CUESTIONES TEMA 4: La revolución genética y la biotecnología.

Tamaño: px
Comenzar la demostración a partir de la página:

Download "CUESTIONES TEMA 4: La revolución genética y la biotecnología."

Transcripción

1 CUESTIONES TEMA 4: La revolución genética y la biotecnología. 1. El ADN no puede salir del núcleo: Cómo logra llevar a los ribosomas que están en el citoplasma la información que porta? 2. El individuo del dibujo es diabético. Las células de su páncreas, por una anomalía genética, no producen insulina. Qué técnica representa el siguiente esquema para solucionar su problema? Ordena los textos asociando cada uno de ellos a un número: o Se obtienen células del enfermo. o Se inyectan en el páncreas del paciente y estas ya producen insulina. o Las células quedan modificadas genéticamente. o Se inserta un gen que funciona correctamente de la insulina. o En el laboratorio se elimina la información genética que permite la replicación del virus. o El virus modificado se introduce en las células extraídas del paciente. 3. Explica en pocas palabras: a) Qué utilidades tiene la técnica conocida como PCR? b) Cómo se emplea el ADN para identificar personas? Utiliza la información aportada en la siguiente imagen para responder a estas cuestiones. 4. En la replicación del ADN se ha producido un error que no ha sido reparado, lo que ha dado lugar a una mutación. El error consiste en un pequeño fragmento de ADN: dónde había GAA, ahora hay GAG. Habrá alguna modificación en la proteína resultante? 5. Busca en Internet argumentos a favor y en contra de los alimentos transgénicos. Expón de manera resumida cuál es tu opinión. 1

2 6. Para algunas enfermedades genéticas humanas, los científicos han sido capaces de secuenciar la parte de genoma responsable de las mismas. Una persona quiere saber si tiene el gen que le hace propenso a una determinada enfermedad. Qué técnica debería realizarse? En qué consiste? 7. Por qué se fabrican alimentos genéticamente modificados o transgénicos? Es posible diferenciarlos en el mercado cuando realizamos la compra? 8. Relaciona los impactos que tienen los OMG (Organismos Modificados Genéticamente) en la salud y en el medio ambiente. 9. El riesgo de contaminación genética es un argumento contra los OMG utilizado por algunos científicos y ecologistas. Explica en qué consiste este riesgo y comenta las consecuencias que se derivan de esta contaminación. 10. A modo de resumen del tema, busca y escribe brevemente el significado de los siguientes conceptos: - Genética - ADN - Nucleótidos - Doble hélice - Duplicación del ADN - Genes - Genotipo - Fenotipo - Genoma - Cromosomas - Aminoácidos. Ejemplos - Transcripción - Traducción - Triplete o codón. Ejemplos - Código genético - Enzimas - Biotecnología - Ingeniería genética - Organismos modificados genéticamente (OMG) - Organismos transgénicos. Ejemplos - ADN recombinante - Clonación génica - Biocombustibles. Ejemplos - Clonación - Clonación reproductiva - Clonación terapeútica - Células madre - Células madre embrionarias - Células madre adultas - Medicina regenerativa o reparativa - Fecundación in vitro - Inseminación artificial - Bioética - Enfermedades genéticas - Enfermedades hereditarias - Huella genética - PCR - Terapia génica - Alimentos transgénicos. Ejemplos 2

3 11. Completa el siguiente esquema de un fragmento de ADN, añadiendo los nucleótidos que faltan. (Libro, página 104) 12.El siguiente dibujo representa la secuencia de los siete primeros nucleótidos de la proteína insulina y los códigos genéticos para estos aminoácidos. La insulina posee un total de 51 aminoácidos. (Libro, página 104) Observa el dibujo, consulta la tabla adjunta y contesta a las siguientes preguntas: a) Cuál será la secuencia de los 12 primeros nucleótidos del gen de la insulina? b) Cuál será la secuencia complementaria de la que has escrito anteriormente? c) Cuántos nucleótidos serán necesarios para codificar todos los aminoácidos que constituyen una molécula de insulina? 13.Si tus células de la piel, las del páncreas y las musculares tienen los mismos genes, por qué son tan diferentes? Indica al menos un gen o una proteína que esté activa en cada una de ellas y no en las otras. 14. Cómo se llaman los procesos que tienen relación con la expresión de los genes para formar proteínas? 15. Ordena las siguientes etapas necesarias para la producción de la proteína lactasa, mediante tecnología de ADN recombinante: 3

4 - Identificar el clon con el gen de la lactasa. - Insertar el plásmido en la bacteria y dejar que se dividan. - Aislar el gen que codifica para la lactasa. - Producir un plásmido recombinante que contenga el gen de la lactasa. 16. Ordena las siguientes etapas que tienen lugar en un proceso de terapia génica: - El virus se inyecta en el paciente. - El gen humano se introduce en un virus. - El gen humano normal se aísla y se clona. - El gen humano normal se transcribe y se traduce en las células del paciente, produciendo una proteína normal. 17. Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F): La base nitrogenada complementaria de la adenina es la guanina. Las proteínas están formadas por pequeñas unidades denominadas nucleótidos. La duplicación del ADN origina dos moléculas de ADN iguales. Los cromosomas contienen los genes. 18. Completa el siguiente esquema con las palabras que faltan: ADN ARNm Proteína Citoplasma 19. Cuántos libros de Biología y Geología como el que estás utilizando se necesitarían para contener el código genético humano? (supongamos que una página del libro contiene unos 2000 caracteres y sabemos que el tamaño del genoma humano es pares de bases): 20. Observa el siguiente análisis de huella genética y contesta: 4

5 a) Qué bandas de la persona A coinciden con las bandas de la persona B? b) Qué bandas de la persona A coinciden con las bandas de la persona C? c) Crees que A puede ser hijo de B o de C? 21. Relaciona cada enfermedad de la primera columna con una sustancia que puede obtenerse con tecnología de ADN: Diabetes Hemofilia Enanismo Anemia Factor VIII de coagulación Insulina Eritropoyetina Hormona del crecimiento 22. Marca con una cruz los casos en que la planta sea transgénica: Una planta en la que se ha integrado un gen procedente de otra especie. Una planta en la que se ha integrado un gen procedente de la misma especie. Una planta en la que se ha modificado un gen de la propia planta. Una planta en la que se ha seleccionado un gen por métodos de mejora genética. 23. Utiliza el código genético representado en la página 85 del libro para transcribir y traducir la siguiente secuencia de ADN: ADN: ARNm: T A C T T T T C T G T T C T G G G T C C G T C A A T C Proteína: 24. Explica el método biotecnológico que utilizarías para reponer las células musculares muertas de una persona en un accidente. 5

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante.

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante. Temáticas que se revisarán: Universidad Nacional Abierta y a Distancia Especialización en Mejoramiento Genético Ingeniería genética Agropecuaria Luz Mery Bernal Parra Curso: Ingeniería genética Agropecuaria

Más detalles

GENES Y MANIPULACIÓN GENÉTICA

GENES Y MANIPULACIÓN GENÉTICA GENES Y MANIPULACIÓN GENÉTICA El ADN, material de los genes La información que controla la aparición de los caracteres hereditarios se localiza en el interior del núcleo celular y se transmite de célula

Más detalles

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Diferencia entre los seres vivos 1. Pedruscos y bichos, Qué los diferencia? Dos tipos de objeto seres vivos (pueden hacer copias

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Proyecto GENOMA HUMANO

Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar.

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar. PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA DATOS DEL ASPIRANTE Apellidos: CALIFICACIÓN PRUEBA Nombre: D.N.I. o Pasaporte: Fecha de nacimiento: / / Instrucciones: Lee atentamente

Más detalles

Tema 5 Quién puede ser donante? La legislación Española !! Riesgos del transplante Rechazo inmunológico: Escasez de órganos:

Tema 5 Quién puede ser donante? La legislación Española !! Riesgos del transplante Rechazo inmunológico: Escasez de órganos: Tema 5 Quién puede ser donante? Suelen ser personas en muerte cerebral o alguien vivo La legislación Española Muerte cerebral Respeto a la voluntad del fallecido Diagnóstico de muerte hecho por otro equipo

Más detalles

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID MATERIA: BIOLOGÍA

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID MATERIA: BIOLOGÍA UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID PRUEBA DE ACCESO A LAS ENSEÑANZAS UNIVERSITARIAS DE GRADO Curso 2012-2013 8 MATERIA: BIOLOGÍA INSTRUCCIONES GENERALES Y VALORACIÓN Estructura de la prueba:

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

Y después de la secuencia, qué?

Y después de la secuencia, qué? Y después de la secuencia, qué? Nuestros genomas no son iguales Persona 1 Persona 2 = Variaciones en el ADN Qué tipo de variaciones? Secuencia estándar Variaciones: Cambios de una base por otra: Polimorfismos

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008 . Genética. Gen.

Más detalles

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano ÍNDICE ADN - Historia del ADN - Qué es el ADN? - De qué está formado? - Qué función tiene? Ingeniería genética - Qué es la ingeniería genética?

Más detalles

Gen: Fragmento de ADN que contiene la información para la construcción de una proteína. Es la unidad biológica de la herencia.

Gen: Fragmento de ADN que contiene la información para la construcción de una proteína. Es la unidad biológica de la herencia. RESUMEN DÉCIMO Conceptos de genética: Genética: Rama de la biología que estudia la transmisión de los caracteres hereditarios o herencia Código genético: Es la secuencia de bases nitrogenadas que existe

Más detalles

PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5

PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 PREGUNTAS TEST CORRESPONDIENTES A LOS TEMAS 1 AL 5 Las preguntas de test que le adjuntamos corresponden a exámenes de las últimas convocatorias. Una vez que finalicen el estudio de los cinco primeros capítulos,

Más detalles

APLICACIONES DE BIOTECNOLOGÍA EN MEDICINA Y REPRODUCCIÓN

APLICACIONES DE BIOTECNOLOGÍA EN MEDICINA Y REPRODUCCIÓN APLICACIONES DE BIOTECNOLOGÍA EN MEDICINA Y REPRODUCCIÓN APLICACIONES EN MEDICINA Y REPRODUCCIÓN TERAPIA GÉNICA CLONACIÓN TERAPÉUTICA CÉLULAS MADRE DIAGNÓSTICO GENÉTICO DIAGNÓSTICO GENÉTICO PREIMPLANTACIONAL

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

TEMA 1: La célula. 1.- Busca el origen y el significado de los términos procariota (o procariótica) y eurocariota (o eucariótica).

TEMA 1: La célula. 1.- Busca el origen y el significado de los términos procariota (o procariótica) y eurocariota (o eucariótica). Biología Curso 2011/12 4º E.S.O. TEMA 1: La célula 1.- Busca el origen y el significado de los términos procariota (o procariótica) y eurocariota (o eucariótica). 2.- Cuándo fue enunciada la Teoría Celular?

Más detalles

ENFERMEDADES GENÉTICAS

ENFERMEDADES GENÉTICAS ENFERMEDADES GENÉTICAS Inicio INDICE 1 Que es una enfermedad genética? 1.1Enfermedades cromosómicas 1.2Enfermedades monogenicas 2. como se heredan? 2.1 Herencia dominante 2.2 Herencia recesiva 2.3 Herencia

Más detalles

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia 5 JUN9.- Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran

Más detalles

ANDALUCIA / SEPTIEMBRE 00. LOGSE / BIOLOGIA / OPCION A / EXAMEN COMPLETO

ANDALUCIA / SEPTIEMBRE 00. LOGSE / BIOLOGIA / OPCION A / EXAMEN COMPLETO OPCION A 1. Retículo endoplásmico (3 puntos). a) Describa la estructura y funciones del retículo endoplásmico rugoso. b) En algunas células esta muy desarrollado el retículo endoplásmico liso. Qué consecuencias

Más detalles

CURSO 2014 2015 CONVOCATORIA: OPCIÓN A

CURSO 2014 2015 CONVOCATORIA: OPCIÓN A PRUEBAS DE ACCESO A LA UNIVERSIDAD MATERIAS DE MODALIDAD: FASES GENERAL Y ESPECÍFICA CURSO 2014 2015 CONVOCATORIA: MATERIA: BIOLOGIA ACLARACIONES PREVIAS: El alumno debe elegir una de las dos opciones,

Más detalles

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C: QUÍMICA

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C: QUÍMICA PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C: QUÍMICA DATOS DEL ASPIRANTE Apellidos: CALIFICACIÓN PRUEBA Nombre: D.N.I. o Pasaporte: Fecha de nacimiento: / / Instrucciones: Lee atentamente

Más detalles

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID

UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID UNIVERSIDADES PÚBLICAS DE LA COMUNIDAD DE MADRID PRUEBA DE ACCESO A LAS ENSEÑANZAS UNIVERSITARIAS DE GRADO MODELO Curso 2010/11 MATERIA: BIOLOGÍA INSTRUCCIONES GENERALES Y VALORACIÓN Estructura de la prueba:

Más detalles

Ejercicios. 1. Qué simbolizan estos esquemas?

Ejercicios. 1. Qué simbolizan estos esquemas? Ejercicios 1. Qué simbolizan estos esquemas? Éste esquema representa la mitocondria, que quema los nutrientes básicos, con la ayuda del oxígeno, obteniendo principalmente energía, que la célula utiliza

Más detalles

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS

GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS GUIA DE LABORATORIO PRACTICA 8 EXTRACCIÓN ADN PROGRAMA DE ENFERMERIA CURSO INTEGRADO DE PROCESOS BIOLOGICOS Leidy Diana Ardila Leal Docente. INTRODUCCIÓN En esta práctica se va a realizar la extracción

Más detalles

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética.

Name Date Class. [Comienzo de Sección 11-1] Por favor pasa a la página 226 para empezar la Sección 11-1, La Ingeniería Genética. [Introducción] Por favor abre tu libro en la página 225. Capítulo 11: La Tecnología de Genes Los científicos trabajan día a día en búsqueda de nuevas formas para el uso de la tecnología genética en beneficio

Más detalles

TRABAJO de VERANO. Biología y Geología. Actividades estivales para alumnado de 4º ESO. www.colegioselvalle.es

TRABAJO de VERANO. Biología y Geología. Actividades estivales para alumnado de 4º ESO. www.colegioselvalle.es TRABAJO de VERANO Actividades estivales para alumnado de 4º ESO Biología y Geología www.colegioselvalle.es UNIDAD 1 Las células y la organización de los seres vivos 1. Escribe los rótulos en las casillas

Más detalles

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA 2 PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA D E S C R I P C I Ó N OBJETO DE LA INVENCIÓN La presente

Más detalles

Genoma y Ensamblado Seminario de Modelos y Métodos cuantitativos (Bioinformática)

Genoma y Ensamblado Seminario de Modelos y Métodos cuantitativos (Bioinformática) Genoma y Ensamblado Seminario de Modelos y Métodos cuantitativos (Bioinformática) Rodrigo Fernández Cristián Maureira Gabriel Zamora Universidad Técnica Federico Santa María 18 de noviembre de 2010 Genoma

Más detalles

AUTOR/PRODUCCIÓN: España. Ministerio de Educación y Ciencia

AUTOR/PRODUCCIÓN: España. Ministerio de Educación y Ciencia TÍTULO DEL VIDEO: Dominancia genética AUTOR/PRODUCCIÓN: España. Ministerio de Educación y Ciencia DURACIÓN: 00:00:39 GÉNERO: No Ficción AÑO: DESCRIPCIÓN: Este video explica en qué consiste la dominancia

Más detalles

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 OBJETIVOS DEL TEMA * Ácidos nucleicos. Composición. Estructura. Tipos. Funciones. * Procesos del dogma

Más detalles

Por y para la piel. A medida que se avanza en la investigación, la piel se va revelando como un órgano implicado en numerosas funciones vitales

Por y para la piel. A medida que se avanza en la investigación, la piel se va revelando como un órgano implicado en numerosas funciones vitales Grupo de Investigación en Daño, Reparación e Ingeniería tisular en epitelios. CIEMAT Por y para la piel Investigadores del CIEMAT desarrollan tratamientos para enfermedades dermatológicas y otras patologías

Más detalles

PRUEBAS DE ACCESO PARA MAYORES DE 25 AÑOS

PRUEBAS DE ACCESO PARA MAYORES DE 25 AÑOS PRUEBAS DE ACCESO PARA MAYORES DE 25 AÑOS CONVOCATORIA DE 2014 EJERCICIO DE: BIOLOGÍA TIEMPO DISPONIBLE: 1 hora 30 minutos PUNTUACIÓN QUE SE OTORGARÁ A ESTE EJERCICIO: (véanse las distintas partes del

Más detalles

TEMA 40 Herencia Cuantitativa

TEMA 40 Herencia Cuantitativa TEMA 40 Herencia Cuantitativa 40.1.- Introducción. Los caracteres que Mendel estudió eran lo que se conocen como genes cualitativos, que marcan características fenotípicas muy diferentes según el alelo

Más detalles

TEMA 4: LA REVOLUCIÓN GENÉTICA

TEMA 4: LA REVOLUCIÓN GENÉTICA TEMA 4: LA REVOLUCIÓN GENÉTICA 1. Introducción Los seres vivos son capaces de hacer copias de sí mismos, de tal modo que los hijos heredan los caracteres de sus padres. Para lograrlo a) Deben almacenar

Más detalles

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA

REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA Tema 4 REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA 1. ADN y ARN pág 92-93 -Composición química y conceptos: ADN, ARN, nucleótidos, bases nitrogenadas, ácido fosfórico. -Estructura: doble hélice, cadenas complementarias.

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles

ALIMENTOS TRANSGÉNICOS Principios básicos y métodos de detección

ALIMENTOS TRANSGÉNICOS Principios básicos y métodos de detección ALIMENTOS TRANSGÉNICOS Principios básicos y métodos de detección CONTENIDO: 1.- INTRODUCCIÓN 2.- BASES BIOLÓGICAS - 2.1.- Qué es la información genética? - 2.2.- Estructura genética y bioquímica - 2.3.-

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

2. Los organizadores nucleares aportan información para la síntesis de: a- ARNm b- ARNr c- ARNt d- Histonas

2. Los organizadores nucleares aportan información para la síntesis de: a- ARNm b- ARNr c- ARNt d- Histonas CBC UBA 2º Parcial Biología (54) Paseo Colon Apellido y Nombre:... DNI...Comisión Nº... Lea atentamente cada pregunta con sus opciones de respuesta. Marque en su grilla la opción correspondiente a la respuesta

Más detalles

HORMONAS Falta poco para concluir tu asignatura no bajes la guardia continua con el mismo ánimo adelante!

HORMONAS Falta poco para concluir tu asignatura no bajes la guardia continua con el mismo ánimo adelante! TERCER ETAPA DE EVALUACION. HORMONAS Falta poco para concluir tu asignatura no bajes la guardia continua con el mismo ánimo adelante! Si perteneces al grupo de las personas que acaban de cumplir 40 años

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética.

Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética. Módulo III (Optativo) Ampliación de Biología-Geología Bloque 2. Unidad 6. Genes y manipulación genética. En Unidades anteriores has estudiado que las características de un ser vivo se deben a sus genes

Más detalles

INSTITUCIÓN EDUCATIVA HECTOR ABAD GOMEZ

INSTITUCIÓN EDUCATIVA HECTOR ABAD GOMEZ Proceso: CURRICULAR INSTITUCIÓN EDUCATIVA HECTOR ABAD GOMEZ Código NOMBRE DEL DOCUMENTO: PLANES DE MEJORAMIENTO Versión 01 Página 1 de 1 ASIGNATURA /AREA CIENCIAS NATURALES GRADO: OCTAVO PERÍODO 1 AÑO:

Más detalles

PROGRAMAS MATERIAS. MAYORES 25 AÑOS Biología

PROGRAMAS MATERIAS. MAYORES 25 AÑOS Biología 1 PROGRAMAS MATERIAS. MAYORES 25 AÑOS Biología Para superar esta prueba, el alumno deberá demostrar tener conocimientos básicos de Biología a nivel de LOGSE. PRESENTACIÓN. La Biología es la ciencia que

Más detalles

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto.

Got es de color negro y es idéntico que su padre que se llamaba Vasito. El segundo toro clonado del proyecto llamado Glass nació muerto. Noticia: Got, el primer toro bravo clonado Nace en Palencia Científicos españoles han clonado con éxito a un semental de la ganadería de toros de lidia de Alfonso Guardiola. Ya está aquí el primer animal

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA AULA DE MAYORES Y DE LA EXPERIENCIA F.Córdoba, R.Torronteras, A.Canalejo Departamento de Biología Ambiental y Salud Pública LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA Tema 1.3. Los sistemas

Más detalles

Slide 1 / 50. Biotecnología

Slide 1 / 50. Biotecnología Slide 1 / 50 Biotecnología Slide 2 / 50 Biotecnología definida La manipulación (mediante la ingeniería genética) de los organismos vivos o sus componentes para producir productos útiles, generalmente comerciales

Más detalles

INSTITUCION EDUCATIVA LOMA HERMOSA PLAN DE MEJORAMIENTO

INSTITUCION EDUCATIVA LOMA HERMOSA PLAN DE MEJORAMIENTO INSTITUCION EDUCATIVA LOMA HERMOSA PLAN DE MEJORAMIENTO ÁREA: Ciencias naturales (biología) GRADO: Noveno. PROFESOR: Rafael Giraldo Jaramillo PERIODO: AÑO 2011 Entregar el trabajo en hojas de block tamaño

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles

BIOTECNOLOGIA PECUARIA

BIOTECNOLOGIA PECUARIA 1ro9ber4to5 BIOTECNOLOGIA PECUARIA La demanda por productos animales ha crecido constantemente y es necesario incrementar la cantidad y calidad de estos productos. En este contexto, en los últimos 20 años

Más detalles

EL ADN y la INGENIERÍA GENÉTICA

EL ADN y la INGENIERÍA GENÉTICA IES LAS VIÑAS MANILVA. MÁLAGA. CMC. Susana Serradilla EL ADN y la INGENIERÍA GENÉTICA EL GENOMA HUMANO GENOMA: Conjunto de genes de un ser vivo. GENOMA HUMANO: Conjunto de genes de la especie humana PROYECTO

Más detalles

ACTIVIDADES DE RECUPERACIÓN 2ª EVALUACIÓN (4º ESO)

ACTIVIDADES DE RECUPERACIÓN 2ª EVALUACIÓN (4º ESO) ACTIVIDADES DE RECUPERACIÓN 2ª EVALUACIÓN (4º ESO) Estas cuestiones de refuerzo a realizar se dividirán en dos partes: - Una primera parte que pretenderá la revisión de conceptos, y que supondrá una calificación

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles

co 2012 2013 la Asignatura VETERINARIA SEGUNDO Nombre de de la asignatura GENÉTICA Créditos Teóricos Periodo Grupos de conocimiento to Genética

co 2012 2013 la Asignatura VETERINARIA SEGUNDO Nombre de de la asignatura GENÉTICA Créditos Teóricos Periodo Grupos de conocimiento to Genética Curso Académic co 2012 2013 VETERINARIA SEGUNDO GENÉTICA GUÍA DOCENTE 1.- Características de la asignatura Nombre de la Asignatura GENÉTICA Totales Créditos Teóricos Prácticos Grupos Teoría Práctica Troncal

Más detalles

Conocimiento del medio 6.º > Unidad 3 > La función de reproducción _

Conocimiento del medio 6.º > Unidad 3 > La función de reproducción _ Conocimiento del medio 6.º > Unidad 3 > La función de reproducción _ 1. Explica brevemente cuáles son las etapas en la vida de una persona. Para ello, indica cómo se denomina cada período, qué edad abarca,

Más detalles

UNIDAD 7 LA DIGNIDAD DE LA VIDA

UNIDAD 7 LA DIGNIDAD DE LA VIDA UNIDAD 7 LA DIGNIDAD DE LA VIDA A) EL EMBRIÓN: fecundación Espermatozoides llegando al ovocito Concepción La carrera por la vida... "Desde el momento mismo de la fecundación, desde el instante en que a

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

La célula. Estas células forman parte de los tejidos de organismos pluricelulares de los reinos fungi, metafita y metazoo.

La célula. Estas células forman parte de los tejidos de organismos pluricelulares de los reinos fungi, metafita y metazoo. La célula Célula Eucarionte: Definición: Estas células forman parte de los tejidos de organismos pluricelulares de los reinos fungi, metafita y metazoo. Poseen formas y tamaños muy variados, de acuerdo

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Genética, Medicina y Sociedad (Síntesis).

Genética, Medicina y Sociedad (Síntesis). Genética, Medicina y Sociedad (Síntesis). Biología. Curtis, et al. (2008). Editorial Médica Interamericana. 7ª Ed. Cap. 16. Por lo general, los principios de la genética son los mismos para cualquier ser

Más detalles

FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General

FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General FLUJO DE LA INFORMACIÓN GENÉTICA REPRODUCCIÓN CELULAR Biología General 1- Diga si son falsas o verdaderas las siguientes afirmaciones con respecto al núcleo celular: I. La envoltura nuclear presenta dos

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles

Resumen de las células madre

Resumen de las células madre Novedades en la investigación de la EH. En lenguaje sencillo. Escrito por científicos. Para toda la comunidad EH. Emocionantes avances de las células madre 'inducidas' Células madre de pacientes con EH:

Más detalles

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica Terapia Génica Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica 5/8/2015 Gen Esta en un cromosoma Es la unidad base de la Herencia Codificación, proteína DNA RNA proteins Proteínas,

Más detalles

P R O G R A M A NOMBRE DEL CURSO: GENÉTICA HUMANA

P R O G R A M A NOMBRE DEL CURSO: GENÉTICA HUMANA P R O G R A M A NOMBRE DEL CURSO: GENÉTICA HUMANA I. Datos Generales Académicos Responsable: Profesores Participantes : Lilian Jara Sosa. José Barón. Programa Genética Humana. (ICBM) Facultad de Medicina.

Más detalles

Transgénicos naturales y transgénicos de laboratorio

Transgénicos naturales y transgénicos de laboratorio Transgénicos naturales y transgénicos de laboratorio Inés Ponce de León Dept. Biología Molecular Instituto de Investigaciones Biológicas Clemente Estable Organismos genéticamente modificados (OGMs) Un

Más detalles

Bioelementos: a) Define el término bioelemento. (0.5) b) Describa el grupo de los bioelementos primarios (1.5)

Bioelementos: a) Define el término bioelemento. (0.5) b) Describa el grupo de los bioelementos primarios (1.5) EJERCICIOS DE LAS P.A.U. Bioelementos: Define el término bioelemento. (0.5) Describa el grupo de los bioelementos primarios (1.5) Los elementos biogénicos se combinan entre sí para formar biomoléculas

Más detalles

La ingeniería genética

La ingeniería genética Objetivos Antes de empezar En esta quincena aprenderás a: Biotecnología moderna. tradicional Ingeniería genética y manipulación del genoma. Alimentos transgénicos. La clonación. El genoma humano Problemas

Más detalles

Ácidos nucleicos: ADN y ARN

Ácidos nucleicos: ADN y ARN Unidad I Genética Ácidos nucleicos: ADN y ARN Definición Los ácidos nucleicos son compuestos orgánicos constituidos por unidades llamadas nucleótidos. Su función principal es transmitir las características

Más detalles

SEMINARIO DE BIOÉTICA E INVESTIGACIÓN. 2ª SESIÓN. 13-4-2010

SEMINARIO DE BIOÉTICA E INVESTIGACIÓN. 2ª SESIÓN. 13-4-2010 FUNDACIÓN CÉSAR NAVARRO SEMINARIO DE BIOÉTICA E INVESTIGACIÓN. 2ª SESIÓN. 13-4-2010 SOBRE EL PONENTE: DRA. ISABEL SÁNCHEZ. La Doctora Isabel Sánchez estudió la carrera en la Universidad de Alcalá y después

Más detalles

S e hereda el cáncer?

S e hereda el cáncer? Se hereda el cáncer? Se hereda el cáncer? Hábitos saludables: Cómo prevenir problemas de salud Predisposición al cáncer hereditario Qué es el consejo genético en cáncer? Qué puedo hacer para mejorar mi

Más detalles

Problemas integradores. Problema 1

Problemas integradores. Problema 1 Problemas integradores Problema 1 La ingeniería genética involucra la manipulación deliberada y racional de los ácidos nucleicos, con el fin de generar nuevas informaciones biológicas con sentido funcional

Más detalles

TEST DE NIVEL BASICO. 1. Únicamente las bacterias Gram negativas tienen: a) Exotoxinas b) Peptidoglicano c) Lipopolisacárido d) Plásmidos

TEST DE NIVEL BASICO. 1. Únicamente las bacterias Gram negativas tienen: a) Exotoxinas b) Peptidoglicano c) Lipopolisacárido d) Plásmidos TEST DE NIVEL BASICO 1. Únicamente las bacterias Gram negativas tienen: a) Exotoxinas b) Peptidoglicano c) Lipopolisacárido d) Plásmidos 2. Los genes de virulencia de una especie bacteriana patógena: a)

Más detalles

Definición de la célula

Definición de la célula Página 1 de 8 La Célula: estructura interna y metabolismo Definición de la célula La célula se entiende como la unidad mínima de un organismo capaz de actuar de manera autónoma en su funcionamiento y reproducción.

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Tema 7.- Genética Molecular. Biología y Geología 4º ESO: Genética Molecular

Tema 7.- Genética Molecular. Biología y Geología 4º ESO: Genética Molecular Tema 7.- Genética Molecular 1 El ADN, la molécula de la herencia El ADN (ácido desoxirribonucléico), es el portador de la información genética y es el responsable de las características biológicas de un

Más detalles

cromátidas centrómero cromosoma

cromátidas centrómero cromosoma núcleo en interfase fibra de cromatina cromátidas centrómero cromosoma 2n = 46 cromátidas cromosomas homólogos Los genes están formados por genes alelos segmentos de ADN y se encuentran situados en los

Más detalles

ACTIVIDADES TEMA 3: LA REVOLUCIÓN GENÉTICA

ACTIVIDADES TEMA 3: LA REVOLUCIÓN GENÉTICA ACTIVIDADES TEMA 3: LA REVOLUCIÓN GENÉTICA 1- Dado el ADN de secuencia CATACTGGCTGGTACCAACTGAGC, escribe: a) La secuencia del ARNm que se deriva se él. b) La secuencia de la cadena complementaria de ADN.

Más detalles

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes:

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes: TEMA 4: AVANCES BIOMÉDICOS 1.- TRASPLANTES DE ÓRGANOS Trasplante o injerto en medicina es un tratamiento médico complejo que consiste en trasladar órganos, tejidos o células de una persona a otra. El órgano

Más detalles

Terapia celular con células madre: una reflexión sobre el pasado y una mirada hacia el futuro

Terapia celular con células madre: una reflexión sobre el pasado y una mirada hacia el futuro LOS EXPERTOS RESPONDEN Terapia celular con células madre: una reflexión sobre el pasado y una mirada hacia el futuro Felipe Prósper. Servicio de Hematología y Area de Terapia Celular. Clínica Universidad

Más detalles

BIOLOGÍA-GEOLOGÍA 4º E.S.O. CRITERIOS DE EVALUACIÓN, CALIFICACIÓN Y CONTENIDOS MÍNIMOS

BIOLOGÍA-GEOLOGÍA 4º E.S.O. CRITERIOS DE EVALUACIÓN, CALIFICACIÓN Y CONTENIDOS MÍNIMOS BIOLOGÍA-GEOLOGÍA 4º E.S.O. CRITERIOS DE EVALUACIÓN, CALIFICACIÓN Y CONTENIDOS MÍNIMOS 1. CRITERIOS DE EVALUACIÓN UNIDAD 1: LA CÉLULA UNIDAD DE VIDA 1.1. Conocer los principales hitos en el estudio de

Más detalles

ADN, con capacidad autoreplicativa.. Se introducen dentro hospedadora y en general, producen un gran numero de copias.

ADN, con capacidad autoreplicativa.. Se introducen dentro hospedadora y en general, producen un gran numero de copias. Vectores Plásmidos o Vectores Son moléculas pequeñas de ADN doble cadena y circular. Vectores de clonado, son pequeñas moléculas de ADN, con capacidad autoreplicativa.. Se introducen dentro de la célula

Más detalles

J. L. Sánchez Guillén. IES Pando - Oviedo Departamento de Biología y Geología 1

J. L. Sánchez Guillén. IES Pando - Oviedo Departamento de Biología y Geología 1 J. L. Sánchez Guillén IES Pando - Oviedo Departamento de Biología y Geología 1 LOS ÁCIDOS NUCLEICOS CONCEPTO: Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Dieta genética para prevenir enfermedades? La clonación, el ADN y otras cosas Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética

Más detalles

Tema 22.- HERENCIA MENDELIANA. Introducción a la Genética Humana: tipos de herencia. Herencia monogénica mendeliana

Tema 22.- HERENCIA MENDELIANA. Introducción a la Genética Humana: tipos de herencia. Herencia monogénica mendeliana BIBLIOGRAFÍA Jorde, Carey, Bamshad. Genética médica. Editorial Elsevier Mosby, 4ª Ed. (2011) Nussbaum, McInnes, Willard. (Thompson&Thompson). Genética en medicina. Editorial Elservier Masson, 5ª/7ª Ed.

Más detalles

U N U N I V E R S O L L E N O D E S O R P R E S A S JULIO 2007 y

U N U N I V E R S O L L E N O D E S O R P R E S A S JULIO 2007 y U N U N I V E R S O L L E N O D E S O R P R E S A S JULIO 2007 y Recomendación de HÉLIX POR: Adrián Morales Flores (12 años) Título: El cuerpo humano a tu alcance Autor: Serge Montagnat Editorial: Oniro

Más detalles

CUESTIONES SELECTIVIDAD: ORGÁNULOS CELULARES

CUESTIONES SELECTIVIDAD: ORGÁNULOS CELULARES CUESTIONES SELECTIVIDAD: ORGÁNULOS CELULARES 1) En relación con la figura adjunta, responda las siguientes cuestiones a) Indique si se trata de una célula animal o vegetal (0.2)Nombre tres criterios en

Más detalles