Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:




2 DATOS DE LA EMPRESA Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC- SODERCAN), Avda. Herrera Oria s/n. Santander. El tutor CSIC fue Raúl Fernández López y el tutor de la Universidad Fernando Leal Sánchez. El periodo de las prácticas se inicio el 2 julio de 2008 finalizando las prácticas el 29 agosto de Las horas previstas al día son de 8 pero varían según las necesidades de investigación. Se trabaja de lunes a viernes. Estas prácticas están dirigidas a alumnos de 5º curso de Biología/Bioquímica. RESUMEN Dentro de la Biología Sintética, uno de los procesos fundamentales es la construcción y caracterización de partes (Biobricks), que una vez construidas y analizadas se envían al Registro Biológico de Partes Estándar ( A partir de estos Biobricks se diseñan y construyen dispositivos más complejos para el desarrollo de diversos procesos biotecnológicos. Los plásmidos son utilizados como lanzaderas naturales para transportar estos dispositivos hasta las cepas de destino. Un problema esencial para mejorar nuestra capacidad de transportar y hacer funcionar con éxito dispositivos sintéticos en bacterias reside en entender las relaciones que se establecen entre el plásmido lanzadera y la bacteria hospedadora. Los plásmidos naturales han desarrollado mecanismos que les permiten residir en bacterias causando un impacto mínimo sobre su capacidad de supervivencia. Este proyecto tiene como objetivo estudiar las relaciones que establece uno de estos plásmidos naturales, R388, con Escherichia coli, y desarrollar partes sintéticas a partir de él.

3 TÉCNICAS EXPERIMENTALES Y HABILIDADES A DESARROLLAR Técnicas básicas de bioinformática: Diseño de oligonucleótidos, construcción in silico de vectores, búsqueda de homología mediante BLAST, optimización del uso de codones etc Técnicas básicas de biología molécular: PCR, electroforesis en geles de agarosa, clonaje molecular, secuenciación etc Técnicas básicas de microbiología: cultivos bacterianos, antibiogramas, ensayos de fitness y competición etc Técnicas básicas de biología de sistemas (microbianos): perfiles de expresión por sondas fluorescentes, análisis de expresión por citometría de flujo, análisis por PCR cuantitativa. DESARROLLO DE LAS PRÁCTICAS Se quiere estudiar el comportamiento de dos cepas isogénicas de E.coli B, son REL 606 y REL 607. Estas cepas se comportan exactamente igual exceptuando que una no fermenta arabinosa (REL 606) y la otra sí (REL 607). Se quiere ver la influencia de una cepa sobre otra, si afecta positivamente o negativamente o no interfieren. Así pues, el inicio de este estudio es el cultivo de ambas cepas de forma conjunta en el mismo medio. Este inoculo inicial se plaquea en placas petri con un medio especial para el estudio. Este medio es agar convencional rico en arabinosa y contiene un colorante (tetrazolium). Estas dos colonias se diferencian en la mezcla debido a que las Ara+ (fermentan arabinosa) aparecen blancas y las Ara- rojas por la presencia de TTC (tetrazolium) en el medio. La mezcla de ambas cepas se cultiva (37ºC durante 24h) en el tiempo y se hacen plaqueos cada día. Con esto, se hace un recuento del numero de células que hay cada dia 24 horas (unas 20 generaciones). Se ve si unas células decrecen, se mantienen o aumentan. Contando las colonias que crecen en una placa y teniendo en cuenta la dilución plaqueada, se consigue saber el número de células inicial, con el

4 que se comienza este estudio de competencia. Contando las colonias que crecen en placas (que se flaquean cada 24 horas) seguimos el crecimiento de las células en competición. Se va viendo como responde cada población (REL 606 y REL 607) mientras crecen juntas. Al mismo tiempo, se quiere estudiar como afecta el plásmido R388 a la célula hospedadora. Aprovechando que tenemos dos cepas isogénicas con el mismo fitness, se van a utilizar para este estudio. Lo primero que hay que conseguir es tener el plásmido R388 dentro de las cepas REL 606 y REL 607. Se hace por electroporacion. Las células que hayan incorporado el plásmido serán resistentes a trimetropin (TMP), las que no lo incorporen solo serán resistentes a estreptomicina (SM). Así seleccionamos solo las que son resistentes a ambos antibióticos ya que serán que te tengan incorporado el plásmido a estudiar. El protocolo de este estudio es el mismo que el anterior, el cual sirve para control negativo de este nuevo. Si la incorporación del plásmido no afecta en absoluto a la cepa se debe comportar exactamente igual que si no tuviera el plásmido (primer estudio). Estos resultados esta sujetos a una interpretación muy objetiva, ya que el conteo de las colonias (diferenciar entre rojas y blancas) se hace por la persona encargada y no siempre es fácil diferenciar las dos cepas. General mente, ambas cepas (ara+ y ara-) aparecen con un halo blanco a su alrededor, pero unas tienen el interior rosa-fucsia y otras rosa-blanco. Con el objetivo de medir de alguna forma el crecimiento de estas dos cepas cuando lo hacen juntas, se estudio cada cepa con fluorescencia. En este tercer estudio, se quiere introducir fluorescencia roja (plásmido pbad) en una cepa y fluorescencia verde (pbad::gfp). Este plásmido es introducido en la célula por electroporosis. Ahora las células que incluyen este plásmido serán resistentes a Sm y Cm (cloranfenicol). Así vamos a ser capaces de medir el crecimiento de ambas cepas conjuntas y monitorizarlo a tiempo real. Se utiliza un aparato (VICTOR) capaz de medir la D.O del cultivo y la fluorescencia roja y verde. Vamos a ser capaces de describir el comportamiento de una cepa frente a otra a tiempo real. A lo largo del estudio se plaquean las cepas que incluyen el plásmido (con resistencia a uno u otro antibiótico) en placas con agar y el correspondiente antibiótico, con la finalidad de seleccionar solo las células que realmente lo han incorporado. Otra prueba que también se debe realizar, son los antibiogramas.

5 Un antibiograma consiste en crecer un inoculo de una cepa en una placa de agar en la cual se colocan discos de antibiótico a una determinada concentración, a la cual se espere que nuestra cepa sea resistente (se venden comercialmente). Este estudio de competencia se ha realizado según el estudio llevado a cabo por Richard Lenski de la Universidad Michigan State ( Lo que se ha querido ver en el laboratorio de genética (Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC-SODERCAN)) es la competencia entre cepas con el mismo fitness pero que una tiene incorporado el plásmido R288 contra otra que no lo tiene. ESTUDIO DE LA CONJUGACION BACTERIANA La conjugación bacteriana es el proceso de transferencia de información genética desde una célula donadora a otra receptora, promovido por determinados tipos de plásmidos, que portan un conjunto de genes cuyos productos participan en el proceso, y que requiere contactos directos entre ambas, con intervención de estructuras superficiales especializadas y de funciones específicas (pili sexuales en los Gram negativos, y contacto íntimo en los Gram positivos). Algunos de estos plásmidos se comportan como episomas, es decir, que pueden integrarse en el cromosoma; en este caso, si se produce la conjugación, se puede transferir el propio plásmido más un segmento adyacente del cromosoma, que a su vez podrá recombinarse con secuencias homólogas del cromosoma del receptor, dando lugar a un cromosoma híbrido.

6 Esquema de la conjugación bacteriana. 1- La célula donante genera un pilus. 2-El pilus se une a la célula receptora y ambas células se aproximan. 3-El plásmido móvil se desarma y una de las cadenas de ADN es transferida a la célula receptora. 4-Ambas células sintetizan la segunda cadena y regeneran un plásmido completo. Además, ambas células generan nuevos pili y son ahora viables como donantes. En la conjugación bacteriana, cuando una célula ha cogido un plásmido, ya no quiere otro. Así, se sintetiza una proteína de membrana que dice que ya ha recibido un plásmido. Esta proteína se ha denominado entry exclusión (Eex). El siguiente estudio que se va a realizar durante las prácticas es conseguir eliminar el fragmento génico de esta proteína en el plásmido R388. Se quiere eliminar la secuencia que pertenece a esta proteína. Ahora se va a eliminar la secuencia de Eex mediante la introducción en esa zona de R388, de la secuencia génica correspondiente a la resistencia ante el antibiótico kanamicina (Kn). El proceso consiste en tener la secuencia de la Kn (resistencia a este antibiótico) amplificada. Se obtiene de un plásmido de resistencia a este antibiótico, mediante una PCR común. Se comprueba el tamaño del fragmento ampliado mediante un gel de agarosa. Si el tamaño es el esperado (el numero de bases que tenga esa secuencia de resistencia a la Kn), se purifica la banda en cuestión. Este fragmento de resistencia a la Kn se introduce en las células por electroporacion. Son unas células especiales ya que la maquinaria de precombinación se induce a 40 ºC. Así que como no nos interesa que se de precombinación ya que pueden eliminar el fragmento de su material genético, se plaquean tras la electroporacion a 30ºc durante 24h. Se flaquean en placa con los antibióticos adecuados para seleccionar colonias que realmente hayan incorporado este fragmento de resistencia a la Kn, así que plaquearan en TMP (la cepa ya es resistente a este) y en Kn.

7 Una vez que obtengo colonias resistentes a Kn (por la incorporación del fragmento) y TMP (propio de la cepa), tengo que conocer en que lugar del plásmido R388 se ha incorporado la secuencia de resistencia a Kn. Para esto se realiza una nueva PCR y se comprueba el tamaño del fragmento ampliado y de lo restante (que debe ser un único fragmento correspondiente al plásmido R388 sin Eex). Cuando ya sabemos que tenemos el fragmento de Kn incorporado en R388 y en el sitio correcto (donde debería estar Eex), entonces eliminamos este fragmento de resistencia a Kn mediante enzimas de restricción. El objetivo es quitar la secuencia de Kn que se incorporo a R388 para eliminar Eex; quedando como resultado final, el plásmido R388 sin Eex (y sin lo correspondiente a Kn). Cuando hayamos comprobado que la digestión de ese plásmido es la correcta (el tamaño y numero de bandas en un gel de agarosa tiene que ser lo esperado), se ligan los dos extremos 5 con el 3. Así se habrá construido un plásmido al que se le ha eliminado la secuencia correspondiente a una proteína en concreto. La clave en todo este método (se sigue el método descrito por Wanner) esta en el diseño de los oligos para realizar la PCR. Se debe diseñar un oligo que podemos dividir en tres zonas. 1. la zona correspondiente con el inicio de la secuencia Eex. Aquí se debe guardar una longitud de unos 40 pares de bases de homología con dicha secuencia. 2. una zona que permita el corte a una determinada enzima de restricción (la que se quiera usar). 3. la zona correspondiente al inicio de la secuencia de la Kn. En la primera PCR el oligo diseñado se une al DNA (de donde queramos obtener el fragmento de resistencia a Kn) por la parte aquí descrita como 3. La parte aquí descrita como 1, es para que se reconozca la zona donde empieza Eex y así el fragmento de Kn se introduzca ahí, eliminando la secuencia de Eex. Para comprobar que se ha insertado en la zona donde debería estar Eex se utiliza otra pareja de oligos (la pareja 5-3 y 3-5 ). Se utilizan oligos que amplíen una zona que empiece fuera de la región Kn (la introducida). Así lo que se amplíe será el fragmento entero de la Kn más unos pares de bases por delante y por detrás. Se esperara un fragmento grande, ya que la secuencia para la resistencia a Kn es de unos 1000pb y la que se quiere eliminar, Eex, es de unos 350pb. Como resultado final de este proceso (según wanner) será un plásmido R388 sin la zona que codifica para la proteína Eex. Así las células que tengan el plásmido con la deleción de Eex y ya ligados sus extremos, serán estudiadas. Lo siguiente será ver como afecta la deleción de esta proteína en las células receptoras. Ver como responden en conjugación bacteriana sin la señal que informa de que ya tienen un plásmido incorporado.


Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR. RESUMEN Las repeticiones

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles



Más detalles



Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

GENÉTICA BACTERIANA. Elementos genéticos. GENOMA BACTERIANO es el conjunto de elementos genéticos autorreplicativos que tiene una bacteria

GENÉTICA BACTERIANA. Elementos genéticos. GENOMA BACTERIANO es el conjunto de elementos genéticos autorreplicativos que tiene una bacteria GENÉTICA BACTERIANA I. Elementos genéticos I. Elementos genéticos II. Variabilidad genética III. Genómica y concepto de especie GENOMA BACTERIANO es el conjunto de elementos genéticos autorreplicativos

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles



Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Tipos de mapas: MAPAS FISICOS (de restricción, citogenéticos, de híbridos de radiación...)

Más detalles



Más detalles


CURSO ACADÉMICO 2012-2013 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2012-2013 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, ecología y Genética Área de conocimiento: Genética Ciclo:2º Curso: 4º Tipo:

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles


BIOTECNOLOGÍA Y GENÉTICA MOLECULAR BIOTECNOLOGÍA Y GENÉTICA MOLECULAR Conceptos de biotecnología y genética molecular. Importancia y beneficios de la biotecnología. Genética y Tecnología del DNA recombinante: estrategias de clonación. Enzimas

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles


ANÁLISIS DE LA COMPOSICIÓN DEL REGULÓN LEXA EN EL DOMINIO Bacteria Universidad Autónoma de Barcelona Departamento de Genética y Microbiología ANÁLISIS DE LA COMPOSICIÓN DEL REGULÓN LEXA EN EL DOMINIO Bacteria Mónica Jara Ramírez 2004 Universidad Autónoma de Barcelona

Más detalles


QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles



Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles



Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA 1. DESCRIPCIÓN DEL SERVICIO El servicio de Secuenciación Masiva tiene como finalidad el proporcionar asesoramiento y soporte técnico a los grupos de investigación interesados en realizar proyectos de ultrasecuenciación.

Más detalles

Evaluación de tres estrategias de diagnóstico para el Huanglongbing de los cítricos en la zona de Cuitláhuac, Ver.

Evaluación de tres estrategias de diagnóstico para el Huanglongbing de los cítricos en la zona de Cuitláhuac, Ver. UNIVERSIDAD VERACRUZANA Facultad de Ciencias Biológicas y Agropecuarias Campus Peñuela Zona Orizaba-Córdoba Evaluación de tres estrategias de diagnóstico para el Huanglongbing de los cítricos en la zona

Más detalles


METODO DE FILTRACIÓN POR MEMBRANA PARA DETERMINACION DE COLIFORMES Y E. coli EN AGUA PRT-712.03-009 Página 1 de 7 1. OBJETIVO Este método se utiliza para medir la calidad sanitaria del agua potable. 2. CAMPO DE APLICACIÓN Y ALCANCE Se aplica a agua clorada o agua naturales de muy baja

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles


REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA Tema 4 REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA 1. ADN y ARN pág 92-93 -Composición química y conceptos: ADN, ARN, nucleótidos, bases nitrogenadas, ácido fosfórico. -Estructura: doble hélice, cadenas complementarias.

Más detalles

5. La infección hospitalaria: herramientas para su control

5. La infección hospitalaria: herramientas para su control 5. La infección hospitalaria: herramientas para su control Por definición se considera infección nosocomial o de adquisición hospitalaria a la que no está presente ni se está incubando en el momento del

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REGULACIÓN DE LA EXPRESIÓN GENÉTICA INTRODUCCIÓN La transmisión de la información genética (transcripción), posibilita la formación de proteínas, cuyas funciones van a caracterizar la actividad y morfología

Más detalles

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación.

1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. Anexo I. 1. Diseño, elaboración de manuales y desarrollo de prácticas de las asignaturas del primer año de la titulación. a) Asignatura BIOQUÍMICA Esta asignatura es la primera en la que el alumno entra

Más detalles


TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

MANUAL DE PRÁCTICAS !!! Heber!Torres! !!!!!!!!!!!!!!!!!!!!!!!!!!!

MANUAL DE PRÁCTICAS !!! Heber!Torres! !!!!!!!!!!!!!!!!!!!!!!!!!!! MANUAL DE PRÁCTICAS igem-cideb_uanl HeberTorres Índice de Contenidos Presentación... 1 Reglas Generales y Recomendaciones... 3 Prácticas de Laboratorio de Biología Sintética para igem-cideb_uanl... 5

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles


LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia

Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia Unidad Temática 3 Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia Introducción En un sistema biológico se define al crecimiento como el aumento ordenado de las estructuras y los constituyentes

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

La división celular. .Interfase

La división celular. .Interfase .Interfase La división celular El conjunto de procesos propios de la interfase hacen posible el mantenimiento o el incremento de las estructuras celulares, lo que conlleva, en principio, un incremento

Más detalles


2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Paloma Rodríguez Rodríguez

Paloma Rodríguez Rodríguez Paloma Rodríguez Rodríguez AVANCES TECNOLÓGICOS M. Electrónica + Secuenciación y comparación genómica / aminoacídica Diversidad y Abundancia Cadenas tróficas microbianas Redes tróficas globales Presentes

Más detalles



Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles



Más detalles


III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009

VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009 VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009 Caracterización y estudio de la función de un gen (Tb podría ser un fragmento de DNA genómico para el estudio de splicing o del promotor de un

Más detalles

Ingeniería Genética II

Ingeniería Genética II Ingeniería Genética II Expresión de proteínas recombinantes Vectores de expresión Características adicionales: - Promotor regulable - Terminador de la transcripción - Sitio de reconocimiento por el ribosoma

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

WEBMINAR Nuevos sistemas de expresión para construir metagenotecas

WEBMINAR Nuevos sistemas de expresión para construir metagenotecas WEBMINAR Nuevos sistemas de expresión para construir metagenotecas Grupo de Eduardo Santero Universidad Pablo de Olavide UPO-CSIC Objetivos 1) Modificación de vectores de clonación para maximizar la expresión

Más detalles



Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

Solicitud para la concesión de permisos para Experimentación y/o Liberación al Medio de Microorganismos Genéticamente Modificados y/o sus productos

Solicitud para la concesión de permisos para Experimentación y/o Liberación al Medio de Microorganismos Genéticamente Modificados y/o sus productos Solicitud para la concesión de permisos para Experimentación y/o Liberación al Medio de Microorganismos Genéticamente Modificados y/o sus productos para aplicaciones en animales El Secretario de Agricultura,

Más detalles



Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Dpto. de Ciencias Agrarias y del Medio Natural Área: Fisiología Vegetal MASTER EN BIOLOGÍA MOLECULAR, CELULAR Y GENÉTICA


Más detalles

D.- La investigación ha sido presentada en otros eventos (ferias o muestras) científicos?

D.- La investigación ha sido presentada en otros eventos (ferias o muestras) científicos? C. Dónde han investigado? Mencione si se ha desarrollado parte, o toda la investigación en otras instituciones distintas a su Establecimiento Educacional. La fase práctica del proyecto fue desarrollada

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles



Más detalles

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua destilada utilizando Dióxido de Titanio dopado con Nitrógeno,

Más detalles

Certificación en Biotecnología Sanitaria (Curso Homologado con Titulación Universitaria + 20 Créditos tradicionales LRU)

Certificación en Biotecnología Sanitaria (Curso Homologado con Titulación Universitaria + 20 Créditos tradicionales LRU) Certificación en Biotecnología Sanitaria (Curso Homologado con Titulación Universitaria + 20 Titulación certificada por EUROINNOVA BUSINESS SCHOOL Certificación en Biotecnología Sanitaria (Curso Homologado

Más detalles

XVII CONCURSO UNIVERSITARIO FERIA DE LAS CIENCIAS CARÁTULA DE TRABAJO. Biología. Área. Externa. Categoría. Investigación Experimental.

XVII CONCURSO UNIVERSITARIO FERIA DE LAS CIENCIAS CARÁTULA DE TRABAJO. Biología. Área. Externa. Categoría. Investigación Experimental. XVII CONCURSO UNIVERSITARIO FERIA DE LAS CIENCIAS CARÁTULA DE TRABAJO Biología Área Externa Categoría Investigación Experimental Modalidad "Regulación de la expresión genética de las proteínas verde fluorescente

Más detalles


MOLECULAR DIAGNOSTIC KITS CATALOGUE MOLECULAR DIAGNOSTIC KITS CATALOGUE KITS DE DIAGNÓSTICO MOLECULAR IELAB le presenta, enmarcada dentro de su línea de productos de diagnóstico molecular, una nueva gama de kits de diagnóstico, que han sido

Más detalles

PRODUCCIÓN DE PROTEÍNAS PICHIA PASTORIS RECOMBINANTES EN. Procesos biotecnológicos Dra. Claudia Elena Año 2015


Más detalles


ASIGNATURA: BIOLOGÍA MOLECULAR Página 1 de 5 CARACTERÍSTICAS GENERALES * Tipo: DESCRIPCIÓN Formación básica, Obligatoria, Optativa Trabajo de fin de grado, Prácticas externas Duración: Cuatrimestral Semestre / s: 3 Número de créditos

Más detalles

TEST DE NIVEL BASICO. 1. Únicamente las bacterias Gram negativas tienen: a) Exotoxinas b) Peptidoglicano c) Lipopolisacárido d) Plásmidos

TEST DE NIVEL BASICO. 1. Únicamente las bacterias Gram negativas tienen: a) Exotoxinas b) Peptidoglicano c) Lipopolisacárido d) Plásmidos TEST DE NIVEL BASICO 1. Únicamente las bacterias Gram negativas tienen: a) Exotoxinas b) Peptidoglicano c) Lipopolisacárido d) Plásmidos 2. Los genes de virulencia de una especie bacteriana patógena: a)

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Tema 14. Mejora genética en acuicultura

Tema 14. Mejora genética en acuicultura Tema 14. Mejora genética en acuicultura Genética CC. Mar 2004-05 Objetivos Destacar los experimentos realizados en peces y otros organismos acuáticos Describir la transgénesis en organismos acuáticos Genética

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles



Más detalles

Microdiversidad: Potencial para las Agroempresas Colombianas. Patricia Del Portillo, Directora Ejecutiva

Microdiversidad: Potencial para las Agroempresas Colombianas. Patricia Del Portillo, Directora Ejecutiva Microdiversidad: Potencial para las Agroempresas Colombianas Patricia Del Portillo, Directora Ejecutiva CorpoGen Investigación y Biotecnología Centro Privado de Investigación Fundado en 1995 Investigación

Más detalles

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar.

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar. PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA DATOS DEL ASPIRANTE Apellidos: CALIFICACIÓN PRUEBA Nombre: D.N.I. o Pasaporte: Fecha de nacimiento: / / Instrucciones: Lee atentamente

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Proceso para transformación de células de plantas con Agrobacterium tumefaciens

Proceso para transformación de células de plantas con Agrobacterium tumefaciens Proceso para transformación de células de plantas con Agrobacterium tumefaciens Transformar Agrobacterium con plásmidos (vectores) conteniendo los genes vir y el T-DNA con los genes deseados. Cocultivar

Más detalles



Más detalles