Técnica de CGH-array. María Rodríguez-Rivera

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Técnica de CGH-array. María Rodríguez-Rivera"

Transcripción

1 Técnica de CGH-array María Rodríguez-Rivera Laboratori de Citogenètica Molecular. Servei de Patologia. Hospital del Mar. Programa de Càncer-IMIM. Barcelona

2 Índice Introducción a los microarrays Arrays genómicos Condiciones del ADN Técnica de CGH-array Aplicaciones

3 Introducción Qué es un microarray? Tipos de microarrays

4 Introducción Qué es un microarray? Tipos de microarrays

5 Introducción: Qué es un microarray? Mikro (del griego,pequeño) y array (del inglés,distribución ordenada) Colección de biomoléculas ordenadas en filas y columnas sobre un soporte sólido miniaturizado.

6 Introducción Que es un microarray? Tipos de microarrays

7 Introducción: Tipos de microarrays Tejido (TMA) Proteínas Células Genómicos Expresión mirna Metilación

8 Introducción: Tipos de microarrays Tejido (TMA) Proteínas Células Genómicos Expresión mirna Metilación

9 Microarrays genómicos

10 Microarrays genómicos Colección de sondas de ADN dispuestas sobre un soporte sólido que permiten detectar alteraciones en el genoma Tipos de microarrays genómicos: Arrays de CGH (Comparative Genome Hybridization) Arrays de SNP (Single Nucleotide Polymorphism)

11 Microarrays genómicos Colección de sondas de ADN dispuestas sobre un soporte sólido que permiten detectar alteraciones en el genoma. Tipos de microarrays genómicos: Arrays de CGH (Comparative Genome Hybridization) Arrays de SNP (Single Nucleotide Polymorphism)

12 Array de BACs: Microarrays genómicos: Arrays de CGH - BAC: Bacterial Artificial Chromosome - Puede ser casero - Perkin Elmer TM, BlueGnome TM Array de oligos comerciales: - Oligonucleótido: secuencias pequeñas de ADN 50pb - Agilent Technologies TM, NimbleGen (Roche TM ), BlueGnome TM - Diferentes formatos - Microarrays prefabricados o custom

13 Microarrays genómicos: Arrays de CGH Estudio de hibridación comparativa (ADN tumoral vs ADN control) que permite detectar ganancias y/o pérdidas de material genético Microarrays de CGH

14 Microarrays genómicos Colección de sondas de ADN dispuestas sobre un soporte sólido que permiten detectar alteraciones en el genoma. Tipos de microarrays genómicos: Arrays de CGH (Comparative Genome Hybridization) Arrays de SNP (Single Nucleotide Polymorphism)

15 Microarrays genómicos: Arrays de SNPs Contiene además sondas de oligonucleótidos correspondientes a variantes alélicas de SNPs seleccionados (oligoarray). SNP ( Single nucleotide polymorphism ): - Variación de la secuencia de ADN que afecta a una sola base - 1 SNP cada 1000 bases

16 Microarrays genómicos: Arrays de SNPs Permite obtener el número de copias de ADN y el genotipo (señal de fluorescencia para cada alelo) Hibridación no competitiva: - La muestra problema y control (si disponible) se hibridan en arrays independientes - Posterior comparación de resultados Microarrays de SNP

17 Microarrays genómicos: Arrays de SNPs Pérdida de heterocigosidad sin cambio en el número de copias (CNN-LOH) Importancia en genes supresores de tumores: mutación heterocigota mutación homocigota

18 Genes supresores de tumores: p53 Mutación p53 Proliferación células anormales

19 CGH vs SNP CGH SNP Hibridación competitiva Hibridación no competitiva Muestra y control en un mismo array Muestra y control se hibridan por separado Ganancias y pérdidas Ganancias y pérdidas LOH

20 CGH y SNP:Limitaciones No detecta alteraciones equilibradas No detecta diferentes clones >30% células tumorales

21 Protocolo técnico arrays CGH

22 Microarrays genómicos: ADN ADN: Sangre periférica o médula ósea Separación de poblaciones celulares (microbeads) Tejido en fresco Tejido congelado (OCT) Micro-Macrodisección del tumor Parafina Micro-Macrodisección del tumor

23 ADN: Tipos de extracción Extracción automatizada Extracción manual Kits columnas Kit manual

24 ADN: Tipos de extracción Extracción automatizada Extracción manual Kits columnas Kit manual

25 Preparación ADN Marcaje Hibridación Lavados y secado Escaneado Análisis de datos

26 ADN: Criterios de calidad Cantidad ADN: 500ng Calidad ADN: Espectofotómetro

27 ADN: Criterios de calidad Espectofotómetro: NanoDrop 1000 Ratio ADN/ARN (A260/280) > 1.80 Ratio ADN/alcoholes, fenoles (A260/230) > 1.80 Concentración

28 ADN: Criterios de calidad Integridad ADN ADN no degradado ADN degradado (smear)

29 Preparación ADN Marcaje Hibridación Lavados y secado Escaneado Análisis de datos

30 Marcaje del ADN ADN tumoral ADN control Desnaturalización Marcaje Cy5 -dutp Cy3 -dutp

31 Marcaje aleatorio (Random Priming) Marcaje del ADN

32 Marcaje aleatorio (Random Priming) Marcaje del ADN

33 Marcaje aleatorio (Random Priming) Marcaje del ADN

34 Marcaje aleatorio (Random Priming) Marcaje del ADN

35 Hibridación Preparación del array e hibridación (muestra y control) Muestra (Cy5) Hibridación Control (Cy3)

36 Hibridación: Preparación del array Unimos el mixer con el array

37 Pipeteamos la muestra dentro del mixer Hibridación

38 Hibridación Horneado 48-72h

39 Preparación ADN Marcaje Hibridación Lavados y secado Escaneado Análisis de datos

40 Lavados y secado Lavados de astringencia Secado

41 Preparación ADN Marcaje Hibridación Lavados y secado Escaneado Análisis de datos

42 Plataforma MS200 NimbleGen, ROCHE TM Escaneado del array

43 Preparación ADN Marcaje Hibridación Lavados y secado Escaneado Análisis de datos

44 Visualización de datos Se obtiene una imagen con la lectura de los dos fluorocromos (Cy3 y Cy5) Se genera un archivo por cada fluorocromo para poder analizar en forma de datos

45 Análisis ADN tumoral > ADN control Ganancia ADN tumoral < ADN control Pérdida ADN tumoral = ADN control Normal

46 Análisis de datos Software para la visualización de los datos Análisis paralelo con tablas de datos

47 Análisis de datos Software para la visualización de los datos Análisis paralelo con tablas de datos

48 Análisis de datos: Principios Sonda Cromosoma Ideograma Cariotipo molecular

49 Análisis visual: Ejemplos DEVA

50 Análisis visual: Ejemplos Nexus

51 Análisis visual: Ejemplos Ganancia Pérdida Nexus

52 Análisis de datos Software para la visualización de los datos Análisis paralelo con tablas de datos

53 Nº sondas: > 5 Log2 Ratio: < (Pérdidas) > 0.2 (Ganancias) Análisis datos: Ejemplos

54 Aplicaciones arrays genómicos

55 Aplicaciones arrays genómicos Oncohematología Diagnóstico Pronóstico Investigación Post-natal y Pre-natal Síndromes asociados a ganancias/pérdidas de material genético: Deleciones: ej síndrome de Cri-du-chat (5p-) Aneuploidias: +21 (Sd.Down), +13 (Sd.Patau), +18 (Sd.Edwards), +X/Y (Sd.Turner, ) Alteraciones en genes asociados a retraso mental y autismo Nuevos síndromes

56 Aplicaciones arrays genómicos: Ejemplos Estudio de carcinomas de células renales (CCR) mediante arrays de CGH y cariotipo N=24 16 CCR de células claras 5 CCR papilares 2 CCR cromófobos 1 Oncocitoma Tejido fresco: Estudio citogenético Extracción ADN Poster SEAP M.Salido

57 CCR-CC: Citogenética 45,X,add(X)(p28),der(1)t(1;1)(p36;q12),del(3)(p14),-14

58 CCR-CC: CGH-arrays

59 CCR-CC: CG vs CGH-arrays

60 Resumen Buena herramienta complementaria Diferentes formatos Limitaciones Coste cada vez menor

61

62 Agradecimientos: Dra.Blanca Espinet Dra.Marta Salido Dra.Anna Puiggros Carme Melero Dra.Silvia de Muga Dra.Nuria Juanpere Dr.Josep Lloreta Dr.Josep Mª Corominas Prof.Sergi Serrano Agradecimientos: Laboratori de Citogenètica Molecular. Servei de Patologia. Hospital del Mar. Programa de Càncer- IMIM. Barcelona

Marta Hergueta Redondo Dic. -2005

Marta Hergueta Redondo Dic. -2005 Perfil de expresión genética en el carcinoma no microcítico de pulmón: utilidad de las biopsias endoscópicas, correlación con la histología y predicción pronóstica en pacientes operables. FIS 04/2641 Marta

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

Bases moleculares y estudios genéticos

Bases moleculares y estudios genéticos II Jornada Genética Clínica para Médicos de Familia Bases moleculares y estudios genéticos María García-Barcina Unidad de Genética del H. Universitario de Basurto Osakidetza Sede SVMFIC Valencia, 2 de

Más detalles

DIAGNÓSTICO PRENATAL: DEL MICROSCOPIO A LAS PLATAFORMAS DE ALTO RENDIMIENTO

DIAGNÓSTICO PRENATAL: DEL MICROSCOPIO A LAS PLATAFORMAS DE ALTO RENDIMIENTO DIAGNÓSTICO PRENATAL: DEL MICROSCOPIO A LAS PLATAFORMAS DE ALTO RENDIMIENTO María Orera U. de Genética HGU Gregorio Marañón CGCGenetics-CircaGen Oviedo 13 4 2011 cronograma 1966: STEELE: Estudio cromosómico

Más detalles

Tests ofrecidos por los PCMA. Anáálisis Prenatal de Microarray Cromosóómico. Baylor fue uno de los primeros laboratorios

Tests ofrecidos por los PCMA. Anáálisis Prenatal de Microarray Cromosóómico. Baylor fue uno de los primeros laboratorios Tests ofrecidos por los laboratorios de genética médica PCMA Anáálisis Prenatal de Microarray Cromosóómico Baylor fue uno de los primeros laboratorios en ofrecer servicios de microarray cromosómicos, y

Más detalles

Enfermedades genéticas

Enfermedades genéticas Enfermedades genéticas Desórdenes genéticos Mutaciones Rearreglos genómicos Variación en número de cromosomas Monogenéticas, heredables en forma mendeliana. Enfermedades genéticas Poligenéticas o complejas,

Más detalles

Congreso Nacional del Laboratorio Clínico 2014

Congreso Nacional del Laboratorio Clínico 2014 Técnicas de Citogenética en diagnóstico prenatal: cariotipo, FISH, QF-PCR y arrays CGH. Cristina Torreira Análisis Clínicos Xerencia de Xestión Integrada de Vigo Comisión de Genética de la SEQC Índice

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Historia. Hibridación in situ Fluorescente

Historia. Hibridación in situ Fluorescente Fluorescent in situ Hybridization Historia Hibridación in situ Desarrollada por Pardue & Gall (1969) -Muy pocas secuencias de DNA disponibles -Radioisótopos Alto entrenamiento Seguridad Tiempo Hibridación

Más detalles

Consenso para la Implementación de los Arrays [CGH y SNP-arrays] en la Genética Clínica

Consenso para la Implementación de los Arrays [CGH y SNP-arrays] en la Genética Clínica Consenso para la Implementación de los Arrays [CGH y SNP-arrays] en la Genética Clínica 2012 del contenido: Instituto Roche. Eucalipto, 33. 28016-Madrid www.institutoroche.es 2012 de esta edición: Drug

Más detalles

RECOMENDACIONES. 1. Criterios técnicos

RECOMENDACIONES. 1. Criterios técnicos RECOMENDACIONES sobre el uso Clínico de los arrays-cgh Dentro del contexto de esta guía, que está dirigida a la implantación de los arrays-cgh para su aplicación clínica en el diagnóstico genético, se

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

CONSENTIMIENTO INFORMADO PARA ANÁLISIS PRENATAL NO INVASIVO DE TRISOMÍAS FETALES

CONSENTIMIENTO INFORMADO PARA ANÁLISIS PRENATAL NO INVASIVO DE TRISOMÍAS FETALES Ejemplar para el Solicitante CONSENTIMIENTO INFORMADO PARA ANÁLISIS PRENATAL NO INVASIVO DE TRISOMÍAS FETALES Propósito El análisis prenatal no invasivo analiza ADN fetal libre, circulante en la sangre

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

INACTIVACIÓN DE LOS GENES SUPRESORES PTEN, DMBT1 Y P16 EN GLIOBLASTOMA MULTIFORME, ASTROCITOMAS ANAPLÁSICOS Y ASTROCITOMAS DE BAJO GRADO.

INACTIVACIÓN DE LOS GENES SUPRESORES PTEN, DMBT1 Y P16 EN GLIOBLASTOMA MULTIFORME, ASTROCITOMAS ANAPLÁSICOS Y ASTROCITOMAS DE BAJO GRADO. IV CONGRESO VIRTUAL HISPANO AMERICANO DE ANATOMÍA PATOLÓGICA Abstract PDF CONTENIDO Comentarios Título Resumen Introducción Material Resultados Conclusiones Imágenes INACTIVACIÓN DE LOS GENES SUPRESORES

Más detalles

Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas.

Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas. Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas. El análisis cromosómico ha proporcionado un conocimiento básico de los cambios genéticos responsables de las

Más detalles

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07 PCR A TIEMPO REAL María Maiques R4-Bioquímica Clínica 25-Abril-07 VEAMOS Herramientas para detectar mutaciones Moléculas fluorescentes y tecnología FRET PCR a tiempo real: equipos y métodos de detección

Más detalles

Anillamiento Asociación de dos cadenas de ácido nucleico (ADN o ARN) complementarias para formar una doble hélice.

Anillamiento Asociación de dos cadenas de ácido nucleico (ADN o ARN) complementarias para formar una doble hélice. GLOSARIO DE PATOLOGÍA MOLECULAR ADNc (ADN complementario) ADN sintetizado por el enzima transcriptasa inversa usando el ARNm (ARN mensajero) como molde, ya sea experimentalmente o in vivo. El producto

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Tipos de mapas: MAPAS FISICOS (de restricción, citogenéticos, de híbridos de radiación...)

Más detalles

IMPACTO CLINICO DE LA INMUNOFENOTIPIFICION CELULAR IV: Ciclo celular en estados neoplásicos y preneoplásicos. T.M. MSC JUAN LUIS CASTILLO N.

IMPACTO CLINICO DE LA INMUNOFENOTIPIFICION CELULAR IV: Ciclo celular en estados neoplásicos y preneoplásicos. T.M. MSC JUAN LUIS CASTILLO N. IMPACTO CLINICO DE LA INMUNOFENOTIPIFICION CELULAR IV: Ciclo celular en estados neoplásicos y preneoplásicos. T.M. MSC JUAN LUIS CASTILLO N. Centro de Diagnóstico Onco-inmunológicoLtda. Laboratorio de

Más detalles

CATÁLOGO DE SERVICIOS PRUEBAS DE APOYO AL DIAGNÓSTICO

CATÁLOGO DE SERVICIOS PRUEBAS DE APOYO AL DIAGNÓSTICO CATÁLOGO DE SERVICIOS PRUEBAS DE APOYO AL DIAGNÓSTICO CENTRO NACIONAL DE INVESTIGACIONES ONCOLÓGICAS Melchor Fernández Almagro, 3, 28929 MADRID Tlf. +34 912246900; www.cnio.es ÍNDICE Identificación mutaciones

Más detalles

Qué sucede en un laboratorio de genética?

Qué sucede en un laboratorio de genética? 12 Algunas personas han expresado su preocupación sobre la posibilidad de que la policía acceda a su ADN. Esto es un hecho extremadamente raro. Si se diera este caso, esto sería posible (como con cualquier

Más detalles

Simposio SEAP Marcadores Moleculares Emergentes y Su Potencial Utilidad Clínica

Simposio SEAP Marcadores Moleculares Emergentes y Su Potencial Utilidad Clínica Simposio SEAP Marcadores Moleculares Emergentes y Su Potencial Utilidad Clínica Fausto J. Rodríguez M.D. Profesor Asistente Departamento de Patología Clínica Mayo Rochester, MN Resumen Nuevas Tecnologías

Más detalles

Detección de Mutaciones. y diagnóstico prenatal. Curso de Genética Molecular. Ciencias Biológicas. Universidad de Jaén

Detección de Mutaciones. y diagnóstico prenatal. Curso de Genética Molecular. Ciencias Biológicas. Universidad de Jaén Detección de Mutaciones y diagnóstico prenatal Curso de Genética Molecular Ciencias Biológicas Universidad de Jaén Detección de mutaciones: Objetivos Detección de enfermedades hereditarias Detección de

Más detalles

CARACTERIZACIÓN DE ANOMALÍAS CROMOSÓMICAS EN DIAGNÓSTICO PRENATAL Y POSTNATAL MEDIANTE TÉCNICAS DE CITOGENÉTICA MOLECULAR

CARACTERIZACIÓN DE ANOMALÍAS CROMOSÓMICAS EN DIAGNÓSTICO PRENATAL Y POSTNATAL MEDIANTE TÉCNICAS DE CITOGENÉTICA MOLECULAR CARACTERIZACIÓN DE ANOMALÍAS CROMOSÓMICAS EN DIAGNÓSTICO PRENATAL Y POSTNATAL MEDIANTE TÉCNICAS DE CITOGENÉTICA MOLECULAR Cristina Hernando Davalillo Tesis doctoral - 2005 Índice 1 INTRODUCCIÓN 3 1.1 TÉCNICAS

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Técnicas de hibridación Concepto, modalidades y tipos de sondas Aplicaciones principales. Federico Rojo Fundación Jiménez Díaz

Técnicas de hibridación Concepto, modalidades y tipos de sondas Aplicaciones principales. Federico Rojo Fundación Jiménez Díaz Técnicas de hibridación Concepto, modalidades y tipos de sondas Aplicaciones principales Federico Rojo Fundación Jiménez Díaz Guión de la presentación Alteraciones estructurales del DNA y cáncer Hibridación

Más detalles

Los retos de las nuevas tecnologías. Eduardo Tizzano Hospital Sant Pau Barcelona y CIBERER U-705

Los retos de las nuevas tecnologías. Eduardo Tizzano Hospital Sant Pau Barcelona y CIBERER U-705 Avances en genética y discapacidad: Los retos de las nuevas tecnologías Eduardo Tizzano Hospital Sant Pau Barcela y CIBERER U-705 Investigación en enfermedades genéticas Investigación básica: en general

Más detalles

Retraso Mental y genética

Retraso Mental y genética Retraso Mental y genética Dra. Teresa Aravena Cerda Especialista en genética clínica INTA, Universidad de Chile Hospital Clínico de la Universidad de Chile Clínica INDISA Prevalencia RDSM o DI: 1 a 3 %

Más detalles

Plataforma de Genómica

Plataforma de Genómica Plataforma de Genómica Dr. Víctor J. Asensio Técnico de Plataforma 27 de febrero de 2015 La Plataforma de Genómica del IdisPa está ubicada en el Hospital Universitario Son Espases; consta de dos salas

Más detalles

BioSeq 739 Servicio de ayuda al diagnóstico oncológico

BioSeq 739 Servicio de ayuda al diagnóstico oncológico BioSeq 739 Servicio de ayuda al diagnóstico oncológico Análisis Genómico Tumoral por Secuenciación Masiva PPBSA CP13 060312 Información sobre el servicio de BioSeq 739 La mayoría de tipos de cáncer se

Más detalles

Catálogo de Servicios GenXPro

Catálogo de Servicios GenXPro Catálogo de Servicios GenXPro Aplicando las mejores y más sensibles técnicas de preparación de muestras, en combinación con las técnicas más modernas de secuenciación de última generación, GenXPro ofrece

Más detalles

Del microscopio al chip: Cariotipo Molecular

Del microscopio al chip: Cariotipo Molecular Del microscopio al chip: Cariotipo Molecular TM. KREN ESPINOZ SVEDR Centro de Genética y Genómica Facultad de Medicina Clínica lemana Universidad del Desarrollo Esquema de la presentación 1. De citogenética

Más detalles

Citogenetica. Cariotipo. Aspectos Tecnicos de Citogenetica Convencional y Molecular en Leucemias Agudas. Citogenetica. Anormalidades Cromosomicas

Citogenetica. Cariotipo. Aspectos Tecnicos de Citogenetica Convencional y Molecular en Leucemias Agudas. Citogenetica. Anormalidades Cromosomicas Lectura Especial- Aspectos Tecnicos de Citogenetica Convencional y Molecular en Leucemias Agudas Part 1 of 3 Lectura Especial- Citogenetica Susana C.,, PhD 1 Susana C.,, PhD Directora, Laboratorio de Cytogeneticas

Más detalles

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales página 2 Objetivo del Curso El objetivo del «Curso de Técnicas Experimentales en Investigación Biomédica» es proporcionar a los asistentes unas nociones básicas sobre las metodologías y tecnología habitualmente

Más detalles

HOSPITAL CLÍNIC-IDIBAPS RED NACIONAL DE CENTROS DE CÁNCER PROGRAMA DE GENÓMICA Y PROTEÓMICA

HOSPITAL CLÍNIC-IDIBAPS RED NACIONAL DE CENTROS DE CÁNCER PROGRAMA DE GENÓMICA Y PROTEÓMICA HOSPITAL CLÍNIC-IDIBAPS RED NACIONAL DE CENTROS DE CÁNCER PROGRAMA DE GENÓMICA Y PROTEÓMICA CATÁLOGO DE OFERTA DE SERVICIOS GENÓMICOS I. INFORMACIÓN GENERAL: NOMBRE DE UNIDAD: Unidad de Genómica CENTRO

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R.

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R. República Bolivariana de Venezuela U. E. Colegio Cruz Vitale É Prof. Francisco Herrera R. LA GENÉTICA es la ciencia que estudia los genes, la herencia, la variación de los organismos. El término Genética

Más detalles

GENÉTICA MENDELIANA EL GEN. El gen Mendeliano es una unidad de función, estructura, transmisión, mutación y evolución, que se distribuye ordenada y linealmente en los cromosomas. A nivel genético el gen

Más detalles

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares MSc. Juan Agapito Panta Laboratorio de Genómica y Biología Molecular Instituto Peruano de Energía Nuclear

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

Aproximación práctica al estudio del KRAS y otros biomarcadores. Javier Hernández Losa. 23-Mayo-2013

Aproximación práctica al estudio del KRAS y otros biomarcadores. Javier Hernández Losa. 23-Mayo-2013 Aproximación práctica al estudio del KRAS y otros biomarcadores Javier Hernández Losa. 23-Mayo-2013 Fase Pre-analítica: Selección del material Evaluación, gestión y rentabiliad de la muestra S09-23447

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

Paralelismo entre cromosomas y la teoria de Mendel

Paralelismo entre cromosomas y la teoria de Mendel Paralelismo entre cromosomas y la teoria de Mendel Cromosomas sexuales Autosomas Herencia ligada al sexo Cromosomas heteromorfos Nettie Stevens, 1909 Estudios en Drosophila, mosca del vinagre Thomas Hunt

Más detalles

Instituto de Medicina Genómica

Instituto de Medicina Genómica Instituto de Medicina Genómica PRESENTACIÓN CORPORATIVA 2013 Qúe nos hace singulares? www.imegen.es Instituto de Medicina Genómica, S.L. Todos los derechos rservados EMPRESA Fundada en 2009 15 años de

Más detalles

CÁNCER DE MAMA. Modelo de aplicación de la genética y biología molecular. Dr. Abelardo Arias Velásquez

CÁNCER DE MAMA. Modelo de aplicación de la genética y biología molecular. Dr. Abelardo Arias Velásquez V SIMPOSIO ANDINO DE LABORATORIO Y MEDICINA CÁNCER DE MAMA Modelo de aplicación de la genética y biología molecular Dr. Abelardo Arias Velásquez Jefe de la Unidad de Genética y Biología Molecular Instituto

Más detalles

Citogenética Básica. Tinción de las preparaciones cromosómicas para detectar los posibles cambios numéricos y estructurales.

Citogenética Básica. Tinción de las preparaciones cromosómicas para detectar los posibles cambios numéricos y estructurales. Citogenética Básica Qué son los Cromosomas? La citogenética es el estudio de los cromosomas y las enfermedades relacionadas, causadas por un número y/o estructura anormales de los cromosomas. Los cromosomas

Más detalles

Western Blot. Western Blot

Western Blot. Western Blot Western Blot Western Blot Inmunométodo para la detección de proteínas específicas en un soporte sólido. Preparación de la muestra (dosaje de proteínas totales) Electroforesis en gel de poliacrilamida Transferencia

Más detalles

Biomarcadores para Uso Clínico. Informe de Vigilancia Tecnológica

Biomarcadores para Uso Clínico. Informe de Vigilancia Tecnológica Biomarcadores para Uso Clínico Informe de Vigilancia Tecnológica Biomarcadores para Uso Clínico Informe de Vigilancia Tecnológica Biomarcadores para Uso Clínico El presente informe de Vigilancia Tecnológica

Más detalles

Perfiles de expresión génica y diagnóstico/pronóstico en cáncer. Introducción 6/1/2010. Meritxell Pelicano Esqueta. Genómica y proteómica

Perfiles de expresión génica y diagnóstico/pronóstico en cáncer. Introducción 6/1/2010. Meritxell Pelicano Esqueta. Genómica y proteómica Perfiles de expresión génica y diagnóstico/pronóstico en cáncer Meritxell Pelicano Esqueta Genómica y proteómica Curso 2009/2010 Introducción Expresión génica: Proceso por el cual los organismos transforman

Más detalles

Vida una receta para hacer proteínas

Vida una receta para hacer proteínas Transcriptómica Vida una receta para hacer proteínas Transcripción Traducción DNA RNA proteína El Dogma Central de la Biología Molecular El Dogma Central de la Biología Molecular Qué es la Información

Más detalles

Avances genéticos en diagnóstico prenatal. Dr. David Poyatos Andújar. Especialista de producto Área Molecular

Avances genéticos en diagnóstico prenatal. Dr. David Poyatos Andújar. Especialista de producto Área Molecular Avances genéticos en diagnóstico prenatal Dr. David Poyatos Andújar. Especialista de producto Área Molecular 9 11 14 1er trimestre 2º trimestre 3er trimestre 2 Test Prenatal No Invasivo Detección T13,

Más detalles

UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE CIENCIAS BIOLÓGICAS

UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE CIENCIAS BIOLÓGICAS UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE CIENCIAS BIOLÓGICAS Departamento de Genética EFICACIA DE LOS ARRAYS DE CGH EN EL DIAGNÓSTICO DE LA DISCAPACIDAD INTELECTUAL Y DE LOS TRASTORNOS DEL ESPECTRO

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Aplicación de la técnica FISH para el diagnóstico molecular de las enfermedades de origen genético. Dr. C. Luis A. Méndez Rosado Investigador Titular

Aplicación de la técnica FISH para el diagnóstico molecular de las enfermedades de origen genético. Dr. C. Luis A. Méndez Rosado Investigador Titular Aplicación de la técnica FISH para el diagnóstico molecular de las enfermedades de origen genético. Dr. C. Luis A. Méndez Rosado Investigador Titular Métodos inmunohistoquímicos Análisis Detecta cromosómico

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles

Genética, Medicina y Sociedad (Síntesis).

Genética, Medicina y Sociedad (Síntesis). Genética, Medicina y Sociedad (Síntesis). Biología. Curtis, et al. (2008). Editorial Médica Interamericana. 7ª Ed. Cap. 16. Por lo general, los principios de la genética son los mismos para cualquier ser

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA 1. DESCRIPCIÓN DEL SERVICIO El servicio de Secuenciación Masiva tiene como finalidad el proporcionar asesoramiento y soporte técnico a los grupos de investigación interesados en realizar proyectos de ultrasecuenciación.

Más detalles

Información para Envío de Muestras

Información para Envío de Muestras Información para Envío de Muestras CARIOTIPO EN LÍQUIDO AMNIÓTICO Es el estudio de los cromosomas del feto en células de líquido amniótico. El estudio implica el cultivo de amniocitos, bandeo cromosómico

Más detalles

ESTUDIO DE LAS ALTERACIONES GENÉTICAS EN ADENOCARCINOMAS GÁSTRICOS MEDIANTE acgh Y FISH EN SU CONTEXTO CLÍNICO-PATOLÓGICO

ESTUDIO DE LAS ALTERACIONES GENÉTICAS EN ADENOCARCINOMAS GÁSTRICOS MEDIANTE acgh Y FISH EN SU CONTEXTO CLÍNICO-PATOLÓGICO ESTUDIO DE LAS ALTERACIONES GENÉTICAS EN ADENOCARCINOMAS GÁSTRICOS MEDIANTE acgh Y FISH EN SU CONTEXTO CLÍNICO-PATOLÓGICO CENTRO DE INVESTIGACIÓN DEL CÁNCER HOSPITAL UNIVERSITARIO DE SALAMANCA Introducción

Más detalles

Estudios genéticos fetales

Estudios genéticos fetales Estudios genéticos fetales Álvaro Gorostiaga Hospital Universitario Basurto, Bilbao Universidad del País Vasco, UPV/EHU Sesión clínica. Unidad de Ecografía y Diagnóstico prenatal Enfermedades genéticas

Más detalles

Catálogo de Servicios

Catálogo de Servicios Catálogo de Servicios UNIDAD: Diagnóstico Prenatal / Postnatal El Centro de Análisis Genéticos (C.A.G.T) se creó en el año 1995 con la finalidad de ofrecer un servicio integral en el ámbito de la Genética

Más detalles

Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona

Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona Montserrat Milà Sección Genética Molecular Hospital Clínic de barcelona Diagnóstico Genético Diagnóstico de una enfermedad causada por una alteración en el material genético Constitucional: afecta a todas

Más detalles

BIOMOL-EXOME: Secuenciación y Análisis Bioinformático de Exoma Humano para la detección de enfermedades de origen genético.

BIOMOL-EXOME: Secuenciación y Análisis Bioinformático de Exoma Humano para la detección de enfermedades de origen genético. BIOMOL-EXOME: Secuenciación y Análisis Bioinformático de Exoma Humano para la detección de enfermedades de origen genético. Biomol-Informatics SL BIOMOL-EXOME es un servicio de Biomol-Informatics, compañía

Más detalles

Las enfermedades genéticas y el diagnóstico genético Preguntas y respuestas

Las enfermedades genéticas y el diagnóstico genético Preguntas y respuestas Las enfermedades genéticas y el diagnóstico genético Preguntas y respuestas PRESENTACIÓN En este documento presentamos doce preguntas básicas relacionadas con las enfermedades genéticas y el diagnóstico

Más detalles

CERTIFICACIONES...5 AGRADECIMIENTOS...11 ÍNDICE DE CONTENIDO...15 LISTADOS...21 LISTADO DE TABLAS...23 LISTADO DE FIGURAS...23 ABREVIATURAS...27 RESUMEN...33 RESUMEN...35 SUMMARY...36 INTRODUCCIÓN...39

Más detalles

Genoma y Ensamblado Seminario de Modelos y Métodos cuantitativos (Bioinformática)

Genoma y Ensamblado Seminario de Modelos y Métodos cuantitativos (Bioinformática) Genoma y Ensamblado Seminario de Modelos y Métodos cuantitativos (Bioinformática) Rodrigo Fernández Cristián Maureira Gabriel Zamora Universidad Técnica Federico Santa María 18 de noviembre de 2010 Genoma

Más detalles

SNP Microarray. Prenatal

SNP Microarray. Prenatal SM SNP Microarray Prenatal SM SNP Microarray Reveal SM SNP Microarray es una prueba que analiza los cromosomas para detectar los cambios que pueden explicar ciertos tipos de defectos congénitos. Este folleto

Más detalles

Técnicas: FISH, CGH, MLPA: rearreglos cromosomales, variación en número de cromosomas.

Técnicas: FISH, CGH, MLPA: rearreglos cromosomales, variación en número de cromosomas. A nivel de ADN: Hibridación, PCR, ligación: Muestra: in situ (localización física), amplificación de ADN de muestra, extracción de ADN, microdisección con rayo laser. Técnicas: FISH, CGH, MLPA: rearreglos

Más detalles

DNA Alliance. Tu aliado en genética humana

DNA Alliance. Tu aliado en genética humana DNA Alliance Tu aliado en genética humana Incidencia y prevalencia de enfermedades de origen genético Actividades de diagnóstico genético 1 Impacto en salud pública 2 Impacto en la actividad económica

Más detalles

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé

Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé OBSTETRICIA TEST EN SANGRE MATERNA PARA DETECTAR SÍNDROME DE DOWN Una prueba genética fetal sin riesgos, ni para ti ni para tu bebé Salud de la mujer Dexeus ATENCIÓN INTEGRAL EN OBSTETRICIA, GINECOLOGÍA

Más detalles

Técnicas: variación en número de cromosomas: FISH, CGH, MLPA. Rearreglos cromosomales: FISH PCR, RT-PCR (algunas translocaciones)

Técnicas: variación en número de cromosomas: FISH, CGH, MLPA. Rearreglos cromosomales: FISH PCR, RT-PCR (algunas translocaciones) A nivel de ADN: Hibridación, PCR, ligación: Muestra: in situ (localización física), amplificación de ADN de muestra, extracción de ADN, microdisección con rayo laser. Técnicas: variación en número de cromosomas:

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Hada C. Macher Manzano FEA del Servicio de Bioquímica Clínica del Hospital Universitario Virgen del Rocío UGC LACUS

Hada C. Macher Manzano FEA del Servicio de Bioquímica Clínica del Hospital Universitario Virgen del Rocío UGC LACUS Hada C. Macher Manzano FEA del Servicio de Bioquímica Clínica del Hospital Universitario Virgen del Rocío UGC LACUS El ADN circulante es el que encontramos en plasma o suero, no unido a células, circulando

Más detalles

Centro Nacional Genotipado

Centro Nacional Genotipado Centro Nacional Genotipado Anna Gonzalez-Neira Centro Nacional de Investigaciones Oncológicas (CNIO) Qué es el CeGen? El CeGen es una plataforma tecnológica, iniciativa de GENOMA ESPAÑA, que tiene por

Más detalles

Enfermedades asociadas a mutaciones estructurales

Enfermedades asociadas a mutaciones estructurales Enfermedades asociadas a mutaciones estructurales El cariotipo humano A partir de un cultivo de sangre periférica, y posterior tratamiento con Giemsa para obtener un bandeo G, puede obtenerse el cariotipo

Más detalles

HER2 en Cancer Gastrico

HER2 en Cancer Gastrico HER2 en Cancer Gastrico Dr. Alejandro Corvalan Laboratorio de Patologia Molecular y Epidemiologia Centro de Investigaciones Medicas Departamento de Hematoloiga &Oncologia P.Universidad Catolica de Chile

Más detalles

HOSPITAL UNIVERSITARIO CENTRAL DE ASTURIAS LABORATORIO DE MEDICINA SERVICIO DE ONCOLOGÍA MOLECULAR

HOSPITAL UNIVERSITARIO CENTRAL DE ASTURIAS LABORATORIO DE MEDICINA SERVICIO DE ONCOLOGÍA MOLECULAR HOSPITAL UNIVERSITARIO CENTRAL DE ASTURIAS LABORATORIO DE MEDICINA Edición Nº 01 SERVICIO DE ONCOLOGÍA MOLECULAR CARTERA DE SERVICIOS DEL LABORATORIO DE ONCOLOGÍA MOLECULAR Modificaciones respecto a la

Más detalles

en plasma es un enfoque valioso para estudiar la heterogeneidad

en plasma es un enfoque valioso para estudiar la heterogeneidad Clinical Chemistry 59:1 211 224 (2013) Diagnóstico del cáncer Exploración del genoma de cáncer en plasma: Detección de los tumores asociados a las aberraciones del número de copias, variantes de nucleótido

Más detalles

Técnicas: FISH, CGH, MLPA: rearreglos cromosomales, variación en número de cromosomas.

Técnicas: FISH, CGH, MLPA: rearreglos cromosomales, variación en número de cromosomas. A nivel de ADN: Hibridación, PCR, ligación: Muestra: in situ (localización física), amplificación de ADN de muestra, extracción de ADN, microdisección con rayo laser. Técnicas: FISH, CGH, MLPA: rearreglos

Más detalles

Presentando la prueba BRCA. Acceso a los resultados que usted quiere para el tratamiento que necesitan sus pacientes.

Presentando la prueba BRCA. Acceso a los resultados que usted quiere para el tratamiento que necesitan sus pacientes. Presentando la prueba BRCA Acceso a los resultados que usted quiere para el tratamiento que necesitan sus pacientes. Quest Diagnostics se compromete con usted a través de la atención continua, fortaleciéndole

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

PCR, Southern Blot Biopsia coriónica (post semana 15) Líquido amniótico (post semana 15) Deleciones Subteloméricas Sangre periférica con EDTA

PCR, Southern Blot Biopsia coriónica (post semana 15) Líquido amniótico (post semana 15) Deleciones Subteloméricas Sangre periférica con EDTA GENETICA MOLECULAR Patología y técnica Tipo/s de muestra Síndrome de X-Fragil PCR, Southern Blot (post semana 15) (post semana 15) Deleciones Subteloméricas MLPA Fibrosis Quística (29 mutaciones) PCR-ARMS

Más detalles

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico Radiación y Cáncer Karel van Wely 23-10 - 2012 -) Una definición del cáncer -) El cáncer, consecuencia de un problema biológico -) el ambiente, donde aparece el cáncer? -) estadios diferentes de la carcinogénesis

Más detalles

MICRO Y NANOTECNOLOGÍA EN MEDICINA: LOS CHIPS O MICROARRAYS DE ADN

MICRO Y NANOTECNOLOGÍA EN MEDICINA: LOS CHIPS O MICROARRAYS DE ADN MICRO Y NANOTECNOLOGÍA EN MEDICINA: LOS CHIPS O MICROARRAYS DE ADN Ana Dopazo González Responsable de la Unidad de Análisis Genómico Centro Nacional de Investigaciones Oncológicas Introducción La aplicación

Más detalles

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA AULA DE MAYORES Y DE LA EXPERIENCIA F.Córdoba, R.Torronteras, A.Canalejo Departamento de Biología Ambiental y Salud Pública LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA Tema 1.3. Los sistemas

Más detalles

Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña

Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña Caroline Becker; Enric Carcereny Costa; Felipe Andreo García; Eva Castellá; Mariona Lletjós Sanuy;

Más detalles

Selección de pacientes

Selección de pacientes 2 Selección de pacientes MENSAJES CLAVE Aproximadamente entre el 20% y el 30% de las pacientes con cáncer de mama presentan tumores HER2 positivos. Hasta un 24% de los tumores con receptores de estrógenos

Más detalles

Significancia de los micronúcleos en lesiones cervicales intraepiteliales y carcinoma

Significancia de los micronúcleos en lesiones cervicales intraepiteliales y carcinoma Significancia de los micronúcleos en lesiones cervicales intraepiteliales y carcinoma María E. Gonsebatt Universidad Nacional Autónoma de México margen@unam.mx > 90 % de los cánceres se originan en tejidos

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA 1. DESCRIPCIÓN DEL SERVICIO El servicio de Secuenciación Masiva tiene como finalidad el proporcionar asesoramiento y soporte técnico a los grupos de investigación interesados en realizar proyectos de ultrasecuenciación.

Más detalles

Una empresa valenciana implanta una técnica para analizar el ADN del esperma

Una empresa valenciana implanta una técnica para analizar el ADN del esperma 26/03/2013 Una empresa valenciana implanta una técnica para analizar el ADN del esperma Valencia, 26 mar (EFE).- La empresa valenciana Sistemas Genómicos ha implantado una técnica de análisis que utiliza

Más detalles

Anomalías Cromosómicas

Anomalías Cromosómicas 12 Unique Grupo de apoyo para enfermedades cromosómicas raras del Reino Unido Teléfono: + 44 (0) 1883 330766 Email: info@rarechromo.org www.rarechromo.org Anomalías Cromosómicas Orphanet Información gratuita

Más detalles

ÁREA DE BIOLOGÍA CELULAR Y MOLECULAR

ÁREA DE BIOLOGÍA CELULAR Y MOLECULAR BIOLOGÍA CELULAR Y MOLECULAR SERVICIO DE BIOLOGÍA MOLECULAR 1. DETECCIÓN DE QUIMIOLUMINISCENCIA Y FLUORESCENCIA DE GELES Y MEMBRANAS. 2. CITÓMETRO DE FLUJO CON SORTER. 3. LUMINÓMETRO 4. MICRODISECCIÓN

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles