RapidFinder STEC Detection Workflow

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "RapidFinder STEC Detection Workflow"


1 QUICK REFERENCE RapidFinder STEC Detection Workflow Aislamiento automático de ADN y detección de la PCR en tiempo real de E. coli O157:H7 y cepas "Big 6" de STEC no O157 Número de catálogo , , , N.º de pub. MAN Rev. A.0 Nota: Si desea conocer las recomendaciones de seguridad y riesgos biológicos, consulte el anexo Seguridad en el documento RapidFinder Shiga Toxin-Producing E. coli (STEC) Detection Workflow User Guide (Pub. no ). Lea las hojas de datos de seguridad (SDS) y siga las instrucciones de manipulación. Lleve el equipo de protección individual (EPI) adecuado (gafas, ropa, guantes). Esta referencia rápida se ha diseñado para usuarios expertos del RapidFinder STEC Detection Workflow. Consulte la RapidFinder Métodos Preparación de las muestras de alimentos Shiga Toxin-Producing E. coli (STEC) Detection Workflow User Guide (Pub. no ) para obtener la siguiente información: Directrices importantes sobre el procedimiento Instrucciones detalladas Solución de problemas 1 Homogeneización y enriquecimiento de las muestras de alimentos Incubar a 42±1 C 375 g de carne picada/recortes +1 l de TSB (precalentado a 48±1 C) 10 horas como mínimo Muestra enriquecida Aislamiento del ADN con el PrepSEQ Nucleic Acid Extraction Kit 2 Preparación de Binding Solution y Wash Buffer Prepare estos reactivos antes de usar por primera vez un nuevo PrepSEQ Nucleic Acid Extraction Kit. 35 ml 74 ml, mezclar Isopropanol al 100 % Etanol al 95 % Binding Solution Wash Buffer 3 Preparación de los reactivos a. Prepare el Proteinase K Buffer Mix, mezcle bien y almacénelo con hielo hasta que esté listo para su uso. Componente Volumen por extracción Volumen para n extracciones [1] Proteinase K 10 µl 200 µl 10 µl 11 µl n PK Buffer 200 µl 220 µl n Volumen total por extracción 210 µl 231 µl n PK Buffer Proteinase K Buffer Mix Proteinase K [1] Incluye un 10 % de excedente. Para analizar muestras ambientales y de alimentos solamente.

2 3 Preparación de los reactivos (cont.) b. Justo antes de su uso, prepare el Binding Mix y agítelo durante 10 segundos aproximadamente. Componente Volumen por extracción Volumen para n extracciones [1] Binding Solution (isopropanol) Magnetic Particles precalentadas a 37±1 C y completamente resuspendidas Volumen total por extracción [1] Incluye un 10 % de excedente. 325 µl 25 µl 325 µl 357,5 µl n 25 µl 27,5 µl n 350 µl Magnetic Particles 385 µl n 37±1 C, agitar Binding Mix Binding Solution 4 Preparación de la placa de lisis 210 µl 200 µl a b Proteinase K Buffer Mix PLACA DE LISIS (MagMAX Express-96 Deep Well Plate) Muestra enriquecida 5 Preparación de las placas de procesamiento MagMAX Express-96 Peine para muestras con puntas Elution Buffer 300 µl Wash Buffer 300 µl 140 µl PEINE PARA MUESTRAS CON PUNTAS PLACA DE ELUCIÓN PLACA DE LAVADO 1 PLACA DE LAVADO 2 2 Referencia rápida de RapidFinder STEC Detection Workflow (aislamiento automático de ADN)

3 6 Procesamiento de las muestras en el instrumento MagMAX Express-96 PEINE PARA MUESTRAS CON PUNTAS MagMAX Express-96 a Seleccionar _PrepSEQ_STEC. Pulse Start (Iniciar). b PLACA DE ELUCIÓN PLACA DE LAVADO 1 PLACA DE LAVADO 2 PLACA DE LISIS Cargue las placas de acuerdo con la lectura del instrumento e inicie el proceso. 350 µl 200 µl Enjoy your DNA (Disfrute de su ADN) Lysis Buffer PLACA DE LISIS 10 min c Binding Mix 2 min PLACA DE ELUCIÓN PLACA DE LISIS d 30 min e PUNTO DE PARADA (opcional) Selle la placa y almacene el ADN: A 5±3 C durante un máximo de 24 horas. Por debajo de 18 C para un almacenamiento a largo plazo. Realización de la PCR con el RapidFinder Ensayo de cribado de STEC 7 8 Creación o edición del archivo de ejecución en RapidFinder Express Software Siga las instrucciones de los mensajes del software. Preparación de las microesferas del ensayo Según la disposición de la placa determinada por el RapidFinder Express Software, coloque las tiras de tubos con las microesferas del ensayo o vacíe las MicroAmp Fast 8 Tube Strips en una base de 96 pocillos a temperatura ambiente (23±5 C). Cribado STEC BASE DE 96 POCILLOS Referencia rápida de RapidFinder STEC Detection Workflow (aislamiento automático de ADN) 3

4 9 Preparación de las reacciones de la PCR Siga y mantenga la disposición de la placa determinada por el software mientras prepara las reacciones de la PCR. 30 µl temperatura ambiente PLACA DE ELUCIÓN a BASE DE 96 POCILLOS 1. Agitar a velocidad elevada de 5 a 10 segundos 2. Centrifugar a g durante 30 segundos 3. Repetir b 10 Carga y ejecución de las reacciones Siga las instrucciones de los mensajes del software. 11 Visualización de los resultados del ensayo de cribado Realización de la PCR con el RapidFinder Ensayo de confirmación de STEC 12 Preparación y ejecución del ensayo de confirmación de STEC El procedimiento de PCR en tiempo real es idéntico al del ensayo de cribado, a excepción de la selección del ensayo. Confirmación STEC 4 Referencia rápida de RapidFinder STEC Detection Workflow (aislamiento automático de ADN)

5 13 Visualización, impresión y exportación de los resultados del ensayo de confirmación de STEC Imprima o exporte los resultados desde la pestaña Reports (Informes) de la página View Results (Ver resultados). Para obtener más información acerca del análisis de los datos, consulte: La guía de usuario de su instrumento. La ayuda en línea de RapidFinder Express Software. RapidFinder Shiga Toxin-Producing E. coli (STEC) Detection Workflow User Guide. Métodos de confirmación independientes USDA FSIS MLG 5.08 e ISO 16654:2001 son protocolos aprobados para la confirmación de E. coli O157:H7 y E. coli O157 respectivamente. Se pueden usar los ensayos TaqMan mostrados en las tablas siguientes para distinguir entre los serogrupos de las muestras cuyo resultado se determine positivo según el RapidFinder Ensayo de confirmación de STEC. Tabla 1 Ensayos TaqMan STEC (diseño ISO) Ensayo [1] Cat. no. Ensayo TaqMan STEC 045 y Ensayo TaqMan STEC 026, 0103 y Ensayo TaqMan STEC 0111 y [1] Siga las directrices ISO/TS 13136:2012. Historial de revisiones Revisión Fecha Descripción A.0 Noviembre de 2014 Documento nuevo. Referencia rápida para usuarios expertos. Limited product warranty Life Technologies Corporation and/or its affiliate(s) warrant their products as set forth in the Life Technologies' General Terms and Conditions of Sale found on Life Technologies' website at If you have any questions, please contact Life Technologies at Tabla 2 Ensayos TaqMan STEC (diseño MLG) Ensayo [1] Cat. no. TaqMan STEC O103 y O TaqMan STEC O26 y O TaqMan STEC O45 y O [1] Siga las directrices USDA FSIS MLG 5B (no O157). Referencia rápida de RapidFinder STEC Detection Workflow (aislamiento automático de ADN) 5


Manual. Isolation transformer 7000 W 230V 32A

Manual. Isolation transformer 7000 W 230V 32A Manual ES Isolation transformer 7000 W 230V 32A Copyrights 2008 Victron Energy B.V. All Rights Reserved This publication or parts thereof may not be reproduced in any form, by any method, for any purpose.

Más detalles

Pathatrix Auto System Análisis de patógenos simplificado

Pathatrix Auto System Análisis de patógenos simplificado Pathatrix Auto System Análisis de patógenos simplificado Perfecto para su procedimiento de detección de patógenos Conozca el sistema Pathatrix Auto System, rápido, preciso, rentable y fácil de utilizar.

Más detalles

Manual. Isolation transformer 2000W 115/230V 18/ 9A 3600W 115/230V 32/16A

Manual. Isolation transformer 2000W 115/230V 18/ 9A 3600W 115/230V 32/16A Manual ES Isolation transformer 2000W 115/230V 18/ 9A 3600W 115/230V 32/16A Copyrights 2008 Victron Energy B.V. All Rights Reserved This publication or parts thereof may not be reproduced in any form,

Más detalles

Destilador/Purificador Solar

Destilador/Purificador Solar ALTA TECNOLOGIA VERDE Purifique su Propia Agua Elimine Botellas Plásticas Elimine Compra Porrón No Usa Electricidad Energía Renovable Destruye Virus y Bacterias Elimina Arsénico, Plomo, Pesticidas Elimina

Más detalles

TrueScience RespiFinder Identification Panels

TrueScience RespiFinder Identification Panels TrueScience RespiFinder Identification Panels TARJETA DE REFERENCIA RÁPIDA Si desea conocer las recomendaciones de seguridad y riesgos biológicos, consulte el apartado Safety en el documento TrueScience

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Assembly Instructions. Tools required for assembly: Small wrench. Operating Instructions. Cleaning Your KaZAM Bicycle WARNING: WARNING:

Assembly Instructions. Tools required for assembly: Small wrench. Operating Instructions. Cleaning Your KaZAM Bicycle WARNING: WARNING: A Assembly Instructions WARNING: WARNING: Tools required for assembly: Small wrench Operating Instructions - Cleaning Your KaZAM Bicycle Limited Warranty - two THIS WARRANTY DOES NOT COVER NORMAL WEAR

Más detalles


Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

Autodesk. SketchBook INK. Consejos y Trucos. Android

Autodesk. SketchBook INK. Consejos y Trucos. Android Autodesk SketchBook INK Consejos y Trucos Android Contents Consejos antes de Empezar 3 Primeros Pasos 4 Crear un lienzo 4 Navegación 4 Ocultar la interfaz de usuario 4 Color 5 Personalización de la paleta

Más detalles

Kofax. Desktop 2.0. Guía de instalación 10300952-000

Kofax. Desktop 2.0. Guía de instalación 10300952-000 Kofax Desktop 2.0 Guía de instalación 10300952-000 2009-2010 Kofax, Inc., 15211 Laguna Canyon Road, Irvine, California 92618, U.S.A. All rights reserved. Use is subject to license terms. Third-party software

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

VCC-HD2300/HD2300P VCC-HD2100/HD2100P

VCC-HD2300/HD2300P VCC-HD2100/HD2100P VCC-HD2300/HD2300P VCC-HD2100/HD2100P Aviso de Copyright Uso del manual Aviso de Copyright/Uso del manual1/8 Este manual de instrucciones es propiedad intelectual de SANYO Electric Co., Ltd. Los materiales

Más detalles

Servicio de Reclamos Amadeus Guía Rápida

Servicio de Reclamos Amadeus Guía Rápida Servicio de Reclamos Amadeus Guía Rápida 2013 Amadeus North America, Inc. All rights reserved. Trademarks of Amadeus North America, Inc. and/or affiliates. Amadeus is a registered trademark of Amadeus

Más detalles

EMC SourceOne TM para Microsoft SharePoint 7.0 Búsqueda de archivo Tarjeta de referencia rápida

EMC SourceOne TM para Microsoft SharePoint 7.0 Búsqueda de archivo Tarjeta de referencia rápida EMC SourceOne TM para Microsoft SharePoint 7.0 Búsqueda de archivo Tarjeta de referencia rápida Utilice la búsqueda de archivo para buscar y restaurar contenido de SharePoint que se encuentre archivado

Más detalles



Más detalles


GENERAR DOCUMENTACIÓN ON-DEMAND GENERAR DOCUMENTACIÓN ON-DEMAND Todd Waits Software Engineering Institute Carnegie Mellon University Pittsburgh, PA 15213 Incorporando Administrado Repositorios De Información Para Generar Documentación

Más detalles

Servicio de Reclamos Amadeus Guía Rápida

Servicio de Reclamos Amadeus Guía Rápida Servicio de Reclamos Amadeus Guía Rápida 2013 Amadeus North America, Inc. All rights reserved. Trademarks of Amadeus North America, Inc. and/or affiliates. Amadeus is a registered trademark of Amadeus

Más detalles

Administración del laboratorio de prácticas

Administración del laboratorio de prácticas Primera publicación: 20 de agosto de 2015 Utilice la administración del laboratorio de prácticas de WebEx para configurar y mantener los laboratorios y las computadoras de las sesiones del laboratorio

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

FOR INFORMATION PURPOSES ONLY Terms of this presentation

FOR INFORMATION PURPOSES ONLY Terms of this presentation Protección de la Inversión a Través del Tiempo Christian Jaramillo TECNOAV Sesión en Español FOR INFORMATION PURPOSES ONLY Terms of this presentation This presentation was based on current information

Más detalles

- 1 - Servicios de otros fabricantes

- 1 - Servicios de otros fabricantes Servicios de otros fabricantes Si utiliza servicios de otros fabricantes con el PRODUCTO, el uso de dichos servicios está sujeto a las condiciones que se indican a continuación. Si accede y/u obtiene contenido

Más detalles

Hoja de trabajo de configuración de la serie EMC VNXe

Hoja de trabajo de configuración de la serie EMC VNXe Hoja de trabajo de configuración de la serie EMC VNXe Número de referencia del documento: 300-015-329 Rev. 01 Use esta hoja de trabajo para reunir y registrar la información necesaria para configurar el

Más detalles

Mejore su proceso de administración de viajes y reservas en línea con SAP Cloud for Travel & Expense y GetThere Francisco Del Valle Marzo 12, 2014

Mejore su proceso de administración de viajes y reservas en línea con SAP Cloud for Travel & Expense y GetThere Francisco Del Valle Marzo 12, 2014 Mejore su proceso de administración de viajes y reservas en línea con SAP Cloud for Travel & Expense y GetThere Francisco Del Valle Marzo 12, 2014 SAP FORUM 2014 COLOMBIA 2011 SAP AG. All rights reserved.

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

Limited TWO-YEAR Warranty SENSIO Inc. hereby warrants that for a period of TWO YEARS from the date of purchase, this product will be free from mechanical defects in material and workmanship, and for 90

Más detalles

5 puntos clave para movilizar su negocio. Jorge Seoane Septiembre 2014

5 puntos clave para movilizar su negocio. Jorge Seoane Septiembre 2014 5 puntos clave para movilizar su negocio Jorge Seoane Septiembre 2014 Movilidad está reformulando la empresa Movilizar Contenido Movilizar Personas Conectar Cosas Conectar Lugares 2014 SAP AG or an SAP

Más detalles

Microcat LIVE Toyota. Guía Rápida de los Recambios

Microcat LIVE Toyota. Guía Rápida de los Recambios Microcat LIVE Toyota Guía Rápida de los Recambios Contenido Introducción... 2 Para comenzar... 3 Iniciar Microcat LIVE... 3 Conexión al sistema y desconexión... 3 Cambiar Fuente de Datos... 4 Paso 1 Identificación

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles


SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. Technical Manual SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. IMPRESO EN ESTADOS UNIDOS Nro. de pieza: TMD037 SwabSolution Kit Toda la bibliografía técnica está disponible en Internet,

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

Plataforma de movilidad SAP en la Nube

Plataforma de movilidad SAP en la Nube Plataforma de movilidad SAP en la Nube Jorge Seoane PDM Latinoamérica SAP Forum La demanda de movilidad Mayor productividad Acceso a back office Acceso a entretenimiento Servir a empleados y consumidores

Más detalles

Light Account Siguientes pasos FAQ

Light Account Siguientes pasos FAQ Light Account Siguientes pasos Light Account Abra la notificación en su correo y haga click en Procesar pedido 2 Siguiente Paso: Registre su cuenta ligera en Ariba Network En la página de registro seleccione

Más detalles

Voyager Serie 1400g. Guía de inicio rápido. Escáner alámbrico de Captura de Imágenes (Area-Imaging) VG1400-LS-QS Rev A 10/12

Voyager Serie 1400g. Guía de inicio rápido. Escáner alámbrico de Captura de Imágenes (Area-Imaging) VG1400-LS-QS Rev A 10/12 Voyager Serie 1400g Escáner alámbrico de Captura de Imágenes (Area-Imaging) Guía de inicio rápido VG1400-LS-QS Rev A 10/12 Nota: Consulte el manual de usuario para obtener información sobre la limpieza

Más detalles


DNA IQ Casework Pro Kit for Maxwell 16 INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS AS1240 Y DC6745. Technical Manual DNA IQ Casework Pro Kit for Maxwell 16 INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS AS1240 Y DC6745. IMPRESO EN ESTADOS UNIDOS. Revisado el 11/11 DNA IQ Casework Pro Kit for Maxwell 16 Toda

Más detalles

Software TRENDnetVIEW Pro. Guía de instalación rápida de TRENDnetVIEW Pro (1)

Software TRENDnetVIEW Pro. Guía de instalación rápida de TRENDnetVIEW Pro (1) Software TRENDnetVIEW Pro Guía de instalación rápida de TRENDnetVIEW Pro (1) TRENDnetVIEW Pro/10.08.2013 Índice Requisitos del software de gestión TRENDnetVIEW Pro... 19 Instalación de TRENDnetVIEW Pro...

Más detalles


MOBI INSTRUCCIONES DE INSTALACIÓN MOBI INSTRUCCIONES DE INSTALACIÓN Caja modular de interior Contenido 1 General 2 Contenido del kit 3 Montaje a pared de caja de operador y de cliente III Módulo Único 9 Preparación del cable en paso 10

Más detalles

DDR3 Unbuffered DIMMs Evaluated with AMD Phenom II X6 Processors

DDR3 Unbuffered DIMMs Evaluated with AMD Phenom II X6 Processors DDR3 Unbuffered s Evaluated with AMD Phenom II X6 Processors This list contains DDR3 unbuffered s that have been evaluated by AMD and have shown reliable operation on the AMD internal reference platform.

Más detalles

Guía de referencia rápida / Quick reference guide Visor de Noticias Slider / NCS News Slider for SharePoint

Guía de referencia rápida / Quick reference guide Visor de Noticias Slider / NCS News Slider for SharePoint Guía de referencia rápida / Quick reference guide Visor de Noticias Slider / NCS News Slider for SharePoint Contenido ESPAÑOL... 3 Términos de Uso... 3 Soporte... 3 Look de la Aplicación... 3 Requisitos

Más detalles

Pantalla principal NOTA

Pantalla principal NOTA MusicSoft Manager ha sido diseñado para iphone, ipod touch e ipad y se puede utilizar para realizar las siguientes tareas de gestión de canciones, datos de estilo y otros archivos utilizados en instrumentos

Más detalles

Xenon 1900/1910. Guía de inicio rápido. Escáner lector. NG2D-ES-QS Rev D 10/12

Xenon 1900/1910. Guía de inicio rápido. Escáner lector. NG2D-ES-QS Rev D 10/12 Xenon 1900/1910 Escáner lector Guía de inicio rápido NG2D-ES-QS Rev D 10/12 Nota: Consulte el manual de usuario para obtener información sobre la limpieza del dispositivo. Para acceder a este documento

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

MagicInfo Express Creador de contenido

MagicInfo Express Creador de contenido MagicInfo Express Creador de contenido MagicInfo Express Creador de contenido Guía del usuario MagicInfo Express Creador de contenido es un programa que permite crear cómodamente contenido LFD usando distintas

Más detalles

Mejoramiento continuo de sus servicios gracias a SAP Business One

Mejoramiento continuo de sus servicios gracias a SAP Business One Mejoramiento continuo de sus servicios gracias a SAP Business One Jorpa Ingeniería Industria Ingeniería y Construcción Locación Chile Productos y Servicios Servicios de ingeniería enfocados principalmente

Más detalles

Grupo Merza: 70% más agilidad en tiempos de respuesta con SAP ERP on HANA

Grupo Merza: 70% más agilidad en tiempos de respuesta con SAP ERP on HANA SAP BTS Distribución Mayoreo y Menudeo Grupo Merza Fotografía utilizada con el permiso de Grupo Merza 2015 SAP SE or an SAP affiliate company. All rights reserved. Grupo Merza: 70% más agilidad en tiempos

Más detalles

Protección modo común

Protección modo común MADE IN FRANCE 1 Protección modo común DPS - CLASE I - Descripción Técnica CONFORMIDAD DE PRODUCTO CON IEC 61643-11 DPS - CLASE I - Descripción Técnica Clase según IEC61643-11 Forma Constructiva No. Polos

Más detalles

Santiago Anguera Tania Van Buyten. Huntsman Polyurethanes. PDA Europe 2010 Annual Conference It's Time to Polyurea Sitges, Spain 15-17 November

Santiago Anguera Tania Van Buyten. Huntsman Polyurethanes. PDA Europe 2010 Annual Conference It's Time to Polyurea Sitges, Spain 15-17 November Membrana impermeabilizante de poliurea, combinada con la espuma VYDRO para cubiertas ecológicas. Santiago Anguera Tania Van Buyten Huntsman Polyurethanes Contenido Lugar de aplicación Descripción de la

Más detalles

Lidiando con el contenido no estructurado. An Oracle White Paper Junio 2009

Lidiando con el contenido no estructurado. An Oracle White Paper Junio 2009 Lidiando con el contenido no estructurado An Oracle White Paper Junio 2009 Lidiando con el contenido no estructurado El contenido no estructurado es cualquier tipo de información que no esta contenida

Más detalles

Roadshow ECM 2010. Proyecto Imaging & Workflow Barclays. Miguel Ángel García de la Cruz

Roadshow ECM 2010. Proyecto Imaging & Workflow Barclays. Miguel Ángel García de la Cruz Roadshow ECM 2010 Proyecto Imaging & Workflow Barclays Miguel Ángel García de la Cruz 1 Índice Necesidades de Barclays Descripción del proyecto Por qué IBM ECM Por qué GBS 2 Necesidades de Barclays Barclays

Más detalles

Creating your Single Sign-On Account for the PowerSchool Parent Portal

Creating your Single Sign-On Account for the PowerSchool Parent Portal Creating your Single Sign-On Account for the PowerSchool Parent Portal Welcome to the Parent Single Sign-On. What does that mean? Parent Single Sign-On offers a number of benefits, including access to

Más detalles

Quick Installation Guide TU2-DVIV H/W: V1.0R

Quick Installation Guide TU2-DVIV H/W: V1.0R Quick Installation Guide TU2-DVIV H/W: V1.0R Table Table of Contents of Contents Español... 1. Antes de iniciar... 2. Cómo se instala... 1 1 3 Troubleshooting... 6 Version 06.27.2008 1. Antes de iniciar

Más detalles

UNE EPM Telecomunicaciones S.A: Automatización de la gestión de accesos y mayor control de riesgos con SAP Access Control rapid-deployment solution

UNE EPM Telecomunicaciones S.A: Automatización de la gestión de accesos y mayor control de riesgos con SAP Access Control rapid-deployment solution SAP Estudio de la Transformación del Negocio Productos de consumo masivo J. Macêdo 2014 SAP AG or an SAP affiliate company. All rights reserved. UNE EPM Telecomunicaciones S.A: Automatización de la gestión

Más detalles

Guía de inicio rápido

Guía de inicio rápido Terminal Portátil Dolphin 6500 con Windows CE 5.0 Guía de inicio rápido Terminal Portátil Dolphin 6500 Cuando retire el embalaje Verifique que el cartón contenga los siguientes elementos: Terminal Portátil

Más detalles

Soluciones Innovadoras

Soluciones Innovadoras CONECTOR TLC 8802 Manual de instalación para cable FRP Soluciones Innovadoras Your Broadband Deployment Partner Para cable FRP El nuevo conector de 3M TLC 8802 sin herramientas permite una rapida instalación

Más detalles

Preguntas y respuestas

Preguntas y respuestas Autodesk Revit Autodesk Revit Architecture Autodesk Revit MEP Autodesk Revit Structure Autodesk Revit LT Preguntas y respuestas Este documento proporciona preguntas y respuestas sobre el uso del software

Más detalles

SAP Banking Forum Millennials live. Buenos Aires, Agosto 2014

SAP Banking Forum Millennials live. Buenos Aires, Agosto 2014 SAP Banking Forum Millennials live Buenos Aires, Agosto 2014 Es un paradigma diferente, con nuevas reglas. Los consumidores están cambiando las reglas. La tecnología está creando nuevos paradigmas. 2014

Más detalles

Cómo proteger su organización con una estrategia de Administración de Dispositivos Móviles? Rodrigo Calvo,CISSP, ITIL v3, SNIA

Cómo proteger su organización con una estrategia de Administración de Dispositivos Móviles? Rodrigo Calvo,CISSP, ITIL v3, SNIA Cómo proteger su organización con una estrategia de Administración de Dispositivos Móviles? Rodrigo Calvo,CISSP, ITIL v3, SNIA Sr. Systems Engineer MCLA Region Technology Day 2014 Implicaciones de la Movilidad

Más detalles


1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS. Página 1 de 5 CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain.

Más detalles

Planes de Carrera, Sucesión y Analíticos Viviane Mozer

Planes de Carrera, Sucesión y Analíticos Viviane Mozer Planes de Carrera, Sucesión y Analíticos Viviane Mozer Business Architect Latin America El futuro de los negocios El acceso global a mercados y Colaboración talentos rediseñará entre el equipos mundo de

Más detalles

Protegiendo la información gubernamental: Retos y recomendaciones

Protegiendo la información gubernamental: Retos y recomendaciones Protegiendo la información gubernamental: Retos y recomendaciones Gerardo Maya Alvarez Security Principal Consultant Protegiendo la información gubernamental: Retos y recomendaciones 1 Agenda 1 Analizando

Más detalles

Detección de Salmonella spp. en muestras de producción primaria por PCR en tiempo real

Detección de Salmonella spp. en muestras de producción primaria por PCR en tiempo real GUÍA DE USUARIO Detección de Salmonella spp. en muestras de producción primaria por PCR en tiempo real Aislamiento de ADN automatizado o mediante columna de centrifugación para uso con: PrepSEQ Nucleic

Más detalles

GUÍA DE USUARIO (No oficial) OpenBSD 5.1

GUÍA DE USUARIO (No oficial) OpenBSD 5.1 GUÍA DE USUARIO (No oficial) Open 5.1 Guía básica: Open-Gnome 3 Imágenes tomadas desde www.openbsd.org Este pequeño escrito (no oficial) esta dedicado a aquellas personas amantes del software libre y que

Más detalles

Aastra 400 R3.1. Presentación de Producto Yolanda Albarracín depl-1965 v1.0. Aastra Telecom Spain A Mitel Company. Aastra 400 R3.1

Aastra 400 R3.1. Presentación de Producto Yolanda Albarracín depl-1965 v1.0. Aastra Telecom Spain A Mitel Company. Aastra 400 R3.1 Aastra 400 R3.1 Presentación de Producto Yolanda Albarracín depl-1965 v1.0 Aastra 400 R3.1 Aastra Telecom Spain A Mitel Company Visión general Aastra 400 R3.1 Aastra 6863i Aastra 6865i Aastra 6867i Aastra

Más detalles

Mejores prácticas para reuniones seguras para organizadores de Cisco WebEx

Mejores prácticas para reuniones seguras para organizadores de Cisco WebEx Mejores prácticas para reuniones seguras para organizadores de Cisco WebEx Primera publicación: 15 de marzo de 2016 Americas Headquarters Cisco Systems, Inc. 170 West Tasman Drive San Jose, CA 95134-1706

Más detalles

Fondo y pantalla inactiva. Guía del administrador

Fondo y pantalla inactiva. Guía del administrador Fondo y pantalla inactiva Guía del administrador Septiembre de 2016 www.lexmark.com Contenido 2 Contenido Descripción general...3 Configuración de la aplicación...4 Acceso a la página de configuración

Más detalles

La Innovación como motor del Crecimiento de las Empresas de Consumo. João Paulo da Silva Director General SAP Iberia

La Innovación como motor del Crecimiento de las Empresas de Consumo. João Paulo da Silva Director General SAP Iberia La Innovación como motor del Crecimiento de las Empresas de Consumo João Paulo da Silva Director General SAP Iberia El porqué de la Innovación Tecnológica en la Empresa Impacto de las Nuevas Tecnologías

Más detalles

Cómo convertirse en un negocio en tiempo real con SAP Business Suite basado en SAP HANA

Cómo convertirse en un negocio en tiempo real con SAP Business Suite basado en SAP HANA de la solución SAP SAP Business Suite basado en SAP HANA Objetivos Cómo convertirse en un negocio en tiempo real con SAP Business Suite basado en SAP HANA Maneje todo su negocio en tiempo real Maneje todo

Más detalles

HDD TWAIN driver Manual del Operador

HDD TWAIN driver Manual del Operador 4037-9634-10 HDD TWAIN driver Manual del Operador Contenido 1 Introducción 1.1 Qué es un controlador HDD TWAIN?...1-1 1.2 Modo de utilización de un controlador HDD TWAIN...1-2 1.3 Entorno operativo...1-3

Más detalles

Seguridad en Aplicaciones Críticas; SAT. Carlos Jiménez González

Seguridad en Aplicaciones Críticas; SAT. Carlos Jiménez González Seguridad en Aplicaciones Críticas; SAT Carlos Jiménez González Industry Forum 2009 2009 IBM Corporation Agenda Quién es el SAT? Necesidad Búsqueda de Soluciones Porqué asegurar los datos / Bases de Datos?

Más detalles

Check our AVR setup tips online Usa.denon.com/SetupTips Ca.Denon.com/SetupTips

Check our AVR setup tips online Usa.denon.com/SetupTips Ca.Denon.com/SetupTips ENGLISH AVR-S710W INTEGRATED NETWORK AV RECEIVER FRANÇAIS ESPAÑOL Quick Start Guide Guide de configuration rapide / Guía de configuración rápida Read Me First... Lisez-moi en premier... / Lea esto primero...

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

AV Surround Receiver NR1606. Quick Start Guide. Read Me First... Please do not return this unit to the store. If you need help

AV Surround Receiver NR1606. Quick Start Guide. Read Me First... Please do not return this unit to the store. If you need help ENGLISH FRANÇAIS AV Surround Receiver NR1606 ESPAÑOL Quick Start Guide Guide de configuration rapide / Guía de configuración rápida Read Me First... Lisez-moi en premier... / Lea esto primero... Please

Más detalles

Buildtek: La evolución del negocio con SAP

Buildtek: La evolución del negocio con SAP Historia de Éxito Minería Tecnologías Industriales Buildtek S.A. Buildtek: La evolución del negocio con SAP Compañía Tecnologías Industriales Buildtek S.A. Industria Construcción Productos y Servicios

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

foodproof RoboPrep + Series Automatización completa de la extracción de ADN y preparación de la PCR

foodproof RoboPrep + Series Automatización completa de la extracción de ADN y preparación de la PCR foodproof RoboPrep + Series Automatización completa de la extracción de ADN y preparación de la PCR TISELAB: QUIÉNES SOMOS Tiselab es una empresa proveedora de industria farmacéutica y alimentaria. Tenemos

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Muebles Liz: información más eficiente con SAP

Muebles Liz: información más eficiente con SAP SAP Estudio de la Transformación del Negocio Productos de consumo masivo J. Macêdo Muebles Liz: información más eficiente con SAP Liz Muebles Industria Consumo Masivo Locación México Productos y Servicios

Más detalles

Evento SOCINFO - Madrid 19 Octubre 2.005 Modelos de Cooperación Proveedores TIC - AAPP. Jordi Aracil Director Sector Público SAP España

Evento SOCINFO - Madrid 19 Octubre 2.005 Modelos de Cooperación Proveedores TIC - AAPP. Jordi Aracil Director Sector Público SAP España Evento SOCINFO - Madrid 19 Octubre 2.005 Modelos de Cooperación Proveedores TIC - AAPP Jordi Aracil Director Sector Público SAP España GUSP Principado de Asturias Comunidad foral de Navarra Generalitat

Más detalles

Coopeande 5: Ofreciendo los mejores precios con SAP

Coopeande 5: Ofreciendo los mejores precios con SAP Fotografía utilizada con el permiso de Coopeande5 2015 SAP SE or an SAP affiliate company. All rights reserved. Partner Coopeande 5: Ofreciendo los mejores precios con SAP Coopeande Nº5 es una Entidad

Más detalles


EMC/MAGIRUS/BROCADE VSPEX - VENTAJAS DE UNA SOLUCIÓN CONJUNTA. Borja Pérez (Magirus) Iván Bello (Brocade) EMC/MAGIRUS/BROCADE VSPEX - VENTAJAS DE UNA SOLUCIÓN CONJUNTA Borja Pérez (Magirus) Iván Bello (Brocade) 2012 Brocade Communications Systems, Inc. Company Proprietary Information 1 Legal Disclaimer All

Más detalles

Guía de Soporte: Como un Socio de HP puede obtener su acceso al HP Partner Portal y a The Learning Center

Guía de Soporte: Como un Socio de HP puede obtener su acceso al HP Partner Portal y a The Learning Center Guía de Soporte: Como un Socio de HP puede obtener su acceso al HP Partner Portal y a The Learning Center Introducción Si usted trabaja para un socio de HP y está a punto de iniciar su proceso de entrenamiento

Más detalles

Consejos y Trucos. ios

Consejos y Trucos. ios Consejos y Trucos ios Contents Consejos antes de Empezar 3 Primeros Pasos 4 Crear un lienzo 4 Navegación 4 Ocultar la interfaz de usuario 4 Color 5 Personalización de la paleta de colores 5 Seleccionando

Más detalles

Altos Hornos: Vanguardia tecnológica en materia de atención al cliente

Altos Hornos: Vanguardia tecnológica en materia de atención al cliente Altos Hornos: Vanguardia tecnológica en materia de atención al cliente Altos Hornos de México, S.A.B. de C.V. (AHMSA) Industria Primary Metal and Mining Locación México Productos y Servicios Extracción

Más detalles

Aplicación de metodologías tradicionales y alternativas en el diagnóstico oficial de E. coli O157 H7 para procesos de exportación en Chile

Aplicación de metodologías tradicionales y alternativas en el diagnóstico oficial de E. coli O157 H7 para procesos de exportación en Chile Aplicación de metodologías tradicionales y alternativas en el diagnóstico oficial de E. coli O157 H7 para procesos de exportación en Chile Subtitulo de la presentación en una línea IRMA ACEVEDO GONZÁLEZ

Más detalles

Los retos de seguridad en el ciclo de vida de la información en la Administración Pública Federal: Clasificación, acceso y retención

Los retos de seguridad en el ciclo de vida de la información en la Administración Pública Federal: Clasificación, acceso y retención Los retos de seguridad en el ciclo de vida de la información en la Administración Pública Federal: Clasificación, acceso y retención Rafael García Julio 2009 Retos en la APF 2 Retos en la APF Existe una

Más detalles

Traspaso de material de devolución.

Traspaso de material de devolución. SAP ECC 5.00 Octubre 2005 Español Traspaso de material de devolución. Business Process Procedure SAP AG Neurottstr. 16 69190 Walldorf Germany Copyright Copyright 2005 SAP AG. All rights reserved. No part

Más detalles

AV Surround Receiver SR6010. Quick Start Guide. Read Me First... Please do not return this unit to the store. If you need help

AV Surround Receiver SR6010. Quick Start Guide. Read Me First... Please do not return this unit to the store. If you need help ENGLISH FRANÇAIS AV Surround Receiver SR6010 ESPAÑOL Quick Start Guide Guide de configuration rapide / Guía de configuración rápida Read Me First... Lisez-moi en premier... / Lea esto primero... Please

Más detalles

Productos Oracle para gobierno de SOA. Oracle White Paper Mayo 2009

Productos Oracle para gobierno de SOA. Oracle White Paper Mayo 2009 Productos Oracle para gobierno de SOA Oracle White Paper Mayo 2009 Productos Oracle para gobierno de SOA RESUMEN EJECUTIVO La solución de Oracle SOA Governance es un elemento clave de la estrategia de

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

Protocolo de iniciación PCR. a tiempo real

Protocolo de iniciación PCR. a tiempo real Protocolo de iniciación PCR a tiempo real CERTEST Biotec, S.L. Pol. Industrial Río Gállego II, Calle J, Nº 1, 50840, San Mateo de Gállego, Zaragoza (SPAIN) www.certest.es Protocolo de iniciación PCR a

Más detalles

Voyager 1202g. Guía Rápida de Inicio. Lector lineal-laser de Código de Barras inalámbrico. VG1202-LS-QS Rev A 1/12

Voyager 1202g. Guía Rápida de Inicio. Lector lineal-laser de Código de Barras inalámbrico. VG1202-LS-QS Rev A 1/12 Voyager 1202g Lector lineal-laser de Código de Barras inalámbrico Guía Rápida de Inicio VG1202-LS-QS Rev A 1/12 Nota: Consulte la guía del usuario para obtener información sobre la limpieza del dispositivo.

Más detalles


REAL TOTAL RNA FROM BACTERIA AND YEAST KIT REAL TOTAL RNA FROM BACTERIA AND YEAST KIT Ref. 1. INTRODUCCIÓN 1. INTRODUCTION Este kit permite la obtención de ARN total a partir de diferentes cultivos de bacterias y levaduras, sin la utilización de

Más detalles

Instrucciones para la instalación de IBM SPSS Data Access Pack para Linux

Instrucciones para la instalación de IBM SPSS Data Access Pack para Linux Instrucciones para la instalación de IBM SPSS Data Access Pack para Linux Note: Before using this information and the product it supports, read the general information under Notices el p. 4. This document

Más detalles

Administración de Laboratorio de prácticas

Administración de Laboratorio de prácticas Primera publicación: 20 de agosto de 2015 Acerca de Utilice de WebEx para configurar y mantener los laboratorios y los ordenadores de las sesiones de Laboratorio de prácticas. Con, podrá: Crear nuevos

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

San Fernando: Optimizando los procesos internos con SAP ERP

San Fernando: Optimizando los procesos internos con SAP ERP SAP Estudio de la Transformación del Negocio Productos de consumo masivo J. Macêdo San Fernando: Optimizando los procesos internos con SAP ERP San Fernando S.A. Industria Alimentos de consumo masivo Locación

Más detalles

Comesa Ltda.: Comercializa con más precisión y rapidez gracias a SAP

Comesa Ltda.: Comercializa con más precisión y rapidez gracias a SAP Comesa Ltda.: Comercializa con más precisión y rapidez gracias a SAP Compañía Comesa Ltda. (Comercial Sud Americana Ltda.) Industria Distribuidora Productos y Servicios Comercializa alimentos congelados,

Más detalles


BENTLEY BactoCount IBC BENTLEY BactoCount IBC Características del equipo El BactoCount IBC es un equipo automático para contar rápido e individualmente las bacterias de la leche cruda. Capacidad: de 50 hasta 150 muestras / hora.

Más detalles