Major en Ingeniería Biológica Interdisciplinario Titulo en Ingeniería Civil en Biotecnología

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Major en Ingeniería Biológica Interdisciplinario Titulo en Ingeniería Civil en Biotecnología"

Transcripción

1 Major en Ingeniería Biológica Interdisciplinario Titulo en Ingeniería Civil en Biotecnología Atrévete a desafiar los límites

2 Areas de Aplicación de la Ingeniería Biológica Salud Roja Biomedicina Verde Agro- Alimentaria Necesidades insatisfechas Sustentabilidad Blanca Industrial Economia

3 En qué consiste el Major en Ingeniería Biológica? - Nueva disciplina que integra la ingeniería con las ciencias de la vida. - Combina la enseñanza de las ciencias biológicas a nivel molecular y celular con el análisis cuantitativo y sistémico de la ingeniería para el diseño y síntesis de soluciones biotecnológicas. - Proporciona a sus egresados las competencias necesarias para: - entender cómo funcionan los sistemas biológicos, - aplicar este conocimiento a la solución de problemas y desarrollo de tecnologías eficientes inspiradas en la biología.

4 Características de Nueva Ingenieria UC Currículo con 2 ciclos de formación Licenciatura (4 años) + Articulación Currículo orientado a competencias Metodologías de enseñanza centradas en el alumno Evaluación de habilidades más que de conocimiento en sí. Programas de licenciatura acreditables internacionalmente (ABET - Accreditation Board for Engineering and Technology ) Licenciatura con un Perfil de Egreso definido. Grado académico Licenciado en Ciencias de la Ingeniería, con Major en y Minor en Diferentes alternativas de articulación luego de la Licenciatura.

5 Majors Majors Disciplinarios: Programas que se concentran en un área del conocimiento específica y auto-contenida de la ingeniería. Majors Interdisciplinarios: Programas que consideran la integración e interacción de dos o más áreas del conocimiento.

6 Minors Minor de Amplitud: Concentración pequeña de cursos cuyos requisitos se encuentran dentro del Plan Común en Ciencias y/o de la Base General del Major. Minor de Profundización: Minor asociado a un Major en particular y compuesto por una concentración pequeña de cursos cuyos requisitos se encuentran sólo en el Major.

7

8 Cursos Específicos BIO151E BIO228C ICS 1006 IIQ2043 IIQ2133 IIQ2102 IIQ 2693 IIQ2683 IIQ2673 IIQ2243 Biología de microorganismos Bioquímica y genética molecular Optimización Fisicoquímica Procesos químicos Fenómenos de Transporte Biotecnología molecular Biotecnología microbiana Bioseparaciones Diseño de procesos químicos

9 Minor de Profundización Minor en Bioingeniería En este minor los estudiantes profundizan sus conocimientos y competencias alcanzados en el Major en Ingeniería Biológica, en una de las siguientes áreas: Procesos Medioambiente Biomedicina Bioenergía Biología sintética Bioinfomática.

10 Inserción al campo laboral - Biominería, - Alimentos, - Medioambiente - Química y Recursos Naturales, - Energía, - Industria farmacéutica - Industria de fermentaciones - Biomedicina,.. - Desarrollo de emprendimientos propios

11 Articulación Títulos Ingeniería Civil en Biotecnología, mención Procesos o Ambiental. Ingeniería civil de industrias, mención Bioprocesos Ingeniería civil ambiental Otros títulos de Ingenieria civil Postgrados Emprendimientos Propios

12 Recursos Académicos Jefe de Programa: Eduardo Agosin Apoyo administrativo: Aurora Muñoz Comité de Programa: Francisco Melo (Biol) Luis Larrondo (Biol) Daniel Garrido (Ing ) Ignacio Vargas (Ing ) Cuerpo Académico Más de 50 profesores de Ciencias Biológicas e Ingeniería.

13 Metabolome S X 1 X 2 X 3 E 1 E 2 E 3 E 4 Fluxome P Proteome E 5 Transcriptome E 7 E6 Interactome Genome Curso Exploratorio IIQ2663 Fundamentos de Biotecnología

14

15 Genómica y bioinformática: de la secuencia a la función DE.. Datos brutos de una secuencia: to nt (bacteria) AAACACTTAGACAATCAATATAAAGATGAAGTGAACGCT CTTAAAGAGAAGTTGGAAAACTTGCAGGAACAAATCAAA GATCAAAAAAGGATAGAAGAACAAGAAAAACCACAAACA CTTAGACAATCAATATAAAGATGAAGTGAACGCTCTTAA AGAGAAGTTGGAAAACTTGCAGGAACAAATCAAAGATCA AAAAAGGATAGAAGAACAAGAAAAACCACAAACACTTAG ACAATCAATATAAAGATGAAGTGAACGCTCTTAAAGAGA AGTTGGAAAACTTGCAGGAACAAATCAAAGATCAAAAAA GGATAGAAGAACAAGAAAAACCACAAACACTTAGACAAT CAATATAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTG GAAAACTTGCAGGAACAAATCAAAGATCAAAAAAGGATA GAAGAACAAGAAAAACCACAAACACTTAGACAATCAATA TAAAGATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAA CTTGCAGGAACAAATCAAAGATCAAAAAAGGATAGAAGA ACAAGAAAAACCACAAACACTTAGACAATCAATATAAAG ATGAAGTGAACGCTCTTAAAGAGAAGTTGGAAAACTTGC AGGAACAAATCAAAGATCAAAAAAGGATAGAAGAACAAG AAAAACCAC A. La célula virtual (reconstrucción de las vías metabólicas desde la secuencia)

16

17 Diseño de procesos biotecnológicos

18 Otros datos relevantes Atrévete a desafiar los límites

19 Evolución de la Secuenciación de Genomas

20 Interpretación de datos genómicos

21

ACUERDO RECTIFICATORIO CARRERAS DE INGENIERÍA PONTIFICIA UNIVERSIDAD CATÓLICA DE CHILE SANTIAGO

ACUERDO RECTIFICATORIO CARRERAS DE INGENIERÍA PONTIFICIA UNIVERSIDAD CATÓLICA DE CHILE SANTIAGO ACUERDO RECTIFICATORIO CARRERAS DE INGENIERÍA PONTIFICIA UNIVERSIDAD CATÓLICA DE CHILE SANTIAGO OCTUBRE 2013 ACUERDO RECTIFICATORIO Carreras de Ingeniería Pontificia Universidad Católica de Chile Con fecha

Más detalles

MAGÍSTER EN CIENCIAS DE LA INGENIERÍA BIOINGENIERÍA

MAGÍSTER EN CIENCIAS DE LA INGENIERÍA BIOINGENIERÍA MAGÍSTER EN CIENCIAS DE LA INGENIERÍA BIOINGENIERÍA 2015 MAGÍSTER EN CIENCIAS DE LA INGENIERÍA BIOINGENIERÍA La Bioingeniería es la aplicación de la ingeniería en el diseño, análisis, construcción y manipulación

Más detalles

INGENIERÍA EN BIOTECNOLOGÍA ( D.U.Nº 1 0 7 8 2 0 0 6 )

INGENIERÍA EN BIOTECNOLOGÍA ( D.U.Nº 1 0 7 8 2 0 0 6 ) INGENIERÍA EN BIOTECNOLOGÍA ( D.U.Nº 1 0 7 8 2 0 0 6 ) Facultad de Ecología y Recursos Naturales República 440, 1er Piso Sede Santiago, Campus República Tel: (56-2) 661 82 31 Fax: (56-2) 661 86 61 Contacto:

Más detalles

80115 DISEÑO Y SIMULACIÓN DE BIOPROCESOS Pág 1 de 5

80115 DISEÑO Y SIMULACIÓN DE BIOPROCESOS Pág 1 de 5 80115 DISEÑO Y SIMULACIÓN DE BIOPROCESOS Pág 1 de 5 ASIGNATURA: DISEÑO Y SIMULACIÓN DE BIOPROCESOS ESTUDIOS: MÁSTER EN BIOINGENIERÍA CÓDIGO: 80139 TIPO: O SEMESTRE: 2º CRÉDITOS: 3 (2 horas/semana) PROFESOR:

Más detalles

TOTAL 34 3 3 25 3 510 33. Duración del cuatrimestre. Hora teórica presencial. Hora práctica presencial. Hora teórica no presencial

TOTAL 34 3 3 25 3 510 33. Duración del cuatrimestre. Hora teórica presencial. Hora práctica presencial. Hora teórica no presencial Tipo s / no no Objetivo la asignatura Justificación la asignatura PRIMER CUATRIMTRE TIS I 22 0 0 22 0 330 21 los fundamentos teóricos y prácticos para la realización una propuesta investigación, herramientas

Más detalles

Posgrados PNPC-CONACYT PNPC 1378.5900 CENTRO UNIVERSITARIO DE CIENCIAS EXACTAS E INGENIERÍAS. 27455 y 27456. Red Universitaria de Jalisco

Posgrados PNPC-CONACYT PNPC 1378.5900 CENTRO UNIVERSITARIO DE CIENCIAS EXACTAS E INGENIERÍAS. 27455 y 27456. Red Universitaria de Jalisco PNPC mayo, 2015 Red Universitaria de Jalisco Posgrados CENTRO UNIVERSITARIO DE CIENCIAS EXACTAS E INGENIERÍAS NUESTROS POSGRADOS PERTENECEN AL LOS ADMITIDOS EN ESTOS POSGRADOS PUEDEN OBTENER UNA BECA CUCEI:

Más detalles

ASIGNATURA: GESTIÓN DE PROYECTOS, CALIDAD Y PROPIEDAD INTELECTUAL ESTUDIOS: MÁSTER EN BIOINGENIERÍA CÓDIGO: 80137

ASIGNATURA: GESTIÓN DE PROYECTOS, CALIDAD Y PROPIEDAD INTELECTUAL ESTUDIOS: MÁSTER EN BIOINGENIERÍA CÓDIGO: 80137 80120 GESTIÓN DE PROYECTOS, CALIDAD Y PROPIEDAD INTELECTUAL Pág 1 de 5 ASIGNATURA: GESTIÓN DE PROYECTOS, CALIDAD Y PROPIEDAD INTELECTUAL ESTUDIOS: MÁSTER EN BIOINGENIERÍA CÓDIGO: 80137 TIPO: O SEMESTRE:

Más detalles

LICENCIATURA EN QUIMICO EN ALIMENTOS LISTADO DE MATERIAS CONTENIDO PLAN:2004-2

LICENCIATURA EN QUIMICO EN ALIMENTOS LISTADO DE MATERIAS CONTENIDO PLAN:2004-2 LICENCIATURA EN QUIMICO EN ALIMENTOS PLAN:2004-2 Formar profesionales capaces de desempeñarse de manera eficaz, tanto a nivel individual como interdisciplinariamente, aplicando la información y formación

Más detalles

FICHA DE INFORMACIÓN PÚBLICA NECESARIA

FICHA DE INFORMACIÓN PÚBLICA NECESARIA DESCRIPCIÓN DEL TÍTULO FICHA DE INFORMACIÓN PÚBLICA NECESARIA Denominación : MÁSTER EN METODOLOGÍA DE INVESTIGACIÓN EN BIOLOGÍA FUNDAMENTAL Y BIOMEDICINA. Centro responsable: FACULTAD DE CIENCIAS BIOLÓGICAS

Más detalles

Doctorado en Ciencias Biofarmacéuticas

Doctorado en Ciencias Biofarmacéuticas Doctorado en Ciencias Biofarmacéuticas Código D025 1.- Acceso y admisión. -Para acceder al Programa de Doctorado será requisito estar en posesión de un Título español o europeo que otorgue conocimientos,

Más detalles

Institución educativa innovadora, flexible, centrada en el aprendizaje; fortalecida en su carácter rector de la educación pública tecnológica en

Institución educativa innovadora, flexible, centrada en el aprendizaje; fortalecida en su carácter rector de la educación pública tecnológica en Institución educativa innovadora, flexible, centrada en el aprendizaje; fortalecida en su carácter rector de la educación pública tecnológica en México; posicionada estratégicamente en los ámbito nacional

Más detalles

PROPUESTA PERFIL DE EGRESO BIOQUÍMICO UNIVERSIDAD DE CHILE

PROPUESTA PERFIL DE EGRESO BIOQUÍMICO UNIVERSIDAD DE CHILE PROPUESTA PERFIL DE EGRESO BIOQUÍMICO UNIVERSIDAD DE CHILE SÍNTESIS DEL PERFIL El Bioquímico de la Universidad de Chile es un profesional especialista en el conocimiento de la estructura y función molecular

Más detalles

MÁSTER UNIVERSITARIO EN BIOLOGÍA CELULAR Y MOLECULAR (BCM) Facultad de Ciencias, Facultad de Medicina, CIMA Universidad de Navarra

MÁSTER UNIVERSITARIO EN BIOLOGÍA CELULAR Y MOLECULAR (BCM) Facultad de Ciencias, Facultad de Medicina, CIMA Universidad de Navarra MÁSTER UNIVERSITARIO EN BIOLOGÍA CELULAR Y MOLECULAR (BCM) Facultad de Ciencias, Facultad de Medicina, Universidad de Navarra www.unav.es/ciencias/masterbcm PRESENTACIÓN PLAZAS LIMITADAS FIN DEL PLAZO

Más detalles

MAESTRÍA EN CIENCIAS ENERGÍA RENOVABLE PLAN DE ESTUDIOS

MAESTRÍA EN CIENCIAS ENERGÍA RENOVABLE PLAN DE ESTUDIOS CENTRO DE INVESTIGACIÓN CIENTÍFICA DE YUCATÁN MAESTRÍA EN CIENCIAS EN ENERGÍA RENOVABLE PLAN DE ESTUDIOS Vigencia a partir del 1 de Febrero de 2008 1 DESCRIPCIÓN DEL PROGRAMA Este programa es un programa

Más detalles

Facultad de Ingeniería. ingeniería BIOQUÍMICA A OTRO NIVEL

Facultad de Ingeniería. ingeniería BIOQUÍMICA A OTRO NIVEL Facultad de Ingeniería ingeniería BIOQUÍMICA A OTRO NIVEL El mundo depende hoy en día de la tecnología y los avances en los procesos bioquímicos; las nuevas fuentes de energía dependen de ellos, al igual

Más detalles

Plan de Assessment Académico Departamental

Plan de Assessment Académico Departamental 1 TRABAJO EN PROGRESO Marzo 2010 Universidad de Puerto Rico Arecibo Departamento de Biología Plan de Assessment Académico Departamental El Departamento de Biología de la Universidad de Puerto Rico en Arecibo

Más detalles

Curso 1º. Curso 2º. Curso 3º. Obligatorias. Obligatorias. Obligatorias. Grado en Ingeniería de la Salud por las Universidades de Málaga y Sevilla

Curso 1º. Curso 2º. Curso 3º. Obligatorias. Obligatorias. Obligatorias. Grado en Ingeniería de la Salud por las Universidades de Málaga y Sevilla Curso 1º 1 2260001 Álgebra Lineal 6 C1 1 2260003 Bioquímica Estructural 6 C1 1 2260006 Cálculo 6 C1 1 2260004 Física I 6 C1 1 2260005 Fundamentos de la Programación 6 C1 1 2260002 Ampliación de Cálculo

Más detalles

OBJETIVOS DEL POSGRADO. Facultad de Ciencias

OBJETIVOS DEL POSGRADO. Facultad de Ciencias OBJETIVOS DEL POSGRADO Facultad de Ciencias El programa de Maestría y Doctorado en Ciencias está sustentado por tres disciplinas; Biología, Física y Matemáticas con el fin de contribuir al conocimiento

Más detalles

CURRICULUM VITAE. UNIVERSIDAD CATOLICA DE SANTA MARIA DE AREQUIPA: Bachiller en Ingeniería Biotecnológica. Arequipa, marzo del 2009.

CURRICULUM VITAE. UNIVERSIDAD CATOLICA DE SANTA MARIA DE AREQUIPA: Bachiller en Ingeniería Biotecnológica. Arequipa, marzo del 2009. 1) DATOS PERSONALES CURRICULUM VITAE Nombre y Apellidos: Eduardo Antonio Mendoza Cárdenas Dirección: Residencial Santa Fe dpto. A-303 Tahuaycani-Sachaca- Arequipa. DNI Nro.: 41573250 CIP Nro.: 149469 Teléfonos

Más detalles

Ficha Docente: BIOTECNOLOGÍA FARMACÉUTICA I

Ficha Docente: BIOTECNOLOGÍA FARMACÉUTICA I BIOTECNOLOGÍA FARMACÉUTICA I CURSO 2015-16 FACULTAD DE FARMACIA UNIVERSIDAD COMPLUTENSE DE MADRID I.- IDENTIFICACIÓN NOMBRE DE LA ASIGNATURA: CARÁCTER: Optativa MATERIA: Complementaria 9.2: Itinerario

Más detalles

Introducción a la Bioinformática Centro de Bioinformática Instituto de Biotecnología Universidad Nacional de Colombia

Introducción a la Bioinformática Centro de Bioinformática Instituto de Biotecnología Universidad Nacional de Colombia Introducción a la Bioinformática Centro de Bioinformática Instituto de Biotecnología Universidad Nacional de Colombia Andrés M. Pinzón cphd - Universidad de los Andes 7'000.000 de habitantes Capital Mundial

Más detalles

Máster Universitario en Biotecnología Molecular y Celular de Plantas

Máster Universitario en Biotecnología Molecular y Celular de Plantas Máster Universitario en Biotecnología Molecular y Celular de Plantas 5.1. Descripción del Plan de Estudios El Plan de Estudios del Máster de Biotecnología Molecular y Celular de Plantas se estructura en

Más detalles

INGENIERÍA EN BIOTECNOLOGÍA UNIVERSIDAD ANDRÉS BELLO

INGENIERÍA EN BIOTECNOLOGÍA UNIVERSIDAD ANDRÉS BELLO INGENIERÍA EN BIOTECNOLOGÍA UNIVERSIDAD ANDRÉS BELLO SANTIAGO VIÑA DEL MAR 2 SANTIAGO VIÑA DEL MAR La Biotecnología aplica principios científicos y de la ingeniería al procesamiento de materiales por medios

Más detalles

PONTIFICIA UNIVERSIDAD CATÓLICA DE CHILE VICERRECTORÍA ACADÉMICA

PONTIFICIA UNIVERSIDAD CATÓLICA DE CHILE VICERRECTORÍA ACADÉMICA RESOLUCIÓN Nº111/2012 APRUEBA CREACIÓN DEL MAJOR EN SISTEMAS AUTÓNOMOS Y ROBÓTICOS (INTERDISCIPLINARIO) PARA ALUMNOS DE LA LICENCIATURA EN CIENCIAS DE LA INGENIERÍA 1º Apruébese la creación del Major en

Más detalles

GUÍA DOCENTE. Curso 2012-2013. Doble Grado: Ingeriería Farmacéutica y Diseño de Medicamentos

GUÍA DOCENTE. Curso 2012-2013. Doble Grado: Ingeriería Farmacéutica y Diseño de Medicamentos 1. DESCRIPCIÓN DE LA ASIGNATURA Grado: Biotecnología Doble Grado: Asignatura: Ingeriería Farmacéutica y Diseño de Medicamentos Módulo: Optatividad Sistemas Físicos, Químicos y Naturales Año académico:

Más detalles

LABORATORIO DE ANÁLISIS Y CONTROL DE CALIDAD (GRADO SUPERIOR)

LABORATORIO DE ANÁLISIS Y CONTROL DE CALIDAD (GRADO SUPERIOR) LABORATORIO DE ANÁLISIS Y CONTROL DE CALIDAD (GRADO SUPERIOR) CARACTERÍSTICAS TÍTULO: Técnico Superior en Laboratorio de Análisis y Control de Calidad PERFIL PROFESIONAL: Organizar y supervisar la actividad

Más detalles

UNIVERSIDAD AUTÓNOMA METROPOLITANA. UNIDAD IZTAPALAPA División de Ciencias Biológicas y de la Salud

UNIVERSIDAD AUTÓNOMA METROPOLITANA. UNIDAD IZTAPALAPA División de Ciencias Biológicas y de la Salud UNIVERSIDAD AUTÓNOMA METROPOLITANA UNIDAD IZTAPALAPA División de Ciencias Biológicas y de la Salud Licenciatura en Ingeniería Bioquímica Industrial Título: Ingeniero Bioquímico Industrial o Ingeniera Bioquímica

Más detalles

Aproximación innovadora al diseño de procesos a nivel de máster

Aproximación innovadora al diseño de procesos a nivel de máster 2º Congreso de Innovación Docente en Ingeniería Química Valencia, 23-24 de enero de 2014 Aproximación innovadora al diseño de procesos a nivel de máster Eva Rodil, Héctor Rodríguez, Jorge Sineiro Departamento

Más detalles

Máster en BIOINGENIERÍA. Titulación Oficial Estudios del EEES

Máster en BIOINGENIERÍA. Titulación Oficial Estudios del EEES Máster en BIOINGENIERÍA Titulación Oficial Estudios del EEES 2 Por qué estudiar en IQS? IQS es un centro de enseñanza universitaria de la Compañía de Jesús, con más de cien años de experiencia y una larga

Más detalles

IQS: un partner valioso para la empresa

IQS: un partner valioso para la empresa IQS: un partner valioso para la empresa Barcelona, 15 de noviembre de 2012 ESCUELA TÉCNICA SUPERIOR IQS Centro universitario fundado en Roquetas en 1905, trasladado a Barcelona en 1916 Miembro fundador

Más detalles

GUÍA DOCENTE 1. DESCRIPCIÓN DE LA ASIGNATURA. Nutrición Humana y Dietética Doble Grado:

GUÍA DOCENTE 1. DESCRIPCIÓN DE LA ASIGNATURA. Nutrición Humana y Dietética Doble Grado: 1. DESCRIPCIÓN DE LA ASIGNATURA Grado: Nutrición Humana y Dietética Doble Grado: Asignatura: Nutrigenómica Módulo: Ciencias Básicas Departamento: Biología Molecular e Ingeniería Química Año académico:

Más detalles

BIOPOLIS. Jornada: Biotecnología Industrial, Madrid

BIOPOLIS. Jornada: Biotecnología Industrial, Madrid BIOPOLIS Jornada: Biotecnología Industrial, Madrid INTRODUCCIÓN 40% 15% 25% 20% EMPRESA FUNDADA EN 2003 SOCIOS Consejo Superior de Investigaciones Científicas (CSIC) Natraceutical S.L. Central Lechera

Más detalles

GRADO EN NUTRICIÓN HUMANA Y DIETÉTICA: MÓDULO I

GRADO EN NUTRICIÓN HUMANA Y DIETÉTICA: MÓDULO I GRADO EN NUTRICIÓN HUMANA Y DIETÉTICA: MÓDULO I 1. Los fundamentos químicos, bioquímicos y biológicos de aplicación en nutrición humana y dietética 2. Conocer la estructura y función del cuerpo humano

Más detalles

GRADO EN INGENIERÍA QUÍMICA EGRESADOS. DATOS GENERALES EGRESADOS POR SEXO. Mujeres 28% Hombres 72% www.observatoriodeempleo.ulpgc.

GRADO EN INGENIERÍA QUÍMICA EGRESADOS. DATOS GENERALES EGRESADOS POR SEXO. Mujeres 28% Hombres 72% www.observatoriodeempleo.ulpgc. Correspondencia con: - Ingeniería Química El objetivo fundamental del Grado en Ingeniería Química es formar profesionales con los conocimientos necesarios para el diseño de procesos y productos relacionados

Más detalles

GUÍA DOCENTE. Curso 2012-2013

GUÍA DOCENTE. Curso 2012-2013 1. DESCRIPCIÓN DE LA ASIGNATURA Grado: Grado en Biotecnología Doble Grado: Asignatura: Procesos Biotecnológicos Módulo: Bioingeniería y Procesos Biotecnológicos. Procesos Biotecnológicos Departamento:

Más detalles

II ENCUENTRO DE ASOCIACIONES PROFESIONALES FARMACÉUTICAS

II ENCUENTRO DE ASOCIACIONES PROFESIONALES FARMACÉUTICAS II ENCUENTRO DE ASOCIACIONES PROFESIONALES FARMACÉUTICAS Punto de vista de los Farmacéuticos de Industria ( AEFI y Voc. Industria del COFM) Hemos hecho una revisión de los planes de estudio de las 6 universidades

Más detalles

Facultad de Farmacia Grado en Farmacia

Facultad de Farmacia Grado en Farmacia Facultad de Farmacia Grado en Farmacia COMPETENCIAS Se describen como figuran en la Orden CIN/2137/2008, de 3 de julio, por la que se establecen los requisitos para la verificación de los títulos universitarios

Más detalles

La Escuela Técnica Superior de Ingenieros Industriales

La Escuela Técnica Superior de Ingenieros Industriales La Escuela Técnica Superior de Ingenieros Industriales La Escuela cuenta con 4.500 alumnos matriculados cada año (3.600 de grado y 800 en postgrado), de los cuales 300 son estudiantes extranjeros. En 2014/2015

Más detalles

Modalidad de Ciencias y Tecnología

Modalidad de Ciencias y Tecnología Biología Esta materia requiere conocimientos incluidos en Biología y geología. Los grandes y rápidos avances de la investigación biológica en las últimas décadas han llevado a considerar a la segunda mitad

Más detalles

DOCTORADO EN CIENCIAS EN INGENIERÍA

DOCTORADO EN CIENCIAS EN INGENIERÍA DOCTORADO EN CIENCIAS EN INGENIERÍA Duración: 4 años Líneas de Investigación 1. Ingeniería de Sistemas de Proceso: Las actividades de esta línea se orientan al diseño, simulación, control y optimización

Más detalles

UNIVERSIDAD DEGUADALAJARA

UNIVERSIDAD DEGUADALAJARA Tipo: Profesionalizante. Orientación en: Medicina Forense. Criminalística. Criminología. Objetivos Generales: Centro Universitario de Ciencias de la Salud Maestría en Ciencias Forenses y Criminología Formar

Más detalles

Grado en Biotecnología por la Universidad Miguel Hernández de Elche

Grado en Biotecnología por la Universidad Miguel Hernández de Elche 5. Planificación de la enseñanzas 5.0. Explicación general de la planificación del plan de estudios El plan de estudios del Grado en Biotecnología, siguiendo el art.. del R.D. 9/007, consta de un total

Más detalles

EL CRECIMIENTO DE LOS NEGOCIOS ES HUMANAMENTE POSIBLE. Manpower Professional una empresa de talento diferente

EL CRECIMIENTO DE LOS NEGOCIOS ES HUMANAMENTE POSIBLE. Manpower Professional una empresa de talento diferente EL CRECIMIENTO DE LOS NEGOCIOS ES HUMANAMENTE POSIBLE Manpower Professional una empresa de talento diferente Ahora más que nunca, el crecimiento del negocio depende de poner a las personas en el lugar

Más detalles

Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA

Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal LICENCIATURA EN QUÍMICAS MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA PROGRAMA DE LAS ASIGNATURAS TÉCNICAS DE BIOLOGÍA MOLECULAR

Más detalles

Biotecnología Agrícola en México. Dra. Ernestina Valadez Moctezuma Universidad Autónoma Chapingo

Biotecnología Agrícola en México. Dra. Ernestina Valadez Moctezuma Universidad Autónoma Chapingo Biotecnología Agrícola en México Dra. Ernestina Valadez Moctezuma Universidad Autónoma Chapingo qué es la biotecnología? Es una ciencia aplicada, orientada al aprovechamiento de las capacidades biológicas

Más detalles

Estadísticas de seguimiento de egresados de nivel superior. Dirección de Egresados y Servicio Social

Estadísticas de seguimiento de egresados de nivel superior. Dirección de Egresados y Servicio Social Estadísticas de seguimiento de egresados de nivel superior Dirección de Egresados y Servicio Social 2011 Formato de la presentación Formato de la presentación Descripción de los estudios de seguimiento

Más detalles

ORIENTACIONES PARA LA CONVALIDACIÓN DE MP DE TÍTULOS DE FORMACIÓN PROFESIONAL APORTANDO ESTUDIOS UNIVERSITARIOS.

ORIENTACIONES PARA LA CONVALIDACIÓN DE MP DE TÍTULOS DE FORMACIÓN PROFESIONAL APORTANDO ESTUDIOS UNIVERSITARIOS. ORIENTACIONES PARA LA CONVALIDACIÓN DE MP DE TÍTULOS DE FORMACIÓN PROFESIONAL APORTANDO ESTUDIOS UNIVERSITARIOS. Estas tablas son unas orientaciones que contemplan la posible convalidación de módulos profesionales

Más detalles

Ingeniería de Ejecución Electrónica (5) Ingeniería de Ejecución Informática (4) Ingeniería de Ejecución Metalúrgica (1)

Ingeniería de Ejecución Electrónica (5) Ingeniería de Ejecución Informática (4) Ingeniería de Ejecución Metalúrgica (1) Ingeniería Civil Civil Ingeniería Civil Ambiental Ingeniería Civil Eléctrica Ingeniería Civil Electrónica Ingeniería Civil Industrial Ingeniería Civil Informática Ingeniería Civil Matemática (1) Ingeniería

Más detalles

GRADO EN INGENIERÍA QUÍMICA

GRADO EN INGENIERÍA QUÍMICA GRADO EN INGENIERÍA CURSO ACADÉMICO 2010/2011 Estudios Grado en Ingeniería Química (En el presente año académico solamente se ofertarán los cursos primero y segundo). Rama de conocimiento Centro Ingeniería

Más detalles

Autor: Andrés M. Gatica Arias, Dr.sc.agr

Autor: Andrés M. Gatica Arias, Dr.sc.agr Autor: Andrés M. Gatica Arias, Dr.sc.agr Introducción Es de rigurosa justicia emancipar la enseñanza de todo extraño poder, y convertirla en una función social, sin otra ley que la libre indagación y

Más detalles

DOCTORADO EN CIENCIAS DE LA INGENIERÍA CON MENCIÓN EN INGENIERÍA BIOQUÍMICA

DOCTORADO EN CIENCIAS DE LA INGENIERÍA CON MENCIÓN EN INGENIERÍA BIOQUÍMICA DOCTORADO EN CIENCIAS DE LA INGENIERÍA CON MENCIÓN EN INGENIERÍA BIOQUÍMICA ACREDITADO 4 AÑOS Desde 08/10/2014 hasta 08/10/2018 Doctorado en Ciencias de la Ingeniería con Mención en Ingeniería Bioquímica.

Más detalles

UNIVERSIDAD DE TECNOLOGÍA Y COMERCIO. Tecnológicamente Superior

UNIVERSIDAD DE TECNOLOGÍA Y COMERCIO. Tecnológicamente Superior UNIVERSIDAD DE TECNOLOGÍA Y COMERCIO Tecnológicamente Superior Diplomado en Administración Empresarial A quien está Dirigido Objetivos del Programa Contenido Académico Estructura del Programa Requisitos

Más detalles

Elda Falconi de la F. Reyna Fócil M., Salomón Páramo D. Fecha de elaboración: 12 de mayo de 2010 Fecha de última actualización: 17 mayo de 2010

Elda Falconi de la F. Reyna Fócil M., Salomón Páramo D. Fecha de elaboración: 12 de mayo de 2010 Fecha de última actualización: 17 mayo de 2010 PROGRAMA DE ESTUDIO Programa Educativo: Área de Formación : Licenciatura en Biología, Ing. Ambiental y Gestión Ambiental General BIOLOGÍA Horas teóricas: 2 Horas : 4 Total de Horas: 6 Total de créditos:

Más detalles

ANEXO FORMULARIO DE PROPUESTA DEL CURSO MASTER EN BIOINFORMATICA Y BIOLOGÍA COMPUTACIONAL

ANEXO FORMULARIO DE PROPUESTA DEL CURSO MASTER EN BIOINFORMATICA Y BIOLOGÍA COMPUTACIONAL ANEXO FORMULARIO DE PROPUESTA DEL CURSO MASTER EN BIOINFORMATICA Y BIOLOGÍA COMPUTACIONAL DEPARTAMENTO ACADÉMICO:? FECHAS DE REALIZACIÓN: del 7 de octubre del 2013 al 7 de Octubre de 2014 NOTA: Del 30/9/13

Más detalles

Informe final de evaluación del seguimiento de la implantación de títulos oficiales

Informe final de evaluación del seguimiento de la implantación de títulos oficiales Informe final de evaluación del seguimiento de la implantación de títulos oficiales 2013 MÁSTER UNIVERSITARIO EN BIOQUÍMICA, BIOLOGÍA MOLECULAR Y BIOMEDICINA UCM INFORMACIÓN PUBLICA Valoración Final Uno

Más detalles

Reforma Integral de la Educación Básica. Subsecretaría de Educación Básica Dirección General de Desarrollo Curricular

Reforma Integral de la Educación Básica. Subsecretaría de Educación Básica Dirección General de Desarrollo Curricular Reforma Integral de la Educación Básica Subsecretaría de Educación Básica Dirección General de Desarrollo Curricular Fortalezas de los programas de estudios 1993 Valoración positiva de los alumnos y padres

Más detalles

Doctorado en Administración y Alta Dirección

Doctorado en Administración y Alta Dirección Página web del programa Doctorado en Administración y Alta Dirección Misión El Doctorado en Administración y Alta Dirección formará investigadores de alto nivel capaces contribuir en la generación de conocimientos

Más detalles

Recorridos Biotecnológicos. Investigación y desarrollo en la UNCUYO del 2007 al 2015

Recorridos Biotecnológicos. Investigación y desarrollo en la UNCUYO del 2007 al 2015 Recorridos Biotecnológicos Investigación y desarrollo en la UNCUYO del 2007 al 2015 OBJETIVOS Relevar y sistematizar los proyectos de investigación relacionados con la Biotecnología, presentes en las diferentes

Más detalles

PROGRAMA DE MAESTRÍA EN CIENCIAS CON CONCENTRACION EN BIOTECNOLOGÍA

PROGRAMA DE MAESTRÍA EN CIENCIAS CON CONCENTRACION EN BIOTECNOLOGÍA PROGRAMA DE MAESTRÍA EN CIENCIAS CON CONCENTRACION EN BIOTECNOLOGÍA DESCRIPCION DEL PROGRAMA Programa interdisciplinario que comprende las áreas de química, biología, biotecnología y administración de

Más detalles

FACULTAD ESCUELA DE NEGOCIOS. TÍTULO: LICENCIADO EN COMERCIALIZACIÓN Modalidad a Distancia Duración: 4 (cuatro) años

FACULTAD ESCUELA DE NEGOCIOS. TÍTULO: LICENCIADO EN COMERCIALIZACIÓN Modalidad a Distancia Duración: 4 (cuatro) años FACULTAD ESCUELA DE NEGOCIOS TÍTULO: LICENCIADO EN COMERCIALIZACIÓN Modalidad a Distancia Duración: 4 (cuatro) años TÍTULO: ANALISTA EN MARKETING Modalidad a Distancia Duración: 3 (tres) años 1. INCUMBENCIAS

Más detalles

ANEXO III. Departamento de Antropología Social, Psicología Básica y Salud Pública. Departamento de Biología Molecular e Ingeniería Bioquímica.

ANEXO III. Departamento de Antropología Social, Psicología Básica y Salud Pública. Departamento de Biología Molecular e Ingeniería Bioquímica. ANEXO III Departamento de Antropología Social, Psicología Básica y Salud Pública. BT13001 BT13002 BT13003 Antropología Social Psicología Básica Medicina Preventiva y Salud Pública Departamento de Biología

Más detalles

Experiencias de Implementación del SCT-Chile en el Postgrado de la Universidad de Talca

Experiencias de Implementación del SCT-Chile en el Postgrado de la Universidad de Talca Experiencias de Implementación del SCT-Chile en el Postgrado de la Universidad de Talca Felipe Laurie, Ph.D. Director Magíster en Horticultura Facultad de Ciencias Agrarias Universidad de Talca Rol del

Más detalles

Perfil de Licenciado en Administrador Latinoamericano

Perfil de Licenciado en Administrador Latinoamericano Organización Latinoamericana de Administración Perfil de Licenciado en Administrador Latinoamericano INTRODUCCION De acuerdo a la Convocatoria emitida a las diferentes instituciones que conforman la Organización

Más detalles

CENTRO PANAMERICANO DE ESTUDIOS SUPERIORES

CENTRO PANAMERICANO DE ESTUDIOS SUPERIORES Maestría en Actividad Física CENTRO PANAMERICANO DE ESTUDIOS SUPERIORES CEPES Presentación La actividad física es un factor de suma importancia para mantener la calidad de vida y la salud de las personas

Más detalles

Movilidad Internacional

Movilidad Internacional Movilidad Internacional Colombia Administración de Empresas. Administración Pública. Artes de la Escena. Ciencia Política. Comunicación Social- Periodismo. Contaduría Pública. Derecho. Diseño Gráfico.

Más detalles

Contenidos Programáticos. PROGRAMA: Maestría en Biología Molecular y Biotecnología.

Contenidos Programáticos. PROGRAMA: Maestría en Biología Molecular y Biotecnología. Página 1 de 4 FACULTAD: Ingenierías y Arquitectura PROGRAMA: Maestría en Biología Molecular y Biotecnología. DEPARTAMENTO DE: Ingenieria Civil y Ambiental Bioprocesos CURSO : CÓDIGO: 561201 ÁREA: Núcleo

Más detalles

PROGRAMA DE CIENCIA. Prerrequisitos: Química, Física y Álgebra 2 y Trig, inscripción simultánea en Precálculo

PROGRAMA DE CIENCIA. Prerrequisitos: Química, Física y Álgebra 2 y Trig, inscripción simultánea en Precálculo Distrito 200 escuelas secundarias consideran el pensamiento científico es uno de los pilares de una educación de calidad. Entender el proceso científico, la práctica de la experimentación, registrar las

Más detalles

Lunes, 15 de Junio 2009

Lunes, 15 de Junio 2009 3.1.2. PROGRAMA A continuación se presenta el programa tentativo para la celebración del Curso Nacional de Biología de Sistemas. 8.00-10.00 Registro 8.30-9.00 Recepción Lunes, 15 de Junio 2009 9.00-10.00

Más detalles

INGENIERIA EN ALIMENTOS

INGENIERIA EN ALIMENTOS FACULTAD DE CIENCIAS EXACTAS, QUIMICAS Y NATURALES Dirección: Félix de Azara 1552 C. P. (3300) Posadas MISIONES Teléfono: (0376) - 4 422186 / 4427498 /4425414 e-mail: posmaster@fceqyn.unam.edu.ar www.fceqyn.unam.edu.ar

Más detalles

Estudios de Economía y Empresa 78.617 Trabajo Final de Grado Plan de marketing

Estudios de Economía y Empresa 78.617 Trabajo Final de Grado Plan de marketing TFG: PLAN DE MARKETING Descripción El Trabajo Final de Grado (TFG) es una asignatura obligatoria del plan de estudios del Grado de Marketing e Investigación de Mercados (MIM) que el estudiante debe cursar

Más detalles

Programas Nacionales de Formación. Información General

Programas Nacionales de Formación. Información General Programas Nacionales de Formación Información General Bases políticas la universalización y la municipalización exigen que la Educación Superior se constituya como un espacio abierto de formación permanente,

Más detalles

Daniel González B. Ma. Bernarda Hormazabal

Daniel González B. Ma. Bernarda Hormazabal El desafío de la implementación de Programas de Desarrollo de Habilidades Informacionales en las Universidades: Una mirada desde la Universidad Católica del Maule Daniel González B. Ma. Bernarda Hormazabal

Más detalles

PROYECTO ACREDITACION NAVAL-ABET

PROYECTO ACREDITACION NAVAL-ABET Orden del día: 1. Aprobación actas 30 de enero y 11 de marzo del 2009 2. Convenio alianza Francesa por Maestría Lictur 3. Plan Estretégico-Versión 2 4. Solicitud Ing. Jaime Guerrero 5. Solicitudes 6. Varios

Más detalles

DESAGREGACIÓN DEL PERFIL PROFESIONAL PEDAGOGÍA EN EDUCACIÓN BÁSICA SAN FELIPE

DESAGREGACIÓN DEL PERFIL PROFESIONAL PEDAGOGÍA EN EDUCACIÓN BÁSICA SAN FELIPE DESAGREGACIÓN DEL PERFIL PROFESIONAL PEDAGOGÍA EN EDUCACIÓN BÁSICA SAN FELIPE A.- PERFIL INICIAL B.- PERFIL INTERMEDIO C.- PERFIL DE SÍNTESIS D.- PERFIL DE LA LICENCIATURA VALPARAÍSO, ENERO 2014 A.- DESCRIPTOR

Más detalles

MASTER EN BIOTECNOLOGÍA AGROFORESTAL UNIVERSIDAD POLITÉCNICA DE MADRID

MASTER EN BIOTECNOLOGÍA AGROFORESTAL UNIVERSIDAD POLITÉCNICA DE MADRID LA RESPUESTA DE LA UPM A LOS NUEVOS RETOS DE LA FORMACIÓN DE INVESTIGADORES Y PROFESIONALES DE LOS SECTORES BIOTECNOLÓGICO, AGRÍCOLA Y FORESTAL INICIO DEL NUEVO PROGRAMA DEL MASTER: CURSO 2015-2016* (*Pendiente

Más detalles

UNIVERSIDAD AUTONOMA DE TAMAULIPAS

UNIVERSIDAD AUTONOMA DE TAMAULIPAS UNIVERSIDAD AUTONOMA DE TAMAULIPAS QUIMICO FARMACEUTICO BIOLOGO PLAN DE ESTUDIOS Cd. Victoria Tamaulipas Febrero de 2003 UNIVERSIDAD AUTONOMA DE TAMAULIPAS I. NOMBRE DE LA CARRERA. Químico Farmacéutico

Más detalles

MAESTRÍA EN FUENTES RENOVABLES DE ENERGÍA Y EFICIENCIA ENERGÉTICA

MAESTRÍA EN FUENTES RENOVABLES DE ENERGÍA Y EFICIENCIA ENERGÉTICA Universidad Autónoma de la Ciudad de México Nada humano me es ajeno MAESTRÍA EN FUENTES RENOVABLES DE ENERGÍA Y EFICIENCIA ENERGÉTICA Programa Académico PLAN DE ESTUDIOS UNIVERSIDAD AUTÓNOMA DE LA CIUDAD

Más detalles

MÁSTERES OFICIALES Tasa de Rendimiento

MÁSTERES OFICIALES Tasa de Rendimiento Escuela Politécnica Superior Máster Universitario en Ingeniería Informática y de Telecomunicación 80,70% 69,71% Facultad de Ciencias Máster Universitario en Antropología Física: Evolución y Biodiversidad

Más detalles

FACULTAD DE CIENCIA E INGENIERÍA EN ALIMENTOS LÍNEAS DE INVESTIGACIÓN DE LA MAESTRIA EN BIOTECNOLOGÍA

FACULTAD DE CIENCIA E INGENIERÍA EN ALIMENTOS LÍNEAS DE INVESTIGACIÓN DE LA MAESTRIA EN BIOTECNOLOGÍA FACULTAD DE CIENCIA E INGENIERÍA EN ALIMENTOS LÍNEAS DE INVESTIGACIÓN DE LA MAESTRIA EN BIOTECNOLOGÍA Línea de investigación 1. Determinación de la diversidad biológica y metabólica de bacterias presentes

Más detalles

I. REGLAMENTO TITULO I DISPOSICIONES GENERALES TITULO II DE LOS OBJETIVOS TITULO III DE LA ORGANIZACION DE LOS ESTUDIOS

I. REGLAMENTO TITULO I DISPOSICIONES GENERALES TITULO II DE LOS OBJETIVOS TITULO III DE LA ORGANIZACION DE LOS ESTUDIOS 19 REGLAMENTO ESPECIFICO Y PLAN DE ESTUDIOS DE LA LICENCIATURA EN CIENCIAS FARMACEUTICAS Y DEL TITULO PROFESIONAL DE QUIMICO FARMACEUTICO DE LA FACULTAD DE CIENCIAS QUIMICAS Y FARMACEUTICAS Decreto Universitario

Más detalles

Documento Orientativo Reconversión a Bachiller con Orientación en Arte- Música. Perfiles Docentes

Documento Orientativo Reconversión a Bachiller con Orientación en Arte- Música. Perfiles Docentes Documento Orientativo Reconversión a Bachiller con Orientación en Arte- Música Perfiles Docentes DIRECCIÓN DE EDUCACIÓN SECUNDARIA JUNTA DE CLASIFICACIÓN DE EDUCACIÓN SECUNDARIA AÑO 2014 PARA EL CICLO

Más detalles

Postgrados del Área de Ciencias de la Salud al cual pueden optar los Lic. en Bioanálisis

Postgrados del Área de Ciencias de la Salud al cual pueden optar los Lic. en Bioanálisis Postgrados del Área de Ciencias de la Salud al cual pueden optar los Lic. en Bioanálisis UNIVERSIDAD CENTRAL DE VENEZUELA (UCV) (Actualizado el 02-11-2013) Epidemiología http://www.postgrado.ucv.ve/curso/curso.asp?id=med3018

Más detalles

CURSO DE GENÓMICA NUTRICIONAL Y NUTRICIÓN PERSONALIZADA

CURSO DE GENÓMICA NUTRICIONAL Y NUTRICIÓN PERSONALIZADA CURSO DE GENÓMICA NUTRICIONAL Y NUTRICIÓN PERSONALIZADA Organizado por Instituto IMDEA ALIMENTACIÓN MADRID, 5-7 de Febrero de 2014 Presentación y Objetivos El Instituto Madrileño de Estudios Avanzados

Más detalles

MAGÍSTER INGENIERÍA BIOQUÍMICA EN CIENCIAS DE LA INGENIERÍA CON MENCIÓN EN

MAGÍSTER INGENIERÍA BIOQUÍMICA EN CIENCIAS DE LA INGENIERÍA CON MENCIÓN EN MAGÍSTER EN CIENCIAS DE LA INGENIERÍA CON MENCIÓN EN INGENIERÍA BIOQUÍMICA ACREDITADO 5 AÑOS Desde 11/09/2013 hasta 11/09/2018 Magíster en ciencias de la Ingeniería con Mención Ingeniería Bioquímica. Escuela

Más detalles

GRADO EN BIOLOGÍA. Facultad de Ciencias- Edificio de Biología C/ Darwin, 2 Campus de Cantoblanco 28049 Madrid Teléfono: 914978264 Página Web

GRADO EN BIOLOGÍA. Facultad de Ciencias- Edificio de Biología C/ Darwin, 2 Campus de Cantoblanco 28049 Madrid Teléfono: 914978264 Página Web CURSO ACADÉMICO 2009/2010 GRADO EN BIOLOGÍA Estudios Grado en Biología (En el presente año académico solamente se ofertará el primer curso). Rama de conocimiento Centro Ciencias Facultad de Ciencias- Edificio

Más detalles

Maestría en Proyectos de Arquitectura y Urbanismo

Maestría en Proyectos de Arquitectura y Urbanismo Maestría en Proyectos de Arquitectura y Urbanismo CEPES CENTRO PANAMERICANO DE ESTUDIOS SUPERIORES Presentación El área de Proyectos en la actualidad ha tomado un fuerte protagonismo en el desarrollo profesional

Más detalles

- Vocación - Conciencia social - Espíritu de servicio

- Vocación - Conciencia social - Espíritu de servicio OBJETIVO Formar Licenciados en Enfermería competentes en el cuidado de la salud y la promoción del autocuidado, en todas las etapas de la vida de la persona, familia, grupos y comunidad, a través del proceso

Más detalles

MAESTRÍA Y DOCTORADO EN CIENCIAS CON OPCIONES EN FÍSICA NO LINEAL Y CIENCIAS NUCLEARES

MAESTRÍA Y DOCTORADO EN CIENCIAS CON OPCIONES EN FÍSICA NO LINEAL Y CIENCIAS NUCLEARES MAESTRÍA Y DOCTORADO EN CIENCIAS CON OPCIONES EN FÍSICA NO LINEAL Y CIENCIAS NUCLEARES Programa interinstitucional Facultad de Ciencias Programas de Posgrado de 2007 Instituto Nacional de Investigaciones

Más detalles

MAESTRÍA EN CIENCIAS BIOMÉDICAS PLAN 2005

MAESTRÍA EN CIENCIAS BIOMÉDICAS PLAN 2005 MAESTRÍA EN CIENCIAS BIOMÉDICAS PLAN 2005 ÁREAS: BIOÉTICA ENFERMERÍA OPTOMETRÍA REHABILITACIÓN BUCAL SALUD OCUPACIONAL Descripción: El Centro de Ciencias Biomédicas ofrece la Maestría en Ciencias Biomédicas

Más detalles

Capacidad para relacionar el valor de los recursos naturales y promover su uso sustentable de acuerdo a las necesidades de la región.

Capacidad para relacionar el valor de los recursos naturales y promover su uso sustentable de acuerdo a las necesidades de la región. Nombre de la asignatura: Biología Ambiental Créditos: 2 4-6 Aportación al perfil Capacidad para relacionar el valor de los recursos naturales y promover su uso sustentable de acuerdo a las necesidades

Más detalles

Maestría en Prevención y Riesgos Laborales

Maestría en Prevención y Riesgos Laborales Maestría en Prevención y Riesgos Laborales CEPES CENTRO PANAMERICANO DE ESTUDIOS SUPERIORES Presentación Es incuestionable que toda actividad laboral lleva implícito un riesgo para los trabajadores. Esta

Más detalles

Para concurrir a esta convocatoria los candidatos deberán reunir los siguientes requisitos:

Para concurrir a esta convocatoria los candidatos deberán reunir los siguientes requisitos: CONVOCATORIA PARA LA CONTRATACIÓN, CON CARÁCTER TEMPORAL, DE PERSONAL LABORAL PARA OBRA O SERVICIO DETERMINADO CON CARGO A CAPÍTULO DISTINTO DEL CAPÍTULO I DEL PRESUPUESTO, EN EL SERVICIO GENERAL DE INVESTIGACIÓN

Más detalles

10. La evaluación de las solicitudes se realizará del 15 al 17 de julio de 2013. 11. Los resultados se darán a conocer el día 18 de julio de 2013

10. La evaluación de las solicitudes se realizará del 15 al 17 de julio de 2013. 11. Los resultados se darán a conocer el día 18 de julio de 2013 UNIVERSIDAD AUTÓNOMA DE SAN LUIS POTOSÍ De conformidad con el Artículo 90 del contrato Colectivo de las condiciones gremiales del Personal Académico de la Universidad Autónoma de San Luis Potosí, se expide

Más detalles

1. Área Propedéutica. Considera la formación básica y general de los conocimientos que han de adquirir los alumnos al iniciar la licenciatura.

1. Área Propedéutica. Considera la formación básica y general de los conocimientos que han de adquirir los alumnos al iniciar la licenciatura. PLAN DE ESTUDIOS (SISTEMA ESCOLARIZADO) Tiene por objetivo formar profesionales capacitados para entender los fenómenos mundiales, esto a través de una enseñanza multidisciplinaria que fomente su capacidad

Más detalles

Programa de especialización en gerencia y dietética institucional. Curso virtual: Planificación de menús institucionales

Programa de especialización en gerencia y dietética institucional. Curso virtual: Planificación de menús institucionales Curso virtual: Planificación de menús institucionales A. INTRODUCCIÓN Reconociendo la importancia de los servicios de alimentación institucional y la labor de los profesionales en la administración y gerencia

Más detalles

Modelo de negocio. Equipo Humano

Modelo de negocio. Equipo Humano Dossier 2015 Acerca de Neuron Bio Neuron Bio (NEU.MC) desarrolla y gestiona biosoluciones y proyectos en el campo de la biotecnología para su aplicación en la industria farmacéutica y oleoquímica, a través

Más detalles

II Encuentro de Experiencias Docentes en Educación Superior. Albacete, 22 de Enero de 2015 Pablo Durán-Barroso Juana Arias-Trujillo

II Encuentro de Experiencias Docentes en Educación Superior. Albacete, 22 de Enero de 2015 Pablo Durán-Barroso Juana Arias-Trujillo II Encuentro de Experiencias Docentes en Educación Superior. Albacete, 22 de Enero de 2015 Pablo Durán-Barroso Juana Arias-Trujillo Departamento de Construcción. Escuela Politécnica de Cáceres. Universidad

Más detalles

GUÍA DOCENTE. Curso 2012-2013. Doble Grado: Calidad en procesos biotecnológicos. Biología Molecular e Ingeniería Química Año académico: 2012-13

GUÍA DOCENTE. Curso 2012-2013. Doble Grado: Calidad en procesos biotecnológicos. Biología Molecular e Ingeniería Química Año académico: 2012-13 1. DESCRIPCIÓN DE LA ASIGNATURA Grado: Biotecnología Doble Grado: Asignatura: Calidad en procesos biotecnológicos Módulo: 10. OPTATIVIDAD Departamento: Biología Molecular e Ingeniería Química Año académico:

Más detalles

El graduado del Programa de Magíster en Biotecnología (PMB-UA), tendrá capacidad para:

El graduado del Programa de Magíster en Biotecnología (PMB-UA), tendrá capacidad para: La biotecnología se define como la utilización industrial de los seres vivos o de componentes derivados de estos organismos, con fines sociales y/o empresariales. Sus aplicaciones prácticas son antiguas,

Más detalles