T A C A R I M É D I C O R E S I D E N T E D E A N A T O M Í A P A T O L Ó G I C A U N M S M - I N S T I T U T O D E M E D I C I N A L E G A L A G O S T O 2 0 1

Más detalles


2. PREPARACION DE MATERIAL BOTÁNICO PARA SU ESTUDIO ANATÓMICO Y MORFOLÓGICO 2. PREPARACION DE MATERIAL BOTÁNICO PARA SU ESTUDIO ANATÓMICO Y MORFOLÓGICO OBJETIVOS: 1.- Preparar material vegetal para su observación al microscopio óptico. 2.- Conocer los instrumentos y los métodos

Más detalles

Histology FISH Accessory Kit N.º de catálogo K5799

Histology FISH Accessory Kit N.º de catálogo K5799 Histology FISH Accessory Kit N.º de catálogo K5799 4ª edición Auflage Para hibridación in situ fluorescente (FISH) con cortes de tejidos fijados con formol e incluidos en parafina. El kit contiene reactivos

Más detalles


PROCESAMIENTO DE MUESTRAS VAGINALES PROCESAMIENTO DE MUESTRAS VAGINALES Proyecto AECID 2012 Nuevos procedimientos para el diagnóstico de enfermedades olvidadas utilizando tele-microscopía de bajo coste. 1 TABLA DE CONTENIDOS TOMA DE LA MUESTRA

Más detalles


5. MATERIAL Y MÉTODOS 5. MATERIAL Y MÉTODOS 5.1 ANIMALES Se utilizaron setenta ratas Wistar adultas, hembras (Bioterio Claude Bernard, BUAP) con un peso entre 170 y 240 g. Se colocaron en cajas de policarbonato con aserrín

Más detalles

El tipo de alteración observada también proporciona gran información:

El tipo de alteración observada también proporciona gran información: TEMA 5: ENZIMOLOGÍA CLÍNICA 1. Valor diagnóstico de las enzimas en el plasma. 2. Principios del análisis de enzimas 3. Análisis de isoenzimas. 4. Determinación enzimática de sustratos. 1. Valor diagnóstico

Más detalles

Hoja de datos de seguridad del material

Hoja de datos de seguridad del material Conforme a ANSI Z400.1 Standard (México) 1. Hoja de datos de seguridad del material Identificación del producto y la compañía Nombre del producto Usos del material Proveedor/Fabricante Número Del Producto

Más detalles

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT SensPERT Canine Parvovirus Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

Refractómetro Master- T Series

Refractómetro Master- T Series Refractómetro Master- T Series Nota: Asegúrese de que su refractómetro continúe operando apropiadamente y luzca nuevo por mucho tiempo! Asegúrese de limpiar el refractómetro completamente al hacer mediciones

Más detalles