Extracción de DNA por el Método Adaptado de Drábek.

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Extracción de DNA por el Método Adaptado de Drábek."

Transcripción

1 Extracción de DNA por el Método Adaptado de Drábek. El aislamiento de DNA constituye un paso esencial para la realización de estudios de tamizaje genético, análisis de polimorfismos genéticos, estudios de caracterización genómica al igual que para estudios de epidemiología molecular. Los métodos de extracción de DNA actualmente disponibles poseen dos características que dificultan su incorporación a estudios de epidemiología molecular y al procesamiento de cientos o miles de muestras: su alto costo y la toxicidad de sus reactivos. El estandard de oro de los métodos de extracción de DNA es el de Fenol-Cloroformo-Alcohol Isoamilico (PCI). Este método emplea una enzima proteolítica para digerir el lisado celular seguido de la extracción de DNA por medio de un solvente orgánico carcinógeno (fenol). En los últimos 20 años el empleo de kits de extracción de DNA basados en columnas ha facilitado el procesamiento de muestras. No obstante, el costo de estos kits se vuelve prohibitivo conforme se incrementa el número de muestras por procesar o su volumen individual. Recientemente se ha descrito un método para la extracción de DNA genómica a partir de diversos tejidos que emplea detergentes domésticos. Dicho método constituye una alternativa práctica tanto por su bajo costo como por obviar la necesidad de enzimas proteolíticas y sustancias toxicas. Este protocolo se basa en el método desarrollado por Drábek J (Departamento de Inmunologia de la Universidad Palacky de la República Checa 1 ) y optimizado por Nasiri H (Departamento de Biotecnología Médica de la Universidad Tarbiat Modarres de Irán 2 ) y otros 3. El método ha sido adaptado y optimizado por el Laboratorio de Biología Molecular de la Facultad de Medicina de la UASLP para la extracción de DNA a partir de diferentes fuentes de leucocitos (sangre periferica entera, concentrados leucocitarios de banco de sangre, sangre de cordón umbilical y células mononucleares aisladas por ficoll o procedentes de medios de cultivo). Notas: 1. Los reactivos empelados para la preparación de buffers de lisis y precipitación son genéricos y de grado ACS, obviando el empleo de reactivos costosos y de grado molecular. El etanol empleado puede ser también grado ACS pero no desnaturalizado. 2. Para preparar 1 litro de buffer de lisis celular agregue 10 grs de Tritón X-100 a un vaso de precipitados de 500 ml y afore a 350 ml con dh20 grado III y mezcle con el agitador magnético. Agregue grs de Sucrosa (sacarosa) grs de Cloruro de Magnesio Hexahidratado y 10 ml de Tris HCl 1M ph 7.6. Permita que se disuelvan todos los reactivos completamente. Transfiera la mezcla a un cilindro graduado y afore a 1 litro con dh20 grado III. Dispense alícuotas de 50 ml y mantengalas refrigeradas. 3. Prepare 2 litros de solución de detergente diluyendo 80 grs de detergente Foca comercial de uso doméstico. Mantenga esta preparación en agitación durante 12 horas. Permita que la solución sedimente durante 12 horas. Tome cuidadosamente el sobrenadante sin perturbar el sedimento y filtrelo a través de filtros de jering Luer-Lock empleando discos de 2.5 cm y poros de 5 micrones, posteriormente filtre en uidades Nalgene de 500 ml color amarillo (0.22 µm). Prepare la solución de trabajo realizando las diluciones correspondientes. La concentración de detergente empleada por los diferentes protocolos difiere siendo de 10 mg/ml para el protocolo Maxiprep y de 20 mg/ml para los protocolos Midi, Mini y Microprep. Esta diferencia obedece a que los concentrados leucocitarios poseen una menor proporción de eritrocitos en relación a las muestras de sangre entera. 4. Una vez que se ha precipitado el DNA en Etanol al 96ºGL a -20 C durante 20 minutos no se debe perturbar el sedimento ni centrifugar la muestra. La experiencia reunida durante la optimización del método ha demostrado que estos procedimientos (comunemente empleados en las modalidades publicadas del protocolo) acarrean contaminantes que afectan la calidad espectrofotométrica del DNA y su uso en PCR. 5. Las diluciones de trabajo deben prepararse en tiras microtubos de PCR de 0.2 ml. 6. Evalúe espectrofotométricamente la cantidad y calidad del DNA extraído en el Nanodrop ND-1000.

2 7. Para evaluar la integridad del DNA genómico por electroforesis se cargan 5 µl de una mezcla de 1 µl de solución nativa de DNA + 4 µl de dh 2 O grado I + 3 µl de buffer de carga (naranja O) en un gel de agarosa al 1% y se corre durante 45 minutos a 150 VDC en el sistema Gator A2 o (6 V/cm). El DNA de buena calidad deberá permanecer por encima del marcador de 4 Kb, el DNA fragmentado aparecerá como una mancha que se extiende desde el pozo hasta el frente de migración. El DNA extraido de células apoptóticas generará una escalera de 200 bp. 8. La evaluación funcional de la utilidad del DNA extraído se basa en el protocolo de amplificación de KIR2DL4 o KIR2DL1 para generar fragmentos de 1.8 o 3.6 kbp, respectivamente. Refiérase al protocolo PCR KIR correspondiente. 9. Almacene las soluciones nativas de DNA a -80 C y las alícuotas de trabajo de DNA a -20 C. Referencias: Drabek, J. and Petrek, M., A sugar, laundry detergent, and salt method for extraction of deoxyribonucleic acid from blood. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub 146 (2), 37 (2002). Nasiri, H., Forouzandeh, M., Rasaee, M. J., and Rahbarizadeh, F., Modified salting-out method: high-yield, high-quality genomic DNA extraction from whole blood using laundry detergent. J Clin Lab Anal 19 (6), 229 (2005). Bahl, A. and Pfenninger, M., A rapid method of DNA isolation using laundry detergent. Nucleic Acids Res 24 (8), 1587 (1996); Kotchoni, S. O. and Gachomo, E. W., A rapid and hazardous reagent free protocol for genomic DNA extraction suitable for genetic studies in plants. Mol Biol Rep (2008).

3 Procedimiento Maxiprep (15 ml de concentrado leucocitario anticoagulado con CPDA-1): 1. Agregue 15 ml del concentrado leucocitario a un tubo cónico de 50 ml y adicione 25 ml de buffer de lisis celular, agite vigorosamente por inversión, NO UTILICE EL VORTEX! este paso rompe las células pero deja los núcleos intactos con DNA dentro. 2. Centrifugue a 3,000 G por 5 minutos y deseche el sobrenadante por decantación hacia NaOCl 0.1%. 3. Agregue buffer de lisis celular al pellet nuclear y afore a 30 ml. Mezcle vigorosamente por inversión hasta resuspender el pellet. Este paso busca eliminar los eritrocitos que quedan unidos a los nucleos que forman al pellet. 4. Centrifugue a 3,000 G por 5 minutos y descarte (deseche) nuevamente el sobrenadante por decantación. 5. Repita los pasos #3 y 4 dos veces mas hasta eliminar completamente la coloración roja del pellet nuclear. 6. Agregue 3 ml de Tris-HCl 10 mm ph 8.0 al pellet nuclear, mezcle vigorosamente hasta resuspender completamente al pellet. Este paso solo busca solubilizar el pellet nuclear. 7. Agregue 3 ml de la solución de detergente a 10 mg/ml, mezcle vigorosamente hasta resuspender completamente al pellet. En este paso se rompe la membrana nuclear para liberar al DNA de su interior. 8. Agregue 2 ml de 5M NaCl y mezcle vigorosamente hasta lograr una solución turbia. Este paso precipita las proteinas nucleares y las de membrana nuclear (histonas, factores de transcripción, polimerasas, etc.). 9. Centrifugue a 12,000 G durante 15 minutos empleando el rotor de ángulo fijo AC Este paso compacta las proteinas previamente precipitadas dejando a los ácidos nucleicos (DNA genómico, RNA y DNA mitocondrial en el sobrenadante). 10. Transfiera el sobrenadante a un nuevo tubo cónico de 50 ml evitando perturbar el sedimento. Descarte el primer tubo cónico con el sedimento. Esta es la solución de ácidos nucleicos extraídos que ahora serán purificados para enriquecerla de DNA y eliminar otras proteinas. 11. Agregue 35 ml de etanol al 96% a -20 C, mezcle gentilmente. Este paso precipita el DNA y RNA. 12. Retire el DNA precipitado con un microcapilar o pipeta Pasteur doblada en forma de gancho y descarte por decantación el etanol contenido en el tubo. 13. Regrese el microcapilar o pipeta Pasteur con el DNA de nuevo al tubo y agregue 10 ml de etanol al 70%, lave durante 20 segundos. Este paso busca disminuir la concentración de sales (principalmente NaCl) presentes en el DNA enriquecido. 14. Vuelva a retirar el microcapilar o pipeta Pasteur con el DNA y descarte el etanol de lavado por decantación. 15. Repita los pasos #13 y 14 dos veces mas. 16. Seque el DNA colgado de el microcapilar o pipeta Pasteur durante 15 minutos a temperatura ambiente pero dentro del Gabinete de Seguridad Biológica del laboratorio de procesamiento de muestras. 17. Resuspenda el DNA en 7 ml de Tris-HCl ph 8.0 para preparar la solución nativa de DNA genómico.

4 18. Incube la solución nativa de DNA genómico en baño de agua durante 30 minutos a 70 C. 19. Prepare una alícuota de trabajo en tubos de PCR a 100 ng/µl y cinco alicuotas de 1.5 ml en Eppendorfs de 1.8 ml. Procedimiento Midiprep (7.5 ml de sangre entera anticoagulada con EDTA o ACD): 1. Agregue 7.5 ml de sangre entera anticoagulada a un tubo cónico de 15 ml y adicione 7.5 ml de buffer de lisis celular, agite vigorosamente primero por inversión luego por vortex. 2. Centrifugue a 3,000 G por 5 minutos y descarte cuidadosamente el sobrenadante por decantación hacia NaOCl 0.1%. 3. Agregue 5 ml de buffer de lisis celular y mezcle vigorosamente primero por inversión luego por vortex hasta resuspender por completo el pellet nuclear. 4. Centrifugue a 3,000 G por 5 minutos y descarte cuidadosamente el sobrenadante por decantación. 5. Repita los pasos #3 y 4 dos veces mas hasta eliminar completamente la coloración roja del pellet. 6. Agregue 375 µl Tris-HCl 10 mm ph 8.0, mezcle vigorosamente en vortex hasta resuspender completamente al pellet nuclear. 7. Agregue 375 µl de la solución de detergente a 20 mg/ml, mezcle vigorosamente en vortex hasta resuspender completamente al pellet. 8. Agregue 250 µl de 5M NaCl y mezcle vigorosamente en vortex hasta lograr una solución turbia. Transfiera la suspensión de nucleos lisados a un microtubo de 1.5 ml. 9. Centrifugue a 16,000 G durante 10 minutos. 10. Transfiera el sobrenadante a un nuevo microtubo de 2 ml evitando perturbar el sedimento. Descarte el microtubo con el sedimento. 11. Agregue 1,000 µl de etanol al 96% a -20 C, mezcle gentilmente. 12. Retire el DNA precipitado con un microcapilar o pipeta Pasteur doblados en forma de gancho y descarte el etanol contenido en el tubo por decantación. 13. Regrese el microcapilar con el DNA de nuevo al tubo y agregue 700 µl de etanol al 70%, lave durante 20 segundos. 14. Vuelva a retirar el microcapilar con el DNA y descarte el etanol de lavado por decantación. 15. Repita los pasos #13 y 14 dos veces mas. 16. Regrese el microcapilar con el DNA al microtubo correspondiente y seque el microtubo en el thermomixer

5 a 70 ºC. Revise el microtubo cada 5 minutos hasta evidenciar la eliminación del etanol restante. 17. Resuspenda el DNA en 500 µl de Tris-HCl ph 8.0 para preparar la solución nativa de DNA genómico. 18. Incube la solución nativa de DNA genómico en el thermomixer durante 30 minutos a 70 C y 350 RPM. Procedimiento Miniprep (3 ml de sangre entera anticoagulada con EDTA o ACD): 1. Agregue 3.0 ml de sangre entera anticoagulada a un tubo cónico de 15 ml y adicione 5 ml de buffer de lisis celular, agite vigorosamente primero por inversión luego por vortex. 2. Centrifugue a 3,000 G por 5 minutos y descarte cuidadosamente el sobrenadante por decantación hacia NaOCl 0.1%. 3. Agregue 2 ml de buffer de lisis celular y mezcle vigorosamente primero por inversión luego por vortex hasta resuspender por completo el pellet nuclear. 4. Centrifugue a 3,000 G por 5 minutos y descarte cuidadosamente el sobrenadante por decantación. 5. Repita los pasos #3 y 4 dos veces mas hasta eliminar completamente la coloración roja del pellet. 6. Agregue 150 µl Tris-HCl 10 mm ph 8.0, mezcle vigorosamente en vortex hasta resuspender completamente al pellet nuclear. 7. Agregue 150 µl de la solución de detergente a 20 mg/ml, mezcle vigorosamente en vortex hasta resuspender completamente al pellet. 8. Agregue 100 µl de 5M NaCl y mezcle vigorosamente en vortex hasta lograr una solución turbia. Transfiera la suspensión de nucleos lisados a un microtubo de 1.5 ml. 9. Centrifugue a 16,000 G durante 10 minutos. 10. Transfiera el sobrenadante a un nuevo microtubo de 1.5 ml evitando perturbar el sedimento. Descarte el microtubo con el sedimento. 11. Agregue 1,000 µl de etanol al 96% a -20 C, mezcle gentilmente. 12. Retire el DNA precipitado con un microcapilar doblado en forma de gancho y descarte el etanol contenido en el tubo por decantación. 13. Regrese el microcapilar con el DNA de nuevo al tubo y agregue 0.5 ml de etanol al 70%, lave durante 20 segundos. 14. Vuelva a retirar el microcapilar con el DNA y descarte el etanol de lavado por decantación. 15. Repita los pasos #13 y 14 dos veces mas. 16. Regrese el microcapilar con el DNA al microtubo correspondiente y seque el microtubo en el thermomixer

6 a 70 ºC. Revise el microtubo cada 5 minutos hasta evidenciar la eliminación del etanol restante. 17. Resuspenda el DNA en 1,500 µl de Tris-HCl ph 8.0 para preparar la solución nativa de DNA genómico. 18. Incube la solución nativa de DNA genómico en el thermomixer durante 30 minutos a 70 C y 350 RPM. Procedimiento Microprep (750 µl de SANGRE ENTERA anticoagulada con EDTA o ACD): 1. Agregue 750 µl de sangre entera anticoagulada a un microtubo de 1.5 ml y adicione 750 µl de buffer de lisis celular, agite vigorosamente primero por inversión luego por vortex. 2. Centrifugue a 3,000 G por 5 minutos y descarte el sobrenadante por decantación hacia NaOCl 0.1%. 3. Agregue 500 µl de buffer de lisis celular y mezcle vigorosamente primero por inversión luego por vortex hasta resuspender por completo el pellet nuclear. 4. Centrifugue a 3,000 G por 5 minutos y descarte el sobrenadante por decantación. 5. Repita los pasos #3 y 4 dos veces mas hasta eliminar completamente la coloración roja del pellet. 6. Agregue 37.5 µl Tris-HCl 10 mm ph 8.0 y mezcle vigorosamente en vortex hasta resuspender completamente al pellet nuclear. 7. Adicione 37.5 µl de la solución de detergente a 20 mg/ml y mezcle vigorosamente en vortex hasta homogeneizar por completo el pellet nuclear. 8. Agregue 32.5 µl de 5M NaCl y mezcle vigorosamente en vortex hasta lograr una solución turbia. 9. Centrifugue a 16,000 G durante 10 minutos. 10. Transfiera el sobrenadante a un nuevo microtubo de 1.5 ml evitando perturbar el sedimento. Descarte el microtubo con el sedimento proteico. 11. Agregue 500 µl de etanol al 96% a -20 C, mezcle gentilmente. 12. Retire el DNA precipitado con un microcapilar doblado en forma de gancho y descarte el etanol residual. 13. Enjuague el microcapilar con el DNA en 300 µl de etanol al 70% durante 20 segundos y descarte el etanol residual. 14. Enjuague nuevamente el microcapilar con el DNA en 300 µl de etanol al 70% durante 20 segundos y descarte el etanol residual. 15. Regrese el microcapilar con el DNA al microtubo del último lavado y sequelo en el thermomixer a 70 ºC durante 10 minutos. 16. Resuspenda el DNA en 100 µl de Tris-HCl ph 8.0 para preparar la solución nativa de DNA genómico.

7 17. Incube la solución nativa de DNA genómico en el thermomixer durante 30 minutos a 70 C y 350 RPM. Procedimiento Microprep CL (750 µl de CONCENTRADO LEUCOCITARIO): 1. Agregue 750 µl de concentrado leucocitario a un microtubo de 2 ml y adicione 1.25 ml de buffer de lisis celular, agite vigorosamente primero por inversión luego por vortex. 2. Centrifugue a 3,000 G por 5 minutos y descarte el sobrenadante por decantación hacia NaOCl 0.1%. 3. Agregue 1000 µl de buffer de lisis celular y mezcle vigorosamente primero por inversión luego por vortex hasta resuspender por completo el pellet nuclear. 4. Centrifugue a 3,000 G por 5 minutos y descarte el sobrenadante por decantación. 5. Repita los pasos #3 y 4 dos veces mas hasta eliminar completamente la coloración roja del pellet. 6. Agregue 150 µl Tris-HCl 10 mm ph 8.0 y mezcle vigorosamente en vortex hasta resuspender completamente al pellet nuclear. 7. Adicione 150 µl de la solución de detergente a 10 mg/ml y mezcle vigorosamente en vortex hasta homogeneizar por completo el pellet nuclear. 8. Agregue 100 µl de 5M NaCl y mezcle vigorosamente en vortex hasta lograr una solución turbia. 9. Centrifugue a 16,000 G durante 10 minutos. 10. Transfiera el sobrenadante a un nuevo microtubo de 2 ml evitando perturbar el sedimento. Descarte el microtubo con el sedimento proteico. 11. Agregue 1.75 ml de etanol al 96% a -20 C, mezcle gentilmente. 12. Retire el DNA precipitado con un microcapilar doblado en forma de gancho y descarte el etanol residual. 13. Enjuague el microcapilar con el DNA en 500 µl de etanol al 70% durante 20 segundos y descarte el etanol residual. 14. Enjuague nuevamente el microcapilar con el DNA en 500 µl de etanol al 70% durante 20 segundos y descarte el etanol residual. 15. Regrese el microcapilar con el DNA al microtubo del último lavado y sequelo en el thermomixer a 70 ºC durante 10 minutos. 16. Resuspenda el DNA en 100 µl de Tris-HCl ph 8.0 para preparar la solución nativa de DNA genómico. 17. Incube la solución nativa de DNA genómico en el thermomixer durante 30 minutos a 70 C y 350 RPM.

8 Control de cambios: 2013, 01 de Nov. - Se corrige reduce de suspensión final del DNA de modalidad microprep a 100 µl y del midiprep a 500 µl. - Se elimina paso de incubación a -20 C durante 20 minutos en el paso de precipitación de todas las modalidades. - Se reduce volumen de etanol al 96º de modalidad midiprep de 1500 a 1000 µl.

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido

Guía Práctica 9. Producción de micelio en medio líquido para extracción de ADN. Micelio de hongos. Contenido Guía Práctica 9 Micelio de hongos Producción de micelio en medio líquido para extracción de ADN Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

EXTRACCIÓN DE ADN (3)

EXTRACCIÓN DE ADN (3) EXTRACCIÓN DE ADN (3) PROCEDIMIENTO BÁSICO PARA FUENTES ALTERNATIVAS Muchos estudios de Biología Molecular comienzan con la extracción de ácidos nucleicos. La lisis celular libera las moléculas en una

Más detalles

MODIFICACIÓN DE UNA TÉCNICA PARA EXTRACCIÓN DE ADN DE GLÓBULOS BLANCOS HUMANOS

MODIFICACIÓN DE UNA TÉCNICA PARA EXTRACCIÓN DE ADN DE GLÓBULOS BLANCOS HUMANOS MODIFICACIÓN DE UNA TÉCNICA PARA EXTRACCIÓN DE ADN DE GLÓBULOS BLANCOS HUMANOS José Henry Osorio 1 Yoccner Edilson Quenán 2 RESUMEN Introducción: Las técnicas modificadas de extracción de ADN a partir

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

Laboratorio de Biotecnología Molecular. Módulo de Bioquímica y Farmacia. FCEQyN. UNaM. Av. Mariano Moreno 1375, 3300 Posadas Misiones Argentina.

Laboratorio de Biotecnología Molecular. Módulo de Bioquímica y Farmacia. FCEQyN. UNaM. Av. Mariano Moreno 1375, 3300 Posadas Misiones Argentina. PROTOCOLO DE EXTRACCIÓN DE DNA POR SALTING-OUT PARA PEQUEÑOS VOLÚMENES DE SANGRE Autores Riera, Mario A.; Rojas, Maria E.; Zapata, Pedro D. Dirección Laboratorio de Biotecnología Molecular. Módulo de Bioquímica

Más detalles

Guías Didácticas para el desarrollo de experimentos

Guías Didácticas para el desarrollo de experimentos Guías Didácticas para el desarrollo de experimentos 1) Obtención y cuantificación de tu propio ADN El ácido desoxirribonucleico, abreviado como ADN, es un tipo de ácido nucleico, una molécula que forma

Más detalles

Documentos de la Red Nacional de Biobancos. Guía de protocolos utilizados para la obtención de ácidos nucléicos en biobancos

Documentos de la Red Nacional de Biobancos. Guía de protocolos utilizados para la obtención de ácidos nucléicos en biobancos Documentos de la Red Nacional de Biobancos Guía de protocolos utilizados para la obtención de ácidos nucléicos en biobancos Septiembre 2012 Este documento ha sido elaborado con la participación de las

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

37. Purificación de ácidos nucleicos

37. Purificación de ácidos nucleicos 37. Purificación de ácidos nucleicos Mª José Prieto Álamo, Juan López Barea, Carmen Pueyo de la Cuesta Departamento de Bioquímica y Biología Molecular, Campus Universitario de Rabanales, Edificio Severo

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA.

RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. RECOGIDA DE PLACENTA EN ELPARTO. ESTUDIO INMA. El estudio INMA lleva asociado la toma de una serie de muestras biológicas según el momento o fase del estudio. Coincidiendo con el parto se recoge una muestra

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

OBTENCIÓN DE MUTANTES

OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles

1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS.

1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS. Página 1 de 5 CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain.

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

EXTRACCIÓN DE ADN (2)

EXTRACCIÓN DE ADN (2) EXTRACCIÓN DE ADN (2) PROCEDIMIENTO BÁSICO Muchos estudios de Biología Molecular comienzan con la extracción de ácidos nucleicos. La lisis celular libera las moléculas en una fase acuosa que es separada

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA

BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA Objetivos: Diferenciar los niveles de organización y compactación del material genético. Comprender los principios básicos

Más detalles

Laboratorio de Marcadores Moleculares del Programa de Cereales y Granos Nativos

Laboratorio de Marcadores Moleculares del Programa de Cereales y Granos Nativos Laboratorio de Marcadores Moleculares del Programa de Cereales y Granos Nativos GUÍA PRÁCTICA: INTRODUCCIÓN AL USO DE MARCADORES MOLECULARES EN EL ANÁLISIS DE DIVERSIDAD GENÉTICA Bloque Práctico (Chirinos

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

TRABAJ O PRÁCTICO: PRECIPITACIÓN Y FILTRACIÓN

TRABAJ O PRÁCTICO: PRECIPITACIÓN Y FILTRACIÓN TRABAJ O PRÁCTICO: PRECIPITACIÓN Y FILTRACIÓN PREGUNTA DE ENFOQUE: Es posible conocer la cantidad de cloruro de plata que se forma al mezclar una disolución acuosa de cloruro de sodio con una de nitrato

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

EXTRACCIÓN DE ADN DE DISTINTAS MUESTRAS VEGETALES

EXTRACCIÓN DE ADN DE DISTINTAS MUESTRAS VEGETALES EXTRACCIÓN DE ADN DE DISTINTAS MUESTRAS VEGETALES ABSTRACT The objective of the experiment is to extract DNA of different fruits and vegetables. On our case we developed three different experiments, the

Más detalles

CROMATOGRAFÍA DE FILTRACIÓN EN GEL

CROMATOGRAFÍA DE FILTRACIÓN EN GEL 1.- FUNDAMENTO TEÓRICO CROMATOGRAFÍA DE FILTRACIÓN EN GEL Filtración en gel - 1 (Farmacia) La cromatografía de exclusión o filtración en gel es una clase de cromatografía sólido-líquido que permite la

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo

ANEXO I. Inmunofenotipificación Celular por Citometría de Flujo ANEXO I Inmunofenotipificación Celular por Citometría de Flujo Reactivos Anticuerpos monoclonales fluoromarcados (BD Bioscience Pharmingen) Medio DMEM con 0.02% de azida de sodio Paraformaldehido (PFA)

Más detalles

METODOLOGIA. A. Colección de muestras de agua:

METODOLOGIA. A. Colección de muestras de agua: CUARTA PARTE BIOMASA FOTOTROFOS: CLOROFILAS LA BIOMASA DE FITOPLANCTON puede ser estimada determinando la concentración de pigmentos fotosintéticos en una muestra de agua. Midiendo la concentración de

Más detalles

DANAGENE BLOOD DNA KIT

DANAGENE BLOOD DNA KIT Ref. 0601 100 ml Ref. 0602 200 ml DANAGENE BLOOD DNA KIT 1.INTRODUCCION DANAGENE BLOOD DNA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de sangre total o médula ósea.

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

Experimento con reactivos de la vida cotidiana!

Experimento con reactivos de la vida cotidiana! Experimento con reactivos de la vida cotidiana Laura Martínez Martín- 1º Grado Genética - UAB Abril de 2015 1 Índice Introducción 3 Objetivos 3 Material. 3 Procedimiento 4 Explicaciones científicas del

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

METODOS DE ANALISIS BIOMEDICOS

METODOS DE ANALISIS BIOMEDICOS METODOS DE ANALISIS BIOMEDICOS 2010 Profesora a cargo: Dra. Viviana Lepek PARTE PRÁCTICA Jefe de T.P.: Dra. Mara Roset Ayudantes: Dra. Ines Marchesini Lic. Lucas Bukata Dr. Juan Mucci Dr. Adrián Mutto

Más detalles

Obsevación y recuento de células sanguíneas. Semestre B-2010

Obsevación y recuento de células sanguíneas. Semestre B-2010 1 Práctica 2 Obsevación y recuento de células sanguíneas Semestre B-2010 Introducción En la sangre se encuentran los leucocitos o glóbulos blancos que son las células móviles del sistema inmunitario. Todos

Más detalles

MÉTODO RÁPIDO Y ECONÓMICO PARA LA EXTRACCIÓN DE ADN GENÓMICO EN LA BROCA DEL CAFÉ Y SU USO EN PCR

MÉTODO RÁPIDO Y ECONÓMICO PARA LA EXTRACCIÓN DE ADN GENÓMICO EN LA BROCA DEL CAFÉ Y SU USO EN PCR MÉTODO RÁPIDO Y ECONÓMICO PARA LA EXTRACCIÓN DE ADN GENÓMICO EN LA BROCA DEL CAFÉ Y SU USO EN PCR Flor E. Acevedo-Bedoya * ; Lucio Navarro-Escalante * ; Luis M. Constantino-Chuaire ** ; Zulma N. Gil-Palacio

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA)

CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) CUANTIFICACIÓN DE ADENOSIN DESAMINASA (ADA) PROTOCOLO ADA FUNDAMENTO DEL METODO: La adenosindesaminasa (ADA) es una enzima del catabolismo de las purinas que cataliza la conversión de la adenosina en inosina

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

TEMA 6. PURIFICACIÓN DE PROTEÍNAS

TEMA 6. PURIFICACIÓN DE PROTEÍNAS TEMA 6. PURIFICACIÓN DE PROTEÍNAS 1. Introducción 2. Métodos de rotura celular y extracción de proteínas 3. Métodos cromatográficos 4. Métodos electroforéticos 1. Introducción La mayor parte de las investigaciones

Más detalles

1. OBTENCIÓN DE ADN DE BACTERIAS PATÓGENAS

1. OBTENCIÓN DE ADN DE BACTERIAS PATÓGENAS 1. OBTENCIÓN DE ADN DE BACTERIAS PATÓGENAS Existen diferentes métodos para la obtención de ADN bacteriano que varían en duración y complejidad del procedimiento en función de la calidad del ADN que queramos

Más detalles

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo:

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo: Página 1 de 1 1. Titulo: Electroforesis de DNA 2. Objetivo Conocer los principios básicos de la electroforesis horizontal en geles de agarosa y aplicarlo para la separación de DNA humano, plasmídico, recombinante

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

SECRETARIA DE COMERCIO FOMENTO INDUSTRIAL NORMA MEXICANA NMX-F-267-1991

SECRETARIA DE COMERCIO FOMENTO INDUSTRIAL NORMA MEXICANA NMX-F-267-1991 SECRETARIA DE COMERCIO Y FOMENTO INDUSTRIAL NORMA MEXICANA NMX-F-267-1991 INDUSTRIA AZUCARERA- MUESTRAS DE JUGO DE CAÑA DE AZUCAR SACAROSA CLERGET - METODO DE PRUEBA SUGAR INDUSTRY - SAMPLES OF SUGAR CANE

Más detalles

MMP. MÉTODOS DE MUESTREO Y PRUEBA DE MATERIALES

MMP. MÉTODOS DE MUESTREO Y PRUEBA DE MATERIALES LIBRO: PARTE: TÍTULO: CAPÍTULO: MMP. MÉTODOS DE MUESTREO Y PRUEBA DE MATERIALES 5. MATERIALES PARA SEÑALAMIENTO Y DISPOSITIVOS DE SEGURIDAD 01. Pinturas para Señalamiento 003. Contenido de Pigmento en

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación.

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación. 23 de agosto 2007 Se comenzó la elaboración de la bitácora Medio LB Broth, Billar (Luria-Bertani) 25gr/litro Se preparó 500 mililitros agregando 12.5 gramos Se diluyó y esterilizó por autoclave Medio LB

Más detalles

Hibridación In Situ en secciones gruesas de vibratomo

Hibridación In Situ en secciones gruesas de vibratomo Hibridación In Situ en secciones gruesas de vibratomo (Vicente Herranz Pérez, Unitat de Genetica Molecular, IBV) (Se va trabajar con ARN, por lo que se ha de ser muy estricto y cuidadoso para evitar las

Más detalles

MEMORIA DE PRÁCTICAS

MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS.

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. ASUNTO Con fundamento en lo dispuesto en los Artículos

Más detalles

Normalización de soluciones de NaOH 0,1N y HCl 0,1N.

Normalización de soluciones de NaOH 0,1N y HCl 0,1N. Laboratorio N 1: Normalización de soluciones de NaOH 0,1N y HCl 0,1N. Objetivos: - Determinar la normalidad exacta de una solución de hidróxido de sodio aproximadamente 0,1 N, utilizando biftalato de potasio

Más detalles

EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS

EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS Los hongos poseen un genoma complejo consistente en: ADN nuclear (n ADN) ADN mitocondrial (mt ADN) en algunos casos ADN plasmídico EXTRACCIÓN DE ADN DE HONGOS FILAMENTOSOS

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

UNIVERSIDAD AUTÓNOMA DE CIUDAD JUÁREZ INSTITUTO DE CIENCIAS BIOMÉDICAS DEPARTAMENTO DE CIENCIAS QUÍMICO-BIOLÓGICAS PROGRAMA DE BIOLOGÍA

UNIVERSIDAD AUTÓNOMA DE CIUDAD JUÁREZ INSTITUTO DE CIENCIAS BIOMÉDICAS DEPARTAMENTO DE CIENCIAS QUÍMICO-BIOLÓGICAS PROGRAMA DE BIOLOGÍA UNIVERSIDAD AUTÓNOMA DE CIUDAD JUÁREZ INSTITUTO DE CIENCIAS BIOMÉDICAS DEPARTAMENTO DE CIENCIAS QUÍMICO-BIOLÓGICAS PROGRAMA DE BIOLOGÍA MANUAL DE PRÁCTICAS BIOLOGÍA MOLECULAR MANUAL DE PRÁCTICAS DE BIOLOGÍA

Más detalles

Purificación de RNA IG 2010

Purificación de RNA IG 2010 Purificación de RNA IG 2010 1 Purificación de RNA Para qué sirve? Cómo se trabaja con RNA? Pasos generales: Homogeneizar células Purificar el RNA (total o no total, ej mrna) Cuantificar el RNA purificado

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

REACCIONES DE IONES METÁLICOS

REACCIONES DE IONES METÁLICOS Actividad Experimental 4 REACCIONES DE IONES METÁLICOS Investigación previa -Investigar las medidas de seguridad para trabajar con amoniaco -Investigar las reglas de solubilidad de las sustancias químicas.

Más detalles

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua destilada utilizando Dióxido de Titanio dopado con Nitrógeno,

Más detalles

Obtención de ADN de cactáceas: comparación de dos métodos de extracción en Ferocactus histrix

Obtención de ADN de cactáceas: comparación de dos métodos de extracción en Ferocactus histrix Obtención de ADN de cactáceas: comparación de dos métodos de extracción en Ferocactus histrix Brenda Díaz Cárdenas 1, Liliana Gómez Flores Ramos 1, Verónica Carolina Rosas-Espinoza 2, Laura Izascum Pérez

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

10B Reacciones de Esterificación de Ácidos Carboxílicos. Obtención de Acetato de Isoamilo (Aceite de Plátano).

10B Reacciones de Esterificación de Ácidos Carboxílicos. Obtención de Acetato de Isoamilo (Aceite de Plátano). PRÁCTICA 10B Reacciones de Esterificación de Ácidos Carboxílicos. Obtención de Acetato de Isoamilo (Aceite de Plátano). I. OBJETIVOS. a) Preparar un éster a partir de un alcohol y un ácido carboxílico.

Más detalles

Manual del GPHF-Minilab

Manual del GPHF-Minilab Una Guía Concisa de Control de Calidad de Drogas Esenciales y otros Medicamentos Manual del GPHF-Minilab Tercer Suplemento del Volumen II Cromatografía de Capa Fina Extensión 2003 Antiretrovirales Una

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

II. METODOLOGÍA. El proceso de elaboración del biodiesel se constituye de siete pasos fundamentales: 6.1. DETERMINACIÓN DE LOS GRAMOS DE CATALIZADOR

II. METODOLOGÍA. El proceso de elaboración del biodiesel se constituye de siete pasos fundamentales: 6.1. DETERMINACIÓN DE LOS GRAMOS DE CATALIZADOR II. METODOLOGÍA 6. PROCESO DE ELABORACIÓN El proceso de elaboración del biodiesel se constituye de siete pasos fundamentales: 1. Determinación de los gramos de catalizador 2. Preparación del Metóxido de

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas Grado en Química 4º Curso Bioquímica Guión de Prácticas UTILES A TRAER POR EL ALUMNO Bata Gafas de Seguridad Cuaderno de Laboratorio NORMAS DE TRABAJO Antes de empezar Antes de empezar cada práctica, el

Más detalles

En los programas de estudio para sus estudiantes los Aprendizajes incluidos en la actividad son:

En los programas de estudio para sus estudiantes los Aprendizajes incluidos en la actividad son: INTRODUCCIÓN Recordemos que lo que define a un ser vivo entre otras funciones, es su función reproductiva, que permite que una especie se perpetúe en el tiempo, manteniendo las características de sus progenitores,

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Medición de ph y dureza

Medición de ph y dureza Medición de ph y dureza 363 Medición de ph y dureza Isabel Romero Terán Medición de ph Campo de aplicación Este procedimiento complementario es útil para todos los ensayos de toxicidad que requieran medir

Más detalles

PRÁCTICA 1: MÉTODOS DE RUPTURA CELULAR

PRÁCTICA 1: MÉTODOS DE RUPTURA CELULAR PRÁCTICA 1: MÉTODOS DE RUPTURA CELULAR FUNDAMENTO TEÓRICO Para estudiar la estructura y/o las funciones metabólicas de los distintos compartimentos celulares hay que aislarlos del resto de los orgánulos.

Más detalles

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular

TP1: Diluciones. Objetivos. Introducción. Introducción a la Biología Celular y Molecular TP1: Diluciones Objetivos Familiarizarse con las unidades mas utilizadas en biología molecular y ser capaces de intercambiar ágilmente las distintas unidades. Familiarizarse con el material de uso corriente

Más detalles

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS Leidy Diana Ardila Leal Docente. INTRODUCCIÓN En esta práctica se va a realizar la extracción

Más detalles

Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar

Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar 5. METODOLOGIA Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar (supermercado, mercado de San Pedro Cholula y tienda de verduras). Revisando la bibliografía se encontraron

Más detalles

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel

Int. Cl. 7 : C12N 9/02. 72 Inventor/es: Kajiyama, Naoki. 74 Agente: Carvajal y Urquijo, Isabel 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 249 794 1 Int. Cl. 7 : C12N 9/02 12 TRADUCCIÓN DE PATENTE EUROPEA T3 86 Número de solicitud europea: 9766.6 86 Fecha de presentación

Más detalles