ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

Tamaño: px
Comenzar la demostración a partir de la página:

Download "ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón"

Transcripción

1 ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón

2

3 PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede en la célula cuando se sintetiza el ADN

4 PCR Ingredientes necesarios: Polimerasa ADN Oligonucleotidos dntps (dinucleotidos)

5 PCR: ingredientes Oligonucleótidos: Uno debe tener la misma secuencia del ADN Segundo debe ser complementario a esa secuencia. Forward y reverse De no ser así, no podría amplificarse el fragmento deseado.

6 PCR: aplicaciones Genética de poblaciones Evolución molecular Genómica Medicina forense

7 PCR: Cómo funciona? Después de haber preparado la mezcla maestra Se coloca en un termociclador Calienta o enfría los tubos a tres temperaturas distintas (ciclos de reacción) 95 (desnaturalización) (alineamiento) 72 (extensión)

8 PCR: desnaturalización Dobles cadenas de ADN se abren. PCR: alineamiento Se forman y se rompen constantemente los puentes de H entre los oligonucleótidos y el ADN Uniones más estables durarán mas tiempo Polimerasa se une al fragmento de ADN de doble cadena : 5 3

9 PCR: extensión Polimerasa alcanza su máxima actividad Continúa la sintesis de los fragmentos de ADN

10

11

12 TIPOS DE TECNICAS RAPDs, AFLPs, RFLPs Tener claro el tipo de información que necesitamos Las técnicas se pueden dividir en dos categorías PCRs para la amplificación de un solo sitio conocido del genoma PCRs en los que no es necesario conocer la región que se está amplificando.

13 PCRs para la amplificación de un solo sitio conocido del genoma Requieren conocer la secuencia que se trabaja Con este tipo es posible hacer filogenias Los datos pueden obtenerse de: Geles que detectan cambios hasta de una sola base SSCP Utilizando enzimas de restricción

14 PCRs en los que no es necesario conocer la región que se está amplificando. Se desconoce el tamaño del fragmento (s) Se utilizan para determinar polimorfismo genómico Utiliza un solo oligonucleotido con 2 características Pequeño a mediano (6-18 pb) Secuencia esté presente muchas veces en el ADN

15 Qué se necesita para hacer un PCR? Polimerasa comercial (acompañada de un buffer o amortiguador) MgCl 2 (cloruro de magnesio) Oligonucleótidos Agua (debe tener pocas sales, bidestilada) Tubos ( ml) y puntas (libres de ARNasas y ADNasas) Termociclador

16 HACIENDO PCR ANTES DE EMPEZAR Preparar todos los reactivos en alícuotas congeladas (- 20 C) CONDICIONES DEL PCR Empezar con las mismas condiciones que se hayan reportado para el oligonucleótido que se está utilizando. Realizar pruebas con pocas muestras antes de utilizar todas las muestras de estudio.

17 Concentración inicial Concentración final en la reacción dntps 10 mm 200μM varía de acuerdo al magnesio Magnesio 25mM 1.5mM puede probarse de 1 a 4 mm Cantidad para un tubo 1 μl 10 μl 3 μl 30 μl Cantidad para 10 tubos Oligo forward Oligo reverse 10 μm 1μM puede probarse de 0.1 a 1 μm 10 μm 1μM puede probarse de 0.1 a 1 μm 5 μl 50 μl 5 μl 50 μl Enzima 5U/μl 1U 0.2 μl 2 μl Buffer 10X 1X 5 μl 50 μl Agua μl 298 μl ADN 0.1mg/ml 0.1 mg genómico 11 μl -

18 TEMPERATURAS Y CICLOS Buscar artículos que hayan trabajado con el organismo de interés. Si no hay o bien no funciona se puede probar lo siguiente Desnaturalización inicial: 95 C por 5 10 mins 30 ciclos con desnaturalización a 95 C (30 s), alineamiento a 50 C (30 s) y extensión a 72 C por tiempo variable. Extension final 72 C 10 mins 4 C

19 LA TEMPERATURA DE ALINEAMIENTO Puede modificarse si el PCR aun no funciona. Se puede calcular la Tm (melting temperature) de cada oligo Varia de la cantidad de dobles o triples enlaces de H

20 Qué hacer cuando todo empieza a fallar? Cuál es la calidad del ADN que tenemos? ADN contaminado con proteínas que inhiben la reacción de PCR ADN esté degradado: correr una pequeña muestra de ADN en un gel.

21 En la extracción ocurre lo siguiente Rompe tejido: detergente (SDS o CTAB), si quedan restos de SDS la reacción se inhibe. Puede neutralizarse utilizando 0.5% de Tween 20 o 40 Después es necesario deshacerse de todos los componenetes celulares: se usan sales que precipitan proteínas pero no el ADN.

22 Hacer curvas de cloruro de magnesio Revisar la concentración y el manejo de los dntps. Revisar el buffer Algunos ya incluyen el MgCl 2 e inhiben la reacción Revisar los oligonucleótidos Podrían estar degradados, defectuosos, mal diseñados. Contaminación Trabajar con control negativo

23 GELES DE AGAROSA Métodos para visualizar el PCR

24 Principios básicos de la electroforesis Geles de agarosa o acrilamida (permiten separar fragmentos de acuerdo al tamaño de cada uno) Especie de red con agujeros de tamaños diferentes El ADN es corrido por corriente eléctrica hacia el polo positivo (ADN negativo)

25 Fragmentos de un mismo tamaño se agruparan todos juntos formando bandas en el gel

26 Agarosa o acrilamida? Acrilamida Redes con tamaños de poros uniformes Pequeños Útil si los tamaños de los fragmentos son pequeños Separación fina Una sola base de diferencia Son muy laboriosas La tinción con plata

27 Agarosa No forma redes tan uniformes Permite separar moléculas de ADN en un intervalo muy grande Sencillo

28 METODOS PARA GELES DE AGAROSA EQUIPO Cámara de electroforesis Fuente de poder Transiluminador de luz UV Equipo de fotografía

29 Para empezar: Preparar buffer de corrida Con ph requerido TBE (Tris Boratos EDTA): estable y reusable. TAE (Tris Acetatos EDTA): menos estable pero permite obtener mejor separación de bandas La concentración de agarosa dependerá de los tamaños de fragmentos Si se desconoce el tamaño, se puede iniciar con agarosa al 1%

30 Rango efectivo de separacion (Kb) Agarosa (%)

31 La agarosa se disuelve en el mismo buffer que se utiliza para la corrida Se calienta hasta ebullición (evitar derramar) Dejar enfriar aprox. 60 C Añadir bromuro de etidio Se intercala en las bases del ADN Brilla con luz UV Es mutágeno y altamente tóxico

32 Verter en el contenedor de geles Colocar peines para formar pozos Dejar enfríar y solidificar Agregar el buffer necesario hasta cubrir el gel

33 CARGANDO EL GEL Colorante de corrida: llevan sustancia espesa (glicerol o sacarosa) que permite que la muestra caiga hacia el fondo del pozo Colorantes: nos dan una idea de cómo van migrando los fragmentos

34 Cuando el gel esté listo, se conectan los cables Cable rojo: polo positivo. Cable negro: polo negativo. El ADN migrará hacia el polo + Se recomienda utilizar 5 volts por cada cm que exista entre los dos electrodos (fragmentos grandes) Fragmentos pequeños se recomienda V. Una cámara de 30 cm se correrá a 150 V

35

36 GRACIAS POR SU ATENCIÓN

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Guía práctica sobre la técnica de PCR

Guía práctica sobre la técnica de PCR Guía práctica sobre la técnica de PCR 517 Capítulo 17 Guía práctica sobre la técnica de PCR Laura Espinosa Asuar PCR son las siglas en inglés de Polymerase Chain Reaction o Reacción en Cadena de la Polimerasa.

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

ADN y RNA caracterización y métodos de estudio

ADN y RNA caracterización y métodos de estudio ADN y RNA caracterización y métodos de estudio Separación por centrifugación de equilibrio en gradiente de densidad de en CsCl Separación por centrifugación de equilibrio en gradiente de densidad de en

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo:

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo: Página 1 de 1 1. Titulo: Electroforesis de DNA 2. Objetivo Conocer los principios básicos de la electroforesis horizontal en geles de agarosa y aplicarlo para la separación de DNA humano, plasmídico, recombinante

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

ELECTROFORESIS BASICA

ELECTROFORESIS BASICA Ref.ELECBASICA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS BASICA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

ELECTROFORESIS EN GELES DE POLIACRILAMIDA SDS-PAGE. Presencia de Sodio Dodecil Sulfato bajo condiciones reductoras (SDSPAGE)

ELECTROFORESIS EN GELES DE POLIACRILAMIDA SDS-PAGE. Presencia de Sodio Dodecil Sulfato bajo condiciones reductoras (SDSPAGE) ELECTROFORESIS EN GELES DE POLIACRILAMIDA SDSPAGE Presencia de Sodio Dodecil Sulfato bajo condiciones reductoras (SDSPAGE) Método rápido, reproducible y de bajo costo Utilizado para cuantificar, comparar

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas Grado en Química 4º Curso Bioquímica Guión de Prácticas UTILES A TRAER POR EL ALUMNO Bata Gafas de Seguridad Cuaderno de Laboratorio NORMAS DE TRABAJO Antes de empezar Antes de empezar cada práctica, el

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas)

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos I N T R O D U C C I Ó N. Al finalizar este laboratorio el estudiante podrá: Laboratorio 12 Biología molecular Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Conocer los principios básicos de la técnica de electroforesis y su aplicación al análisis del ADN. 2.

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Sesión nº 5 Electroforesis en gel de agarosa M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Tel. 91 710 00 74 Fax 93 843 78 84 e-mail: info@biotools.eu www.biotools.eu BIOPAP Kit Kit para la detección

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR

3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.- TECNOLOGIA EN EL DIAGNOSTICO MOLECULAR 3.1.- INTRODUCCIÓN Pocas áreas de la Biología Molecular han permanecido inalteradas con la aparición de una serie de técnicas englobadas dentro del término genérico

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES. Laboratorio de Genética BIOL 3306

UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES. Laboratorio de Genética BIOL 3306 UNIVERSIDAD DE PUERTO RICO EN AGUADILLA DEPARTAMENTO DE CIENCIAS NATURALES Laboratorio de Genética BIOL 3306 Liza V. Jiménez Rodríguez, Ph.D. Agosto, 2014 Pre-prueba I. Pareo 1) Geles de agarosa 2) Loading

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

MEMORIA DE PRÁCTICAS

MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO.

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO. Página 1 de 7 CONTENIDO CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130,

Más detalles

FILTROS ELECTROPOSITIVOS Y REACCIÓN DE PCR PARA LA CONCENTRACIÓN Y DETECCIÓN SIMULTÁNEA DE VIRUS Y BACTERIAS EN AGUAS. Víctor Ramírez Angulo

FILTROS ELECTROPOSITIVOS Y REACCIÓN DE PCR PARA LA CONCENTRACIÓN Y DETECCIÓN SIMULTÁNEA DE VIRUS Y BACTERIAS EN AGUAS. Víctor Ramírez Angulo FILTROS ELECTROPOSITIVOS Y REACCIÓN DE PCR PARA LA CONCENTRACIÓN Y DETECCIÓN SIMULTÁNEA DE VIRUS Y BACTERIAS EN AGUAS Víctor Ramírez Angulo Coordinación de Tratamiento y Calidad del Agua, Instituto Mexicano

Más detalles

OBTENCIÓN DE MUTANTES

OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático Criterios para diseñar primers Iván Ferrer Rodríguez, Ph.D. Catedrático 1 Qué es un primer? Es una cadena corta de nucleótidos, un oligonucleótido. Sirve como punto de partida para la replicación del DNA.

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

37. Purificación de ácidos nucleicos

37. Purificación de ácidos nucleicos 37. Purificación de ácidos nucleicos Mª José Prieto Álamo, Juan López Barea, Carmen Pueyo de la Cuesta Departamento de Bioquímica y Biología Molecular, Campus Universitario de Rabanales, Edificio Severo

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles