Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 CIENCIA Y VIDA COTIDIANA Dieta genética para prevenir enfermedades? La clonación, el ADN y otras cosas Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética y Microbiología Murcia, 21 noviembre de En el futuro, un carné genético permitirá al médico decidir si prohíbe un alimento. Existe una nueva ciencia que avanza en paralelo a los descubrimientos sobre el genoma humano que se denomina nutrigenética, nutrigenómica (que suelen utilizarse como sinónimos aunque en realidad no lo son) o, más acertadamente, genómica nutricional. Estudia cómo la nutrición influye en nuestros genes y busca una dieta personalizada para frenar, o por lo menos retrasar, la aparición de aquella diabetes tipo II o cáncer que alguien está predispuesto a contraer por sus cromosomas. Como un traje hecho a medida cuyos patrones se obtienen conforme se desentraña el ADN humano y los científicos van conociendo para qué sirve cada 2 gen (1978) (2010) 6

2 Fecundación natural Fecundación in vitro (Medicina regenerativa) (febrero 2009) 11. Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos. Células madre. Selección embriones 12

3 Genética: Parte de la biología que trata de la herencia y de lo relacionado con ella. Transmisión Genética Genes Diccionario de la lengua española 13 Semejanza entre progenitores y descendientes 14 Genética Porqué nos parecemos a nuestros padres? Transmisión Genes Variación porqué nos parecemos? porqué nos diferenciamos? Porqué nos parecemos a nuestros hermanos, pero no somos iguales? Hay personas genéticamente idénticas? 17 SI, los gemelos idénticos (monocigóticos) 18

4 Los gemelos monocigóticos son genéticamente idénticos, pero son indistinguibles? 19 Los hermanos gemelos Kaczynski 20 Huellas dactilares Los hermanos gemelos Kaczynski posan siendo unos niños 21 Gemelos monocigóticos (= idénticos) 22 Epigenética epigenético, ca. 1. adj. Biol. Perteneciente o relativo a la epigénesis. epigénesis. (De epi- y -génesis). 1. f. Biol. Doctrina según la cual los rasgos que caracterizan a un ser vivo se configuran en el curso del desarrollo, sin estar preformados en el huevo fecundado. 23 Acido DesoxirriboNucleico 24

5 Cadena de ADN Nucleótidos ADN Molécula de ADN 27 Watson y Crick con su modelo del ADN 28 El modelo de Watson y Crick requisitos fundamentales: cumplía tres 1. Potencial informativo (libertad de secuencia a lo largo de la cadena) 29 30

6 egadlmncadcenuynorennrae uomqirnoemoaclobrudahare, enunlugardelamancha,decuy onombrenoquieroacordarme en un lugar de la mancha, de cuyo nombre no quiero acordarme 31 El modelo de Watson y Crick requisitos fundamentales: 2. Capacidad de autorreplicación (complementariedad de las bases) cumplía tres 32 El modelo de Watson y Crick requisitos fundamentales: cumplía tres en un lugar de la mancha, de cuyo nombre no quiero acordarme no quiero acordarme de un lugar en la mancha, cuyo nombre 3. Capacidad de mutación (posibilidad de cambios en la secuencia) El ADN está en el núcleo celular Célula Cromosoma Núcleo ADN 35 Cariotipo Cromosomas sexuales 36

7 Los genes están en los cromosomas Los genes llevan información cifrada para fabricar proteínas Cromosoma Gen 2 Gen 3 Gen 4 Célula Gen 1 Núcleo Proteína 2 Proteína 3 Proteína 4 Gen ADN 37 Proteína 1 38 Los genes llevan información cifrada para fabricar proteínas nucleótidos Gen 2 Gen 3 Gen 4 GCAACTTCGGGATTCACTGCCACCT CGTTGAAGCCCTAAGTGACGGTGGA.. ADN Gen 1 Lactasa Una enzima que procesa un azúcar presente en la leche Miosina Una proteína mecánica que hace que los músculos se contraigan Colágeno Una proteína estructural que se encuentra en la piel y cartílagos Hemoglobina Una proteína de transporte que hace que los glóbulos rojos transporten oxígeno 39 GCAACUUCGGGAUUCACUGCCACCU aminoácidos Código genético aa 1 aa 2 aa 3 aa 4 aa proteína 40 ARN El código genético ADN ARN PROTEÍNA AAAAA núcleo citoplasma 41 42

8 plantas bacterias animales humanos Óvulo recién fertilizado El ADN es básicamente el mismo en todos los organismos espermatozoide óvulo Óvulo recién fertilizado (44 cromosomas + X + X ) Gametos (22 cromosomas + X ) (22 cromosomas + X ó Y) (44 cromosomas + X + Y ) Cuántas combinaciones distintas de cromosomas maternos y paternos se pueden dar a la hora de producir gametos? Cada gameto, al azar, puede contener, por cada pareja de cromosomas, uno del padre o de la madre. Por tanto, una combinación posible puede ser: Las posibles combinaciones son infinitas En total: 2 23 = combinaciones distintas de gametos, y 2 23 x 2 23 = combinaciones distintas de cigotos 47 48

9 El Proyecto Genoma Humano En qué consiste el Proyecto Genoma Humano Identificar todos los genes humanos Determinar la secuencia de los más de 3 mil millones de nucleótidos del DNA humano Febrero Almacenar toda esta información en bases de datos públicas 50 Célula Y después de la secuencia, qué? Tres mil millones de nucleótidos ( letras ) llenarían unas 400 guías telefónicas de 500 páginas cada una Bacterias ( genes) Levaduras ( genes) Nuestro genoma tiene unos tres mil millones de bases Gusanos Moscas Gallo Ratón ( genes) ( genes) ( genes) ( genes) (unos genes) Perros ( genes) Chimpancé ( genes) Humanos ( genes) 53 Plantas ( genes) 54

10 Nuestro genoma tiene tres mil millones de bases (unos genes) Por ejemplo: Entre dos personas cualesquiera hay más de 20 millones de nucleótidos de diferencia, que se agrupan en regiones del genoma. Esas diferencias pueden ser de varios tipos. 7 repeticiones 8 repeticiones 55 Microsatélites 56 Microsatélites Genética forense 7 repeticiones 8 repeticiones = AGCT Cr Cr. 6 = AGCT Cr. 15 = CAGG

11 Genética forense La huella genética Probabilidad de encontrar dos individuos con el mismo perfil: < De dónde se puede obtener ADN? Sangre Semen Saliva Orina Pelos Dientes Huesos Tejidos 65 66

12 Escena del crimen Escena del crimen MA MB MC MD ME Mancha de sangre 7,9 10,13 7,15 8,8 Sospechoso 1 8,9 10,10 9,10 11,12 Sospechoso 2 10,11 9,13 8,14 9,12 Sospechoso 3 7,9 10,13 7,15 8,8 MA MB MC MD ME Mancha de sangre 7,9 10,13 7,15 8,8 Sospechoso 1 8,9 10,10 9,10 11,12 Sospechoso 2 10,11 9,13 8,14 9,12 Sospechoso 3 7,9 10,13 7,15 8, Pruebas de identidad 69 Muestra Sospechosos 70 Caso 1 Pruebas de Paternidad madre hijo padre? 71 72

13 Caso 2 INGENIERÍA GENÉTICA madre hijo Conjunto de técnicas que permiten la manipulación y transferencia de ADN de un organismo a otro. padre? Los extremos resultantes de los cortes facilitan la obtención de moléculas de ADN recombinante Herramientas moleculares: Las enzimas de restricción 75 Moléculas recombinantes o quiméricas 76 CLONACIÓN = AMPLIFICACIÓN 77 Bacterias 78

14 ADN recombinante Cromosoma bacteria ADN recombinante 79 Insulina recombinante ( transgénica ) 80 Cómo se hace una planta transgénica ADN con el gen deseado Célula vegetal 1 Regeneración de la planta ADN recombinante El gen deseado se ha insertado en uno de los Plantas transgénicas cromosomas de la planta Planta transgénica (con el nuevo carácter) Para qué plantas transgénicas Plantas con características de interés (resistencia a plagas, a herbicidas ) Producción de nuevos alimentos Posibilidad de incorporar características nutricionales distintas en los alimentos Vacunas comestibles (Tomates con la vacuna de la hepatitis B ) 83 arroz dorado 84

15 Ruta bloqueada en el arroz blanco Ruta bloqueada en el arroz blanco Sintetasa de fitoeno Desaturasa de fitoeno Desaturasa de x-caroteno transgenes Ciclasa de licopeno 85 β-caroteno 86 Porqué es bueno el β-caroteno? Porqué es bueno el β-caroteno? Los carotenos poseen propiedades antioxidantes. La vitamina A ayuda a la formación y al mantenimiento de dientes sanos, tejidos blandos y óseos, de las membranas mucosas y de la piel. Se conoce también como retinol, ya que produce los pigmentos en la retina del ojo. La vitamina A promueve la buena visión. Vitamina A Vitamina A 87 Su falta produce el desarrollo anormal de los huesos del sistema reproductivo, ceguera nocturna, xeroftalmia (una afección de resequedad de la córnea del ojo).. 88 Cómo se clona un animal Oveja adulta A donante de células Oveja adulta donante de óvulos Oveja adulta receptora Dolly (clon de A) Animales transgénicos 89 90

16 Cómo se hace un animal transgénico DNA Oveja adulta A Oveja adulta donante de óvulos Inyección del transgén deseado en uno de los núcleos del cigoto Oveja adulta receptora fertilización in vitro Desarrollo del embrión in vitro Implante del embrión en el útero de una oveja receptora Oveja transgénica Gen de la antitrombina Óvulo recién fertilizado El DNA recombinante se inyecta en el pronúcleo Implantar en madre adoptiva Se obtiene la leche de los animales transgénicos Identificar los descendientes transgénicos El gen de la antitrombina se ha manipulado para que sólo se exprese en el tejido mamario y se secrete en la leche Se extraen las proteínas de la leche Obtención de proteínas de interés a partir de leche de animales transgénicos Se purifica la antirombina 93

Y después de la secuencia, qué?

Y después de la secuencia, qué? Y después de la secuencia, qué? Nuestros genomas no son iguales Persona 1 Persona 2 = Variaciones en el ADN Qué tipo de variaciones? Secuencia estándar Variaciones: Cambios de una base por otra: Polimorfismos

Más detalles


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética y Microbiología Murcia, 7 de octubre de 2013 Genética: Parte de la biología

Más detalles


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008 . Genética. Gen.

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles


GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes:

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes: TEMA 4: AVANCES BIOMÉDICOS 1.- TRASPLANTES DE ÓRGANOS Trasplante o injerto en medicina es un tratamiento médico complejo que consiste en trasladar órganos, tejidos o células de una persona a otra. El órgano

Más detalles

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto.

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto. Noticia: Got, el primer toro bravo clonado Nace en Palencia Científicos españoles han clonado con éxito a un semental de la ganadería de toros de lidia de Alfonso Guardiola. Ya está aquí el primer animal

Más detalles


EL ADN y la INGENIERÍA GENÉTICA IES LAS VIÑAS MANILVA. MÁLAGA. CMC. Susana Serradilla EL ADN y la INGENIERÍA GENÉTICA EL GENOMA HUMANO GENOMA: Conjunto de genes de un ser vivo. GENOMA HUMANO: Conjunto de genes de la especie humana PROYECTO

Más detalles


TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles

Ácidos nucleicos: ADN y ARN

Ácidos nucleicos: ADN y ARN Unidad I Genética Ácidos nucleicos: ADN y ARN Definición Los ácidos nucleicos son compuestos orgánicos constituidos por unidades llamadas nucleótidos. Su función principal es transmitir las características

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles



Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

La ingeniería genética

La ingeniería genética Objetivos Antes de empezar En esta quincena aprenderás a: Biotecnología moderna. tradicional Ingeniería genética y manipulación del genoma. Alimentos transgénicos. La clonación. El genoma humano Problemas

Más detalles


REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA Tema 4 REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA 1. ADN y ARN pág 92-93 -Composición química y conceptos: ADN, ARN, nucleótidos, bases nitrogenadas, ácido fosfórico. -Estructura: doble hélice, cadenas complementarias.

Más detalles


CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles


LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA LA REVOLUCIÓN GENÉTICA: DESVELANDO LOS SECRETOS DE LA VIDA YA DEBERÍAS SABER Todos los seres vivos tenemos células. Nuestras células son eucariotas (núcleo verdadero) Todas tienen: membrana, citoplasma

Más detalles


LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por Una informació n elaborada por Museos Científicos Coruñeses Monografías de Comunicación Científica 04 Edición realizada con el patrocinio de clonación humana El 13 de febrero de 2004 todos los medios de

Más detalles

Autor: Andrés M. Gatica Arias,

Autor: Andrés M. Gatica Arias, Autor: Andrés M. Gatica Arias, Introducción Es de rigurosa justicia emancipar la enseñanza de todo extraño poder, y convertirla en una función social, sin otra ley que la libre indagación y

Más detalles


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Genética para andar por casa... y 3 Murcia, 17 de diciembre de 2012. Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos.

Más detalles


FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA Departamento de Biología Ambiental y Salud Pública FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA INTRODUCCIÓN. Genes y ambiente. Las cualidades heredadas y los efectos de la experiencia. El sustrato

Más detalles


CAP ITULO XII HERENCIA CAP ITULO XII HERENCIA Algunas enfermedades son genéticas en origen y por lo tanto son transmitidas en familias. La mayoría de las enfermedades de inmunodeficiencia son heredades en alguno de los dos diferentes

Más detalles

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8 Evolución de la donación de órganos en España Europa: 19,2 EEUU: 25,8 REQUISITOS PARA EL TRASPLANTE Muerte encefálica Criterios médicos distribución Equipo médico independiente del trasplante Donación

Más detalles

Ingeniería Genética II

Ingeniería Genética II Ingeniería Genética II Expresión de proteínas recombinantes Vectores de expresión Características adicionales: - Promotor regulable - Terminador de la transcripción - Sitio de reconocimiento por el ribosoma

Más detalles

Actividades de clase para realizar con ordenador:

Actividades de clase para realizar con ordenador: 4º E.S.O. Biología y Geología - Unidad 5.- La herencia biológica Actividades de clase para realizar con ordenador: Alumno/a... Fecha... 1.- Completa: Todos los seres vivos tienen

Más detalles


UNIDAD 7 LA DIGNIDAD DE LA VIDA UNIDAD 7 LA DIGNIDAD DE LA VIDA A) EL EMBRIÓN: fecundación Espermatozoides llegando al ovocito Concepción La carrera por la vida... "Desde el momento mismo de la fecundación, desde el instante en que a

Más detalles


LA NUTRICIÓN CELULAR LA NUTRICIÓN CELULAR La composición química de los seres vivos Todos los seres vivos estamos formados por células y constituidos por el mismo tipo de sustancias químicas, las biomoléculas. Estas biomoléculas

Más detalles

Genealogías y clonación.

Genealogías y clonación. Curso: Biología Mención Material Nº 6 Unidad V. Variabilidad y Herencia. Genealogías y clonación.. GENEALOGÍAS. El hombre, sin haber tenido conocimiento alguno de genética, siempre se ha preocupado de

Más detalles



Más detalles

El Comienzo de la Vida Humana Manifiesto de Madrid IV Congreso de Ciudadanos. Vida y Redes Sociales

El Comienzo de la Vida Humana Manifiesto de Madrid IV Congreso de Ciudadanos. Vida y Redes Sociales El Comienzo de la Vida Humana Manifiesto de Madrid IV Congreso de Ciudadanos. Vida y Redes Sociales XII Asamblea, marzo de 2006 Según una correcta metodología bioética, es necesario ante todo dirigir la

Más detalles

CUESTIONES TEMA 4: La revolución genética y la biotecnología.

CUESTIONES TEMA 4: La revolución genética y la biotecnología. CUESTIONES TEMA 4: La revolución genética y la biotecnología. 1. El ADN no puede salir del núcleo: Cómo logra llevar a los ribosomas que están en el citoplasma la información que porta? 2. El individuo

Más detalles

Embriogénesis humana. Desarrollo desde la primera célula hasta...

Embriogénesis humana. Desarrollo desde la primera célula hasta... Embriogénesis humana Desarrollo desde la primera célula hasta... Mitosis, diferenciación y crecimiento Juvenil (2n) Mitosis, diferenciación y crecimiento Adultos (2n) Cigoto (2n) Meiosis Fertilización

Más detalles

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética.

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética. [Introducción] Por favor abre tu libro en la página 225. Capítulo 11: La Tecnología de Genes Los científicos trabajan día a día en búsqueda de nuevas formas para el uso de la tecnología genética en beneficio

Más detalles

Clonación de seres humanos con fines de reproducción: informe sobre los debates de la Asamblea General de las Naciones Unidas

Clonación de seres humanos con fines de reproducción: informe sobre los debates de la Asamblea General de las Naciones Unidas ORGANIZACIÓN MUNDIAL DE LA SALUD CONSEJO EJECUTIVO EB115/INF.DOC./2 115ª reunión 16 de diciembre de 2004 Punto 9.5 del orden del día provisional Clonación de seres humanos con fines de reproducción: informe

Más detalles


Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D.

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D. Formación de una nueva vida:concepción,herencia y ambiente Janette Orengo Puig,Ed.D. Cambios en la teoría de concepción Concepción- (fertilización)-es el proceso por medio del cual el espermatozoide y

Más detalles

Claus per a comprendre la genètica

Claus per a comprendre la genètica Curs: 2011-2012 Diploma Sènior de la UOM. Primer curs. Obligatòria. Claus per a comprendre la genètica Tema 8: Clonació i cel.lules mare Dr. José Aurelio Castro Ocón Universitat de les Illes Balears La

Más detalles

GENÉTICA MENDELIANA EL GEN. El gen Mendeliano es una unidad de función, estructura, transmisión, mutación y evolución, que se distribuye ordenada y linealmente en los cromosomas. A nivel genético el gen

Más detalles


CONCEPTOS GENERALES EN GENÉTICA CONCEPTOS GENERALES EN GENÉTICA 1. Genetica clásica Genética molecular 1.1. La genética clásica o formal parte del estudio del fenotipo (de lo que observamos) y deduce el genotipo (gen o genes que determinan

Más detalles


BIOTECNOLOGÍA Y GENÉTICA MOLECULAR BIOTECNOLOGÍA Y GENÉTICA MOLECULAR Conceptos de biotecnología y genética molecular. Importancia y beneficios de la biotecnología. Genética y Tecnología del DNA recombinante: estrategias de clonación. Enzimas

Más detalles


LA INGENIERÍA GENÉTICA LA INGENIERÍA GENÉTICA Todo organismo, aún el más simple, contiene una enorme cantidad de información. Esa información se repite en cada una de sus células organizada en unidades llamadas genes, los cuales

Más detalles

Biotecnología - Ingeniería Genética BIOTECNOLOGÍA. Liceo Militar General Espejo

Biotecnología - Ingeniería Genética BIOTECNOLOGÍA. Liceo Militar General Espejo Curso: 3ro Asignatura: Tecnología - Informática Profesor: Federico Olarte Liceo Militar General Espejo Biotecnología - Ingeniería Genética BIOTECNOLOGÍA Introducción. Es una disciplina que emplea organismos

Más detalles

Biología I. Biología I. Tema 9. Biotecnología

Biología I. Biología I. Tema 9. Biotecnología Biología I Tema 9. Biotecnología Objetivo de aprendizaje del tema Al finalizar el tema serás capaz de: Exponer los antecedentes, aplicaciones e importancia de la Biotecnología. Definir el término de Biotecnología

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles


La MEDICINA del SIGLO XXI La MEDICINA del SIGLO XXI Ginés Morata Pérez Ex-Director del Centro de Biología Molecular del CSIC Carlos Martínez-A. Jefe del Departamento de Inmunología y Oncología del Centro Nacional de Biotecnología

Más detalles

MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de

MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de Reproducción Asistida TRAS LA UNIÓN DE LOS GAMETOS EN ESTADÍO

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

La Célula. Unidad Fundamental delavida

La Célula. Unidad Fundamental delavida La Célula Unidad Fundamental delavida La Célula. Unidad Fundamental de la vida El descubrimiento de la célula La teoría celular Estructura de la célula Tipos de células Tipos de células eucariotas Orgánulos

Más detalles

El cuerpo humano está formado por un conjunto de células y dentro de ellas se encuentra el ADN (Acido Desoxirribonucleico).

El cuerpo humano está formado por un conjunto de células y dentro de ellas se encuentra el ADN (Acido Desoxirribonucleico). El cuerpo humano está formado por un conjunto de células y dentro de ellas se encuentra el ADN (Acido Desoxirribonucleico). Es una sustancia química determinada por la técnica de PCR Reacción en Cadena

Más detalles



Más detalles


Modulo 2 NIVEL CELULAR DE ORGANIZACIÓN DEL CUERPO HUMANO Modulo 2 NIVEL CELULAR DE ORGANIZACIÓN DEL CUERPO HUMANO NIVEL CELULAR DE ORGANIZACIÓN DEL CUERPO HUMANO Los seres vivos están integrados por moléculas (inanimadas) los organismos vivos poseen atributos

Más detalles

Reprogenética. Aula de la Experiencia

Reprogenética. Aula de la Experiencia Reprogenética Aula de la Experiencia Manipulación de embriones Día 2º: Embrión de dos células Día 3º y 4º: 8 a 16 células totipotentes Inicio de la diferenciación celular Día 5º: Entrada del embrión en

Más detalles


UNIDAD 5: LOS ANIMALES SE REPRODUCEN UNIDAD 5: LOS ANIMALES SE REPRODUCEN Lee atentamente: 1. LOS COMPORTAMIENTOS SEXUALES Y EL ENCUENTRO ENTRE LOS DOS SEXOS Todos los seres vivos están formados por células. Entre todas las células que forman

Más detalles

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Diferencia entre los seres vivos 1. Pedruscos y bichos, Qué los diferencia? Dos tipos de objeto seres vivos (pueden hacer copias

Más detalles


TEMA 4: LA REVOLUCIÓN GENÉTICA TEMA 4: LA REVOLUCIÓN GENÉTICA 1. Introducción Los seres vivos son capaces de hacer copias de sí mismos, de tal modo que los hijos heredan los caracteres de sus padres. Para lograrlo a) Deben almacenar

Más detalles

ANEXO 1 CRONOLOGÍA a. C.: Los babilonios celebraban con ritos religiosos la polinización de las. palmeras.

ANEXO 1 CRONOLOGÍA a. C.: Los babilonios celebraban con ritos religiosos la polinización de las. palmeras. ANEXO 1 CRONOLOGÍA 1.000 a. C.: Los babilonios celebraban con ritos religiosos la polinización de las palmeras. 323 a. C.: Aristóteles especula sobre la naturaleza de la reproducción y la herencia. 1676:

Más detalles

La Filogenia en nuestro ADN. Las huellas filogenéticas en nuestro ADN

La Filogenia en nuestro ADN. Las huellas filogenéticas en nuestro ADN 78 Hurvitz M. Filogenia en nuestro ADN La Filogenia en nuestro ADN Las huellas filogenéticas en nuestro ADN Hipótesis o Perspectiva Teórica Marcos Hurvitz Área de Biología Molecular Instituto de Coloproctología

Más detalles

TEMA 5 TEMA 6. 7. La célula tiene que saber la ruta a emplear en cada momento, cómo regula estos procesos de manera primaria?.

TEMA 5 TEMA 6. 7. La célula tiene que saber la ruta a emplear en cada momento, cómo regula estos procesos de manera primaria?. TEMA 1 1. El agua es uno de los principales elementos de los seres vivos, por qué es tan importante?. 2. Las proteínas son polímeros de aminoácidos, cuáles son las características básicas de los aminoácidos

Más detalles 1/5 1/5 Los problema por los que algunas parejas no pueden conseguir un embarazo son de origen muy diverso y por eso también son diferentes las soluciones que se buscan: Estimulación ovárica: Se trata de modificar

Más detalles


INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

Ambas noticias están relacionadas con la manipulación génica de los animales y su relación con el ser humano.

Ambas noticias están relacionadas con la manipulación génica de los animales y su relación con el ser humano. TRABAJO PRÁCTICO SOBRE DOS NOTICIAS RELACIONADAS CON LA MODIFICACIÓN GÉNICA DE ANIMALES Principios básicos de la manipulación genética. INGENIERÍA GENÉTICA Programa de Formación del Profesorado UNED Mayo

Más detalles

Las enfermedades genéticas y el diagnóstico genético Preguntas y respuestas

Las enfermedades genéticas y el diagnóstico genético Preguntas y respuestas Las enfermedades genéticas y el diagnóstico genético Preguntas y respuestas PRESENTACIÓN En este documento presentamos doce preguntas básicas relacionadas con las enfermedades genéticas y el diagnóstico

Más detalles

Glosario: embarazo. Se diagnostica con la medición de la presión arterial y un examen de orina en los controles del embarazo.

Glosario: embarazo. Se diagnostica con la medición de la presión arterial y un examen de orina en los controles del embarazo. Glosario: Espermatozoides: son las semillas que se producen en los testículos del hombre y que se liberan con el semen o esperma. Contienen las características que transmite el padre a su hijo o hija y

Más detalles

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante.

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante. Temáticas que se revisarán: Universidad Nacional Abierta y a Distancia Especialización en Mejoramiento Genético Ingeniería genética Agropecuaria Luz Mery Bernal Parra Curso: Ingeniería genética Agropecuaria

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles


CAPÍTULO 13 DIVISIÓN CELULAR DIVISIÓN CELULAR 1. FISIÓN BINARIA Ocurre en procariontes: tras la duplicación del ADN, se segregan las moléculas hijas y se divide el citoplasma. Bacteria en Fisión Binaria Esquema de la Fisión Binaria

Más detalles

Las células madre o progenitoras

Las células madre o progenitoras Capítulo 35 Las células madre o progenitoras Dra. M.ª Teresa Pérez de Prada Bióloga especialista en Biotecnología. Unidad de Investigación Cardiovascular del Instituto Cardiovascular del Hospital Clínico

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Herencia Ligada al Cromosoma X Elaborado a partir de folletos originales de Guy s and St Thomas Hospital, Londres y London IDEAS Genetic Knowledge Park. Enero de 2008 Este trabajo se ha realizado bajo

Más detalles



Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles


AVANCES EN TRANSGÉNESIS ANIMAL AVANCES EN TRANSGÉNESIS ANIMAL Dr. Pablo Bosch Laboratorio de Reprogramación Celular e Ingeniería Genética Departamento de Biología Molecular FCEFQyN, UNRC 1 de 33 Estructura de la presentación Definición

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles



Más detalles

Ética y Valores II. Tema 3: La tecnología en la medicina e ingeniería genética. Unidad I

Ética y Valores II. Tema 3: La tecnología en la medicina e ingeniería genética. Unidad I Tema 3: La tecnología en la medicina e ingeniería genética Ética y Valores II Unidad I Importancia y relación de la ética, la ciencia y la tecnología en la práctica médica y la bioética LA TECNOLOGÍA EN

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Su clínica local: Herencia Ligada al Cromosoma X sta-aegh-2005-servicios-degenetica-clinica.pdf Elaborado

Más detalles

Biotecnología moderna en animales

Biotecnología moderna en animales Biotecnología moderna en animales Los animales transgénicos A diferencia de la biotecnología vegetal y de los microorganismos recombinantes (transgénicos) que ya se aplican a algunos sectores de la producción,

Más detalles

Biotecnología? Qué es eso?

Biotecnología? Qué es eso? ?? Biotecnología?? Qué es eso? Qué es la Biotecnología? La biotecnología es un conjunto de técnicas que utilizan o transforman el material de organismos vivos para desarrollar nuevos procesos y productos

Más detalles


TEMA 4. DE LOS TRASPLANTES A LAS CÉLULAS MADRE TEMA 4. DE LOS TRASPLANTES A LAS CÉLULAS MADRE El 3 de diciembre de 1967 los periódicos de todo el mundo recogieron la noticia: un médico sudafricano, Christiaan Neethling Barnard había realizado el primer

Más detalles

Historia de Monstruos

Historia de Monstruos Una Historia de Monstruos Por Karla Moeller Ilustraciones de Sabine Deviche Traducido por Michelle Christine Chirinos Arias Tabla de contenidos Introducción... 1 Manual de instrucción de ADN.... 2 Combinación

Más detalles Julio-2006 Julio-2006 Predicción del color de la capa en caballos Isabel Tupac-Yupanqui, Susana Dunner, Javier Cañón Laboratorio de Genética. Facultad de Veterinaria. 28040 Madrid. Julio-2006

Más detalles


BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA Objetivos: Diferenciar los niveles de organización y compactación del material genético. Comprender los principios básicos

Más detalles

4º E.S.O. Biología y Geología - Unidad 4.- La célula. Actividades de clase para realizar con ordenador:

4º E.S.O. Biología y Geología - Unidad 4.- La célula. Actividades de clase para realizar con ordenador: 4º E.S.O. Biología y Geología - Unidad 4.- La célula Actividades de clase para realizar con ordenador: Alumno/a... Fecha... 1.- Recuerdas estos conceptos de cursos anteriores?

Más detalles


CÉLULAS MADRE ASUNCION CATALINA G.VALADÉS/DPTO.CCNN/C.NUESTRA SRA DEL CARMEN/MÓSTOLES/BG 4º CÉLULAS MADRE 1 1 Términos como: célula madre, fecundación in vitro, cordón umbilical, terapia celular, biotecnología, manipulación genética, clonación, aparecen cada vez más en nuestra vida cotidiana.

Más detalles

Biotecnología. Historia y aplicaciones Su utilización en el INTA Alto Valle. investigación

Biotecnología. Historia y aplicaciones Su utilización en el INTA Alto Valle. investigación Alejandro Giayetto Técnico INTA Mirta Rossini Técnico INTA Diana Vera Biotecnóloga investigación 10 Biotecnología

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

Tipos de reproducción de los seres vivos

Tipos de reproducción de los seres vivos Tipos de reproducción de los seres vivos Está Es una función que realizan los seres vivos que difiere de las otras, por que no es vital para el individuo, pero sí lo es para la especie. LA FUNCIÓN DE

Más detalles

Prueba de Conocimientos Disciplinarios 2016. Sector Biología I CÉLULA. La célula como unidad funcional

Prueba de Conocimientos Disciplinarios 2016. Sector Biología I CÉLULA. La célula como unidad funcional Temario Prueba de Conocimientos Disciplinarios 2016 Sector Biología Enseñanza Media I CÉLULA La célula como unidad funcional - Propiedades y funciones de las moléculas orgánicas e inorgánicas que componen

Más detalles


CONTENIDOS PRUEBA DE CIENCIA CONTENIDOS PRUEBA DE CIENCIA CONTENIDOS DE BIOLOGÍA PRIMERO MEDIO I Organización, Estructura y Actividad Celular 1 La célula como unidad funcional a. Estructuras y funciones comunes a células animales

Más detalles

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R.

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R. República Bolivariana de Venezuela U. E. Colegio Cruz Vitale É Prof. Francisco Herrera R. LA GENÉTICA es la ciencia que estudia los genes, la herencia, la variación de los organismos. El término Genética

Más detalles


Capítulo 5: BIOMOLÉCULAS Capítulo 5: BIOMOLÉCULAS De qué están hechas las células? Al analizar los átomos y moléculas presentes en las células, se observa que todas ellas se asemejan: una gran proporción es agua; el resto es un

Más detalles