Flujo de información en la célula Transcripción

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Flujo de información en la célula Transcripción"

Transcripción

1 Flujo de información en la célula Transcripción Proceso de síntesis de ARN dirigido por el ADN. Una hebra es copiada (hebra molde) Relacionado con expresión génica Algunas regiones que se transcriben no son traducidas a proteínas (ARNr, ARNt, ARNpn) Proceso similar a replicación 1 2 Diferencias con replicación: Uso de ribonucleótidos Uracilo por Timina Tipos de ARN Propiedades comunes: Todos son producidos por transcripción Todos cumplen un papel en la síntesis proteica Generalmente con estructuras secundarias y terciarias complejas Adición de nucleótidos por RNA Polimerasa Formación temporal de un duplex ADN-ARN El producto es de cadena simple 3 4

2 ARN celulares, abundancia y función Características de la transcripción 6 % 80% 10% 4 % La transcripción está fuertemente regulada. Apenas un 0.01% de los genes se está expresando en una célula eucariota en un momento dado. Dirigido por una ARN Polimerasa Una hebra de ADN sirve de molde La enzima no requiere cebador La enzima elonga una cadena en dirección 5`-3` Formación de enlace 3-5 fosfodiéster La síntesis sólo se inicia en secuencias específicas llamadas promotores Desenrrollamiento parcial del ADN 5 6 Nomenclatura transcripcional Una hebra de ADN sirve de molde (hebra molde) ARN polimerasa bacteriana Unica ARNPolimerasa bacteriana Multímero de varias subunidades subunidad σ70 se une a secuencias específicas en las posiciones 10 y 35 del promotor El transcripto es igual a la hebra codificante y complementario a la hebra molde la subunidad α queda en posición upstream (Sense) (Antisense) CCTTACTTACTGTTACGCCG GGAATGCCTGACAATGCGGC CCUUACUUACUGUUACGCCG las subunidades b y b se asocian con el sitio de inicio el sitio de inicio de la transcripción es +1 downstream = dirección de la transcripción 7 8

3 Promotores bacterianos Modelo de la ARN Polimerasa bacteriana El modelo muestra la interacción de la holoenzima con el promotor formando el complejo abierto. Hebra molde en gris 9 10 Transcripción en bacterias: iniciación El proceso de la transcripción 1. Reconimiento de la hebra molde Unión de la polimerasa al promotor (Formación de un complejo cerrado) Formación de una burbuja de ADN de cadena simple (complejo abierto) 2. Iniciación Síntesis de los primeros 9 o 10 nucleótidos Varios eventos abortivos, donde el ARN es liberado Pasado este punto (10 nucleótidos) se libera sigma y comienza la longación 11 12

4 Transcripción en bacterias: elongación Terminación transcripcional en bacterias Reconocimiento de señales particulares que indican donde terminar la síntesis La burbuja de transcripción se desestabiliza y colapsa liberándose el ARN Rho independiente bucle autocomplementario Rho dependiente proteína Rho se une al ARN Varios eventos abortivos, donde el ARN es liberado Pasado este punto (10 nucleótidos) se libera sigma y comienza la elongación Adición de nucleótidos al extremo 3 hidroxilo de la cadena creciente Diferencias entre la transcripción procariota y eucariota ARN polimerasas eucariotas ARNm policistrónico transcripción y traducción acopladas ARN Polimerasa única ARNm monocistrónico transcripción y procesamiento acoplados 3 ARN Polimerasas diferentes INCAPACES DE RECONOCER EL PROMOTOR Polimerasa localización genes transcritos inhibición por a-amanitina Pol I nucleolo ARNr insensible Pol II nucleoplasma ARNm, ARNpn muy sensible Pol III nucleoplasma ARNt, ARNr 5S sensible 15 16

5 La polimerasa II eucariota es similar a la bacteriana......aunque más compleja Proteínas ARN Polimerasas Factores de Transcripción Modificadores Transcripción en eucariotas Factores específicos Polimerasa II Factores generales Todas las polimerasas eucariotas necesitan Factores Transcripcionales basales para reconocer los promotores e iniciar la transcripción Iniciación en eucariotas Modificadores 19 Señales Promotores Potenciadores 20

6 Promotores regulados eucariotas Secuencias de reconocimiento específico para Factores de Transcripción Estructura modular Factores transcripcionales Proteínas de unión a sitios específicos de ADN Se asocian a Promotores y potenciadores Estructura modular: dominios de unión al ADN dominios de activación Los Factores Transcripcionales son proteínas de unión al ADN Reconocen secuencias específicas en promotores y potenciadores Se ensamblan cooperativamente sobre el ADN mediante interacciones proteína-proteína Potenciadores Activación de la Transcripción Potenciadores (enhancers) reguladores en cis Función a distancia Independientemente de orientación Sitios de union a factores de transcripción 23 24

7 Los factores de transcripción específicos colaboran en el ensamblado del complejo de iniciación Existen activadores, represores y mediadores Factores específicos colaboran para colocar los FBasales en el promotor y éstos posicionan las polimerasas La mayoría de los genes regulados por factores transcripcionales múltiples Los factores basales se ensamblan secuencialmente y posicionan la ARN polimerasa Elongación en eucariotas, el papel del CTD CTD- CARBOXI TERMINAL DOMAIN de la RNA Polimerasa II c/repetidos de 7 péptidos (26-52aa) Unicos a pol II Su fosforilación es esencial para la elongación La fosforilación depende de uno de los factores generales 27 28

8 PROCESAMIENTO DE ARN EN EUCARIOTAS El ciclo transcripcional eucariota Todo ARN se procesa. Los ARNr se transcriben juntos y por corte se generan fragmentos menores. Los ARNt se procesan y sufren modificaciones de bases. Los ARNm sufren 4 tipos de modificaciones: - Capping. -Cola poli A. - Corte y empalme de intrones (Splicing) -Editing Transcripción Y Procesamiento de ARNr Genes dispuestos en tándem: aproximadamente 200 copias de genes de ARNr en Genoma Humano (Cromosomas con satélites). En interfase se ven como Nucleolos: zonas de transcripción y unión a proteínas ribosómicas. Unidad Transcripcional Ribosomal Transcriptos como un gran precursor policistrónico de nt (ARNr 45S). Los transcriptos son metilados Procesados secuencialmente (degradación de las secuencias intermedias) 31 32

9 Transcripción y Procesamiento del ARNt Transcriptos como mono o policistrónicos Los transcriptos son procesados secuencialmente Formación del trébol Degradación de extremos y adición de brazo aceptor CCA Eliminación de intrones Modificación de bases Modificaciones de bases en el ARNt Procesamiento de los ARN mensajeros Capping Estructura de la Caperuza

10 Poliadenilación en extremo 3 El mecanismo de la Poliadenilación Proceso secuencial dependiente de : Reconocimiento de secuencias en el transcripto Interacción ARN-proteinas específicas Interacción proteína-proteína Corte y empalme (splicing( splicing) ) de intrones y exones Hibridación ADN-ARN ARN el gen de la ovoalbúmina 39 40

11 El proceso de corte y empalme Tipos de intrones Ensamblado secuencial de partículas riboproteicas (SNURPs) Apareamiento de bases con el mrna Corte y empalme Liberación del intrón U1 snrnp U2 snrnp GU intron A AG Pre mrna U4, U6, U5 snrnp Salida del intron Ligacion de los exones Reconocimiento de señales de procesamiento El spliceosoma Estructura riboproteica encargada del procesamiento de los intrones Apareamiento de bases del ARN precursor con el ARN del SNURP Ensamblado secuencial de partículas riboproteicas (SNURPs) 43 44

12 El splicing consiste en dos transesterificaciones sucesivas Ribozimas ARN que elimina sus propios intrones ARN que elimina intrones de otros ARN ARN que cataliza su propia replicación TIPO I Algunos genes de ARNr Estructura terciaria de un intron tipo I de un ARN de Tetrahymena que se autoelimina del resto del ARN TIPO II Mitocondria y cloroplastos Una visión moderna de la expresión génica 47

Flujo de información en la célula

Flujo de información en la célula 1 Flujo de información en la célula Transcripción Proceso de síntesis de ARN dirigido por el ADN. Una hebra es copiada (hebra molde) Relacionado con expresión génica Algunas regiones que se transcriben

Más detalles

Orígenes de replicación en los cromosomas eucariotas

Orígenes de replicación en los cromosomas eucariotas Orígenes de replicación en los cromosomas eucariotas REPLICON: unidad del DNA en la cual ocurren actos individuales de replicación. El replicón contiene un origen donde comienza la replicación y un final

Más detalles

Tema 8. Funcionamiento del DNA (I)

Tema 8. Funcionamiento del DNA (I) Tema 8. Funcionamiento del DNA (I) Genética CC. Mar 2004-05 Objetivos Transcripción RNAs y procesamiento Genética CC Mar 2004/5 D. Posada, Universidad de Vigo 2 1 Dogma Central de la Biología Molecular

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge TRANSCRIPCIÓN INTRODUCCIÓN En las rutas de transmisión de la información genética, se denomina transcripción al proceso de trasvase de la información contenida en el ADN, a la molécula de ARN. Constituye

Más detalles

La síntesis de proteínas

La síntesis de proteínas La síntesis de proteínas La Transcripción La información para fabricar todas las proteínas está almacenada en las moléculas de ADN de los cromosomas. La sucesión de bases en las moléculas de ADN es un

Más detalles

Tema 17: PROCESAMIENTO POST-TRANSCRIPCIONAL

Tema 17: PROCESAMIENTO POST-TRANSCRIPCIONAL Tema 17: PROCESAMIENTO POST-TRANSCRIPCIONAL Tipos de ARN: ARNm, ARNr, ARNt, ARNhn, ARNsn, ARNsc Procesamiento en procariotas Procesamiento en eucariotas ARNm: Adición de caperuza y poli(a) Edición Splicing

Más detalles

ARN mensajero. Síntesis y procesamiento. Corte y empalme. Capping. Poliadenilación. Estabilidad. Genética 1 er Curso. Facultad de Medicina TEMA 0-3

ARN mensajero. Síntesis y procesamiento. Corte y empalme. Capping. Poliadenilación. Estabilidad. Genética 1 er Curso. Facultad de Medicina TEMA 0-3 Facultad de Medicina Genética 1 er Curso TEMA 0-3 EXPRESIÓN GÉNICA: TRANSCRIPCIÓN Y TRADUCCIÓN ARN mensajero. La transcripción en eucariotas. Ribosomas. La traducción. ARN mensajero Apartados Síntesis

Más detalles

Control de Expresión Génica Procariota. Profesor: Javier Cabello Schomburg, MS

Control de Expresión Génica Procariota. Profesor: Javier Cabello Schomburg, MS Control de Expresión Génica Procariota Profesor: Javier Cabello Schomburg, MS Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la

Más detalles

Genética molecular (II)

Genética molecular (II) Genética molecular (II) ESTRUCTURA DE UN GEN Cada molécula de ADN está formada por una sucesión de genes. Desde un punto de vista molecular un gen es una unidad de transcripción (desde el punto de vista

Más detalles

TEMA 3: Expresión Génica

TEMA 3: Expresión Génica TEMA 3: Expresión Génica Genómica Estructural: composición de los Genomas ADN Génico y Relacionado: 37% (1.5% CODIFICANTE, EXONES!!) ADN No Codificante: 63% (44 % ELEMENTOS TRANSPONIBLES) 1.5% 44% CONCEPTO

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles

ADN. Estructura primaria del ADN. Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótidos

ADN. Estructura primaria del ADN. Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótidos GENÉTICA MOLECULAR ADN ESTRUCTURA ADN Estructura primaria del ADN Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótidos Azúcar; desoxirribosa Bases nitrogenadas;

Más detalles

Transcripción Gen Transcripción (hebra codificante 5-3 ) templado o molde (3-5 ) catalizada por la ARN polimerasa

Transcripción Gen Transcripción (hebra codificante 5-3 ) templado o molde (3-5 ) catalizada por la ARN polimerasa Transcripción Gen: unidad de ADN que contiene la información para especificar la síntesis de un polipéptido o de un ARN funcional (ARNt, ARNr) Transcripción es la síntesis de una cadena de ARN que representa

Más detalles

TEMA 14. Fisiología celular. Genética molecular.

TEMA 14. Fisiología celular. Genética molecular. TEMA 14. Fisiología celular. Genética molecular. La genética molecular es la parte de la Biología que se encarga de estudiar las moléculas que contienen, transmiten de una generación a la siguiente y permiten

Más detalles

Regulación génica. Necesaria tanto en procariotas como eucariotas. Todas las células del cuerpo tienen el mismo material genético

Regulación génica. Necesaria tanto en procariotas como eucariotas. Todas las células del cuerpo tienen el mismo material genético Regulación génica Necesaria tanto en procariotas como eucariotas Todas las células del cuerpo tienen el mismo material genético Bacterias responden a su ambiente expresando los genes apropiados. Economía

Más detalles

Dogma Central de la Biología Molecular

Dogma Central de la Biología Molecular Replicación Dogma Central de la Biología Molecular Ciclo celular Modelo semiconservador Comprobación Polimerización Procariontes (Modelo Theta) Procariontes y Eucariontes Mitocondrias Origen de la replicación

Más detalles

Capítulo 12 REGULACIÓN DE LA EXPRESIÓN GÉNICA. Factores de Transcripción. Metilación. Procesamiento del ARN. Post-traduccional

Capítulo 12 REGULACIÓN DE LA EXPRESIÓN GÉNICA. Factores de Transcripción. Metilación. Procesamiento del ARN. Post-traduccional REGULACIÓN DE LA EXPRESIÓN GÉNICA - Mecanismos de Regulación Regulación Procariontes Eucariontes Operón Lactosa Operón Triptofano Transcripcional Procesamiento del ARN Traduccional Post-traduccional Factores

Más detalles

III. Material genético. b. Composición y estructura del RNA.

III. Material genético. b. Composición y estructura del RNA. III. Material genético b. Composición y estructura del RNA. RNA (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa: en la posición 2' del anillo del azúcar hay un grupo

Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles

transcripción en procariotas

transcripción en procariotas transcripción en procariotas Síntesis de RNA La síntesis de RNA generalmente se inicia con ATP or GTP (primer nucleótido) Las cadenas de RNA son sintetizadas de 5 a 3 1 RNA polimerasa-dirigida por DNA

Más detalles

ADN, ARN Y SÍNTESIS DE PROTEÍNAS

ADN, ARN Y SÍNTESIS DE PROTEÍNAS UNIVERSIDAD DEL VALLE DE GUATEMALA CU125 - CIENCIAS NATURALES FLOR DE MARÍA PELÁEZ ADN, ARN Y SÍNTESIS DE PROTEÍNAS DIEGO FERNANDO GODOY RECKHOLDER #09602 OSCAR ALESSANDRO REYES LICO #09565 10 de marzo

Más detalles

BIOQUÍMICA-1º de Medicina Dpto. Biología Molecular Isabel Andrés. Generalidades sobre la transcripción

BIOQUÍMICA-1º de Medicina Dpto. Biología Molecular Isabel Andrés. Generalidades sobre la transcripción . Síntesis y maduración del RNA. Tipos y estructuras de RNAs. RNA polimerasas en los organismos procariotas y eucariotas. Promotores. Mecanismo de iniciación de la transcripción. Elongación. Terminación.

Más detalles

TEMA 4: DEL DESCUBRIMIENTO DE LOS ÁCIDOS NUCLEICOS A LA BIOTECNOLOGÍA

TEMA 4: DEL DESCUBRIMIENTO DE LOS ÁCIDOS NUCLEICOS A LA BIOTECNOLOGÍA TEMA 4: DEL DESCUBRIMIENTO DE LOS ÁCIDOS NUCLEICOS A LA BIOTECNOLOGÍA EL ADN, LA MOLÉCULA DE LA HERENCIA El ADN (ácido desoxirribonucleico) es la molécula portadora de la información genética que forma

Más detalles

Cátedra Biología Molecular

Cátedra Biología Molecular Teórico Práctico de Problemas Nº 2 Replicación. PCR. Transcripción en procariotas y eucariotas. Regulación de la expresión génica. 1. Indique la o las respuestas correctas a. Los factores de transcripción

Más detalles

GENÉTICA MOLECULAR. El ADN, LA MOLÉCULA DE LA HERENCIA

GENÉTICA MOLECULAR. El ADN, LA MOLÉCULA DE LA HERENCIA GENÉTICA MOLECULAR El ADN, LA MOLÉCULA DE LA HERENCIA INTRODUCCIÓN: COMENCEMOS PREGUNTÁNDONOS Qué significan estas dos palabras? GENÉTICA MOLECULAR Estudio de la genética (genes) desde el punto de vista

Más detalles

TEMA 15 LOS GENES Y SU FUNCIÓN. IES Enric Valor Nieves Martinez Danta 1

TEMA 15 LOS GENES Y SU FUNCIÓN. IES Enric Valor Nieves Martinez Danta 1 TEMA 15 LOS GENES Y SU FUNCIÓN IES Enric Valor Nieves Martinez Danta 1 1-La replicación semiconservativa del ADN 2- El mecanismo de la replicación 3- La expresión del mensaje genético 4- El mecanismo de

Más detalles

Los genes se expresan con diferente eficiencia

Los genes se expresan con diferente eficiencia De ADN a proteína Los genes se expresan con diferente eficiencia El mecanismo de transcripción Diferentes clases de ARN s Transcripción en bacterias La cadena codificante tiene la misma secuencia que el

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

EL A.D.N. Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN

EL A.D.N. Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN EL A.D.N Existen 2 tipos de Acidos Nucleicos : ADN (Acido Desoxirribonucleico) y ARN (Acido Ribonucleico) Diferencias entre ADN y ARN Hay tres tipos netamente diferenciados de ARN, tanto en su estructura

Más detalles

En las células se encuentran dos variedades de ácidos nucleicos: el ácido ribonucleico (ARN)

En las células se encuentran dos variedades de ácidos nucleicos: el ácido ribonucleico (ARN) Ácidos Nucleicos Características generales de los ácidos nucleicos En las células se encuentran dos variedades de ácidos nucleicos: el ácido desoxirribonucleico (ADN). el ácido ribonucleico (ARN) El ADN

Más detalles

Acidos Nucleicos. Cap.3 Dra. Millie L. González

Acidos Nucleicos. Cap.3 Dra. Millie L. González Acidos Nucleicos Cap.3 Dra. Millie L. González Acidos Nucleicos Los ácidos nucleicos son de suma importancia para las células, ya que almacenan, transmiten y expresan la información genética Son polímeros

Más detalles

GENÉTICA MOLECULAR 1865 MENDEL PRESENTA SU PUBLICACIÓN SOBRE LAS LEYES DE LA HERENCIA 1928 GRIFFITH DESCUBRE EL PRINCIPIO TRANSFORMANTE

GENÉTICA MOLECULAR 1865 MENDEL PRESENTA SU PUBLICACIÓN SOBRE LAS LEYES DE LA HERENCIA 1928 GRIFFITH DESCUBRE EL PRINCIPIO TRANSFORMANTE 1865 MENDEL PRESENTA SU PUBLICACIÓN SOBRE LAS LEYES DE LA HERENCIA 1928 GRIFFITH DESCUBRE EL PRINCIPIO TRANSFORMANTE 1 9 4 4 A V E R Y Y M C L E O D D E S C U B R E N Q U E P R I N C I P I O TRANSFORMANTE

Más detalles

Tema V. Transcripción en eucariontes

Tema V. Transcripción en eucariontes Tema V. Transcripción en eucariontes Procariontes 1. Todas las especies de RNA son sintetizadas por la misma especie de RNA polimerasa. 2. El mrna se traduce durante la transcripción. 3. Los genes son

Más detalles

Proceso conservativo (El ADN utilizado va a permanecer intacto) y selectivo (se selecciona la parte de información genética que se transcribe)

Proceso conservativo (El ADN utilizado va a permanecer intacto) y selectivo (se selecciona la parte de información genética que se transcribe) Características generales de la transcripción Proceso conservativo (El ADN utilizado va a permanecer intacto) y selectivo (se selecciona la parte de información genética que se transcribe) Selección del

Más detalles

Tema 15: DEL ADN A LAS PROTEÍNAS (EXPRESIÓN GÉNICA)

Tema 15: DEL ADN A LAS PROTEÍNAS (EXPRESIÓN GÉNICA) Tema 15: DEL ADN A LAS (EXPRESIÓN GÉNICA) 1.- EL ADN COMO MATERIAL HEREDITARIO 2.- ESTRUCTURA DEL GENOMA Y SU EXPRESIÓN 3.- FLUJO DE INFORMACIÓN GENÉTICA 4.- TRANSCRIPCIÓN: SÍNTESIS DEL ARN 5.- MADURACIÓN

Más detalles

Objetivos del tema. El alumno... Aplicación. Comprensión. Conocimiento VI. TRANSCRIPCIÓN Y PROCESAMIENTO DEL RNA

Objetivos del tema. El alumno... Aplicación. Comprensión. Conocimiento VI. TRANSCRIPCIÓN Y PROCESAMIENTO DEL RNA Objetivos del tema VI. TRANSCRIPCIÓN Y PROCESAMIENTO DEL RNA El alumno... Revisará como se expresa la información genética, identificando los factores involucrados en este proceso: DNA y proteínas. Reconocerá

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Tema 15. EXPRESIÓN DE LA INFORMACIÓN GENÉTICA

Tema 15. EXPRESIÓN DE LA INFORMACIÓN GENÉTICA Tema 15. EXPRESIÓN DE LA INFORMACIÓN GENÉTICA La transmisión de la información: el dogma central de la biología Dos problemas que se plantearon, una vez conocida la estructura del ADN, fueron: cómo se

Más detalles

Clave Genética y Síntesis de Proteínas

Clave Genética y Síntesis de Proteínas UNIVERSIDAD DE SAN CARLOS DE GUATEMALA FACULTAD DE CIENCIAS MÉDICAS FASE I, Unidad Didáctica: BIOQUÍMICA MÉDICA 2º AÑO CICLO ACADÉMICO 2,011 Clave Genética y Síntesis de Proteínas Dr. Mynor A. Leiva Enríquez

Más detalles

DUPLICACION DEL ADN. Dra Carmen Aída Martínez

DUPLICACION DEL ADN. Dra Carmen Aída Martínez DUPLICACION DEL ADN Dra Carmen Aída Martínez Definción El proceso de replicación de ADN es el mecanismo que permite al ADN duplicarse (es decir, sintetizar una copia idéntica) Replicación La reproducción

Más detalles

Machete 6: Unidad 4, Capítulo 1

Machete 6: Unidad 4, Capítulo 1 Machete 6: Unidad 4, Capítulo 1 Una de las alternativas que, desde, te ofrecemos para acompañarte en el estudio de esta materia, son las tutorías presenciales. En el campus encontrarás el Cronograma de

Más detalles

REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA

REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA Niveles de organización de los seres humanos Biología Molecular Básica e Ingeniería Genética T.M. Claudia Troncoso M. Regulación expresión génica Diversidad

Más detalles

Organización y estructura de genomas

Organización y estructura de genomas Organización y estructura de genomas ORGANIZACIÓN DE LOS GENOMAS 1. Un gen es un segmento de DNA que al expresarse da un producto funcional que puede ser una proteína o un RNA. 2. Un genoma es el conjunto

Más detalles

Acción y Regulación de los Genes. Cátedra de Genética FAZ - UNT

Acción y Regulación de los Genes. Cátedra de Genética FAZ - UNT Acción y Regulación de los Genes Concepto de Gen. Contenidos a desarrollar Dogma Central de la Biología Molecular. Expresión de la acción génica en los procesos metabólicos: Postulados de Garrod. El Código

Más detalles

Organización del genoma eucariotico. 1. Complejidad del genoma eucariota

Organización del genoma eucariotico. 1. Complejidad del genoma eucariota Organización del genoma eucariotico Procariotas: Prácticamente todo el ADN existe en forma de copia única y codifica productos génicos (proteínas y ARNs) Eucariotas: La mayor parte del ADN es NO codificante.

Más detalles

PROCESAMIENTO Y MADURACIÓN DE LOS ARNs BIOSÍNTESIS DE MACROMOLÉCULAS, GRADO BIOQUÍMICA

PROCESAMIENTO Y MADURACIÓN DE LOS ARNs BIOSÍNTESIS DE MACROMOLÉCULAS, GRADO BIOQUÍMICA PROCESAMIENTO Y MADURACIÓN DE LOS ARNs BIOSÍNTESIS DE MACROMOLÉCULAS, GRADO BIOQUÍMICA 1 FORMACIÓN 5 CAP No codificado por la secuencia, es una modificación del ARN. Adicción de una Guanina memlada al

Más detalles

DOGMA CENTRAL DE LA BIOLOGIA

DOGMA CENTRAL DE LA BIOLOGIA La única diferencia entre las moléculas de ADN de distintos individuos es el orden en el que se disponen sus nucleótidos; lo que se denomina secuencia. Los nucleótidos se ordenan a modo de palabras que

Más detalles

Tema 15. DEL ADN A LAS PROTEÍNAS

Tema 15. DEL ADN A LAS PROTEÍNAS Tema 15. DEL ADN A LAS PROTEÍNAS EL ADN COMO MATERIAL HEREDITARIO. La primera evidencia de que el ADN es el material hereditario fue obtenida en 1928 por Griffith, que al buscar la vacuna contra la neumonía,

Más detalles

UNIDAD 1: Introducción a la biología

UNIDAD 1: Introducción a la biología UNIVERSIDAD DEL TOLIMA FACULTAD DE CIENCIAS BÁSICAS PROGRAMA DE MATEMÁTICAS CON ÉNFASIS EN ESTADÍSTICA MICROCURRICULO ASIGNATURA: OPTATIVA EN BIOLIGÍA CONTENIDOS UNIDAD 1: Introducción a la biología Explicar

Más detalles

DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR (Francis Crick 1970) (Excepción de la transcriptasa inversa) ADN Transcripción ARN traducción PROTEINAS

DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR (Francis Crick 1970) (Excepción de la transcriptasa inversa) ADN Transcripción ARN traducción PROTEINAS DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR (Francis Crick 1970) (Excepción de la transcriptasa inversa) ADN Transcripción ARN traducción PROTEINAS TRANSCRIPCIÓN DEL CÓDIGO: BIOSÍNTESIS DE ARN Se sintetiza

Más detalles

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre.

Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Los elementos químicos más abundantes en los seres vivos son: Agua y proteínas. Carbono, oxígeno, hidrógeno, nitrógeno, fósforo y azufre. Glúcidos, lípidos, proteínas, ácidos nucleicos. Oxígeno, calcio,

Más detalles

REGULACIÓN GENÉTICA EN CÉLULAS EUCARIOTAS

REGULACIÓN GENÉTICA EN CÉLULAS EUCARIOTAS REGULACIÓN GENÉTICA EN CÉLULAS EUCARIOTAS INFORMACIÓN GENÉTICA GENOMA TRANSCRIPTOMA PROTEOMA CONTROL DE LA EXPRESIÓN GENÉTICA En un organismo multicelular existen muchos tipos celulares (diferenciación)

Más detalles

La transcripción en eucariótas

La transcripción en eucariótas La transcripción en eucariótas RNA POLIMERASA I La Pol I es un enzima que contiene 13 subunidades y un peso molecular de 600 Kd. Se sabe que necesita al menos de dos factores de transcripción. Transcribe

Más detalles

TEMA 14. LA BASE MOLECULAR DE LA HERENCIA.

TEMA 14. LA BASE MOLECULAR DE LA HERENCIA. TEMA 14. LA BASE MOLECULAR DE LA HERENCIA. 1. Introducción. Desde que Watson y Crick dieron a conocer la estructura en doble hélice del ADN se inició el desarrollo de una nueva rama de la genética. Esta

Más detalles

2. La dirección en la que las ARN polimerasas sintetizan ARN es siempre 5'P 3'OH. 2. Elementos que participan en la transcripción.

2. La dirección en la que las ARN polimerasas sintetizan ARN es siempre 5'P 3'OH. 2. Elementos que participan en la transcripción. Clase 9. Del DNA a las proteínas. Transcripción. 1. Características de la transcripción: COMPLEMENTARIDAD, DIRECCIÓN Y ASIMETRÍA 2. Elementos que participan en la transcripción. 3. La molécula de DNA es

Más detalles

MODELO BIOLOGÍA 2º PARCIAL 54

MODELO BIOLOGÍA 2º PARCIAL 54 1) Durante la profase mitótica, una célula humana presenta: a. 92 moléculas de ADN (46 cromosomas de 2 cromátides cada uno). b. 46 moléculas de ADN (46 cromosomas de 1 cromátide cada uno). c. 46 moléculas

Más detalles

NIVELES DE ORGANIZACIÓN DEL ADN.

NIVELES DE ORGANIZACIÓN DEL ADN. TEMA 4. Modos de información genética. Acidos nucleicos: ADN y ARN. Estructura polarizada del ADN. Cromatina, cromosomas, gen, cistrón, genotipo y fenotipo. Duplicación semiconservativa de la información

Más detalles

2. Los organizadores nucleares aportan información para la síntesis de: a- ARNm b- ARNr c- ARNt d- Histonas

2. Los organizadores nucleares aportan información para la síntesis de: a- ARNm b- ARNr c- ARNt d- Histonas CBC UBA 2º Parcial Biología (54) Paseo Colon Apellido y Nombre:... DNI...Comisión Nº... Lea atentamente cada pregunta con sus opciones de respuesta. Marque en su grilla la opción correspondiente a la respuesta

Más detalles

TEMA 14: LA BASE MOLECULAR DE LA HERENCIA Y MUTACIONES EL ADN, PORTADOR DE LA INFORMACIÓN GENÉTICA

TEMA 14: LA BASE MOLECULAR DE LA HERENCIA Y MUTACIONES EL ADN, PORTADOR DE LA INFORMACIÓN GENÉTICA TEMA 14: LA BASE MOLECULAR DE LA HERENCIA Y MUTACIONES EL ADN, PORTADOR DE LA INFORMACIÓN GENÉTICA 1.1 Características del ADN como portador de la información 1.2 Experimentos que confirmaron que el ADN

Más detalles

PROCESOS GENÉTICOS DE LA SÍNTESIS DE PROTEÍNAS: LA TRANSCRIPCIÓN

PROCESOS GENÉTICOS DE LA SÍNTESIS DE PROTEÍNAS: LA TRANSCRIPCIÓN PROCESOS GENÉTICOS DE LA SÍNTESIS DE PROTEÍNAS: LA TRANSCRIPCIÓN Jacob Monod Cech Pribnow Fundamento Central de la Biología Molecular: "Dogma central de la Biología Molecular". Transcripción. Las ARN polimerasas

Más detalles

ACTIVIDADES 2º BACHILLERATO C. Y T. GENÉTICA MOLECULAR

ACTIVIDADES 2º BACHILLERATO C. Y T. GENÉTICA MOLECULAR ACTIVIDADES 2º BACHILLERATO C. Y T. GENÉTICA MOLECULAR 1. a) Explica con detalle el proceso de síntesis de ARN en el núcleo de una célula b) Indica tres tipos de ARN señalando el papel que desempeñan en

Más detalles

Ácidos nucleicos. 3ª y 4ª Parte: Transcripción y traducción I & II. Tema 12 de Biología NS Diploma BI Curso 2012-2014

Ácidos nucleicos. 3ª y 4ª Parte: Transcripción y traducción I & II. Tema 12 de Biología NS Diploma BI Curso 2012-2014 Ácidos nucleicos 3ª y 4ª Parte: Transcripción y traducción I & II Tema 12 de Biología NS Diploma BI Curso 2012-2014 Expresión de la información genética Ya se ha visto cómo la información genética se conserva

Más detalles

Complejo de iniciación de la transcripción Fosforilación de el CTD de la ARN pol II

Complejo de iniciación de la transcripción Fosforilación de el CTD de la ARN pol II Complejo de iniciación de la transcripción Fosforilación de el CTD de la ARN pol II FACTORES DE ELONGACIÓN TFII S Reduce el tiempo de pausa Lectura de prueba ptefb Fosforila a la ARNp Fosforila a hspt5

Más detalles

Muchas de las células eucariotas son especializadas: el ser humano tiene más de 200 tipos de células.

Muchas de las células eucariotas son especializadas: el ser humano tiene más de 200 tipos de células. Muchas de las células eucariotas son especializadas: el ser humano tiene más de 200 tipos de células. Si todas tienen el mismo genoma, qué las hace diferentes? Las proteínas: no todas las células fabrican

Más detalles

TRANSCRIPCION EN PROCARIOTAS

TRANSCRIPCION EN PROCARIOTAS TRANSCRIPCION EN PROCARIOTAS El dogma central de la biología molecular y el flujo de la información genética Transcripción Traducción DNA RNA PROTEINA Funciones del RNA a) Material genético: puede replicarse

Más detalles

Replicación del ADN - Replicación de la doble hélice: Biosíntesis de ADN en células procariotas y

Replicación del ADN - Replicación de la doble hélice: Biosíntesis de ADN en células procariotas y Replicación del ADN - Replicación de la doble hélice: Biosíntesis de ADN en células procariotas y eucariotas. Corrección de errores. (poner especial atención, es muy importante entenderla, pues en este

Más detalles

INSTITUTO NACIONAL Departamento de Biología NM

INSTITUTO NACIONAL Departamento de Biología NM INSTITUTO NACIONAL NM 4 2016 Guía de Trabajo 4 Medio Dogma Central de la Biología Molecular Introducción Un GEN se define como la unidad mínima de información genética. Dicho de otro modo, Un GEN es el

Más detalles

GENÉTICA MOLECULAR. Unidad 1: Introducción a la genética molecular

GENÉTICA MOLECULAR. Unidad 1: Introducción a la genética molecular GENÉTICA MOLECULAR CONTENIDOS CONCEPTUALES COMPETENCIAS Unidad 1: Introducción a la genética molecular Concepto de genética molecular y aplicaciones a diferentes ramas de la ciencia. Dogma central de la

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

BLOQUE I. Reproducción Celular

BLOQUE I. Reproducción Celular BLOQUE I. Reproducción Celular Tipos de reproducción La importancia de la reproducción Principales actores de la reproducción Anomalías de la reproducción ESQUEMA DE CONTENIDOS REPRODUCCIÓN Es fundamental

Más detalles

ÍNDICE 3. REPLICACIÓN DEL ADN 1. INTRODUCCIÓN 2. ESTRUCTURA DEL ADN. Comisión de Genética Molecular. Preparado por: AM Sánchez De Abajo 1

ÍNDICE 3. REPLICACIÓN DEL ADN 1. INTRODUCCIÓN 2. ESTRUCTURA DEL ADN. Comisión de Genética Molecular. Preparado por: AM Sánchez De Abajo 1 Transmisión Química Clínica de la información 2007; 26 (5) genética 265-271 Transmisión de la información genética Comisión de Genética Molecular Preparado por: AM Sánchez De Abajo 1 ÍNDICE 1. Introducción

Más detalles

J. L. Sánchez Guillén. IES Pando - Oviedo Departamento de Biología y Geología 1

J. L. Sánchez Guillén. IES Pando - Oviedo Departamento de Biología y Geología 1 J. L. Sánchez Guillén IES Pando - Oviedo Departamento de Biología y Geología 1 LOS ÁCIDOS NUCLEICOS CONCEPTO: Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces

Más detalles

ESTRUCTURA DEL GENOMA HUMANO Y MECANISMOS DE EXPRESIÓN GÉNICA

ESTRUCTURA DEL GENOMA HUMANO Y MECANISMOS DE EXPRESIÓN GÉNICA ESTRUCTURA DEL GENOMA HUMANO Y MECANISMOS DE EXPRESIÓN GÉNICA MODULO 1: CONCEPTOS GENERALES DE GENÉTICA HUMANA CERTIFICADO DE GENÉTICA MÉDICA 2014-2015 MODULO 1: CONCEPTOS GENERALES DE GENÉTICA HUMANA

Más detalles

La primera pregunta: semiconservativa o conservativa? Experimento de Meselson y Stahl

La primera pregunta: semiconservativa o conservativa? Experimento de Meselson y Stahl REPLICACIÓN DE ADN La primera pregunta: semiconservativa o conservativa? Experimento de Meselson y Stahl Replicación semiconservativa La copia de DNA original fue marcada con N15 (isótopo pesado). Este

Más detalles

Tema 19. Traducción II. Activación de los aminoácidos y fases de la traducción

Tema 19. Traducción II. Activación de los aminoácidos y fases de la traducción Tema 19 Traducción II. Activación de los aminoácidos y fases de la traducción Dónde se sintetizan las proteínas? Replicación Transcripción Maduración Síntesis de proteínas * La síntesis de proteínas tiene

Más detalles

Traducción en Procariotas. en los procariotas la traducción se produce junto con la transcripción

Traducción en Procariotas. en los procariotas la traducción se produce junto con la transcripción Traducción Traducción en Procariotas en los procariotas la traducción se produce junto con la transcripción Traducción en Eucariotas en los eucariotas la traducción se produce en el citoplasma Iniciación

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

Se trata del estudio de cómo se transmite y expresa la información genética a nivel molecular

Se trata del estudio de cómo se transmite y expresa la información genética a nivel molecular Se trata del estudio de cómo se transmite y expresa la información genética a nivel molecular El fragmento de ADN que se transcribe se llama gen Contiene la información complementaria a la del ADN. Va

Más detalles

Tema 1: Breve Lección de biología (2)

Tema 1: Breve Lección de biología (2) Tema 1: Breve Lección de biología (2) Genes y Proteínas Dr. Oswaldo Trelles Universidad de Málaga La función primordial de los genes es proporcionar la información necesaria para la síntesis de proteínas.

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

LOS ÁCIDOS NUCLEICOS

LOS ÁCIDOS NUCLEICOS LOS ÁCIDOS NUCLEICOS Son polímeros de alto peso molecular constituidos por: ácido fosfórico un tipo de pentosa (ribosa o desoxiribosa) un tipo de base nitrogenada (púricas o pirimidínicas) Si la pentosa

Más detalles

REPLICACIÓN, TRANSCRIPCIÓN Y TRADUCCIÓN

REPLICACIÓN, TRANSCRIPCIÓN Y TRADUCCIÓN TEMA 10 REPLICACIÓN, TRANSCRIPCIÓN Y TRADUCCIÓN 1. Introducción 2. El ADN como portador de la información genéntica 3. Herencia y replicación del ADN 4. Transcripción y ARN 5. Código genético y traducción.

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REPLICACIÓN DEL ADN INTRODUCCIÓN La unidad básica de información en los seres vivos es el gen, definido en células eucariotas como un segmento de ADN que lleva la información necesaria para la síntesis

Más detalles

Click para ir al sitio web:

Click para ir al sitio web: Slide 1 / 46 New Jersey Center for Teaching and Learning Iniciativa de Ciencia Progresiva Este material está disponible gratuitamente en www.njctl.org y está pensado para el uso no comercial de estudiantes

Más detalles

UBICACIÓN DE LA MATERIA

UBICACIÓN DE LA MATERIA GENÉTICA MOLECULAR JUSTIFICACIÓN Considerando la heterogeneidad en el origen académico de los alumnos que ingresan a la Opción de Bioquímica y Bioquímica Molecular, se considera que éste debe ser un curso

Más detalles

BIOSINTESIS de PROTEINA = TRADUCCION

BIOSINTESIS de PROTEINA = TRADUCCION BIOSINTESIS de PROTEINA = TRADUCCION 1.) activación de amino ácidos 2.) iniciación 3.) elongación 4.) terminación y liberación 5.) plegamiento y procesamiento post-traduccional Actores: -amino ácidos -trnas

Más detalles

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS

CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO Y SÍNTESIS DE PROTEÍNAS Sumario Mitosis y meiosis Código genético y síntesis de proteínas: 1. Concepto de gen 2. Estructura del ADN 3. La replicación del ADN 4. La transcripción 5. La traducción

Más detalles

PREGUNTAS DE SELECTIVIDAD POR TEMAS

PREGUNTAS DE SELECTIVIDAD POR TEMAS BIOMOLÉCULAS PREGUNTAS DE SELECTIVIDAD POR TEMAS A. Defina los siguientes términos: a. Polisacáridos. (1 punto) b. Lípidos saponificables. (1 punto) B. Dada la siguiente secuencia de ADN: 3' TACCTACACAGATCTTGC

Más detalles

-Concepto operon -Mutante constitucional -Lac operon, represor (alolactosa), regulacion por represion catabolito -Promotor (pro. Policistronico, eu.

-Concepto operon -Mutante constitucional -Lac operon, represor (alolactosa), regulacion por represion catabolito -Promotor (pro. Policistronico, eu. -Concepto operon -Mutante constitucional -Lac operon, represor (alolactosa), regulacion por represion catabolito -Promotor (pro. Policistronico, eu. Pol II con TF) -Elementos cis- y trans-regulatorios,

Más detalles

dentro y hacia afuera de la célula (secreción) Metabolismo de lípidos.

dentro y hacia afuera de la célula (secreción) Metabolismo de lípidos. BIOLOGÍA GUÍA DE EJERCITACIÓN 1 RESPUESTAS PREGUNTA 1 Nombre Función 1 Nucléolo Síntesis de ribosomas 2 Núcleo Almacena la información genética (ADN en la forma de cromosomas). Lugar donde ocurre la síntesis

Más detalles

Capítulo 24. Replicación, Transcripción y Traducción

Capítulo 24. Replicación, Transcripción y Traducción Capítulo 24. Replicación, Transcripción y Traducción El dogma central de la Biología involucra esencialmente la duplicación del ADN, la transcripción de la información contenida en el ADN en forma de ARN

Más detalles

ÁCIDOS NUCLEICOS. Circular Lineal

ÁCIDOS NUCLEICOS. Circular Lineal TEMA 6: ÁCIDOS NUCLEICOS 1. Concepto, clasificación y función Los ácidos nucleicos son biomoléculas orgánicas formadas por C, H, O, N y P. Son macromoléculas de elevado peso molecular constituidas por

Más detalles

LA BASE QUÍMICA DE LA HERENCIA

LA BASE QUÍMICA DE LA HERENCIA LA BASE QUÍMICA DE LA HERENCIA 1.- Genética molecular. 1.1.- El ADN como portador de la información genética. 1.1.1.- ADN y cromosomas. 1.1.2.- Concepto de gen. 1.1.3.- Conservación de la información:

Más detalles

CÓMO SE PUEDE DETERMINAR LA SECUENCIA DEL DNA A PARTIR DE UNA PROTEÍNA? DR. MANUEL E. AQUINO

CÓMO SE PUEDE DETERMINAR LA SECUENCIA DEL DNA A PARTIR DE UNA PROTEÍNA? DR. MANUEL E. AQUINO Alianza para el Aprendizaje de Ciencias y Matemáticas CÓMO SE PUEDE DETERMINAR LA SECUENCIA DEL DNA A PARTIR DE UNA PROTEÍNA? DR. MANUEL E. AQUINO GUÍA DEL MAESTRO ESTÁNDARES ATENDIDOS: 1. LA NATURALEZA

Más detalles

Veamos rápidamente el ciclo celular

Veamos rápidamente el ciclo celular Replicación del adn Veamos rápidamente el ciclo celular Fase G1: Fase de crecimiento celular. Fase G2: la célula ya duplicó su material genético, y se prepara para la mitosis. Fase M: fase de división

Más detalles

Clase 10. del DNA a las proteínas. Traducción

Clase 10. del DNA a las proteínas. Traducción Clase 10. del DNA a las proteínas. Traducción 1. El código genético. 2. Principales participantes en la traducción: RNAm, ribosomas, RNAt. 3. Etapas de la traducción: 1. Iniciación 2. Elongación 3. Terminación

Más detalles

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago

ÁCIDOS NUCLEICOS. Por: Wilfredo Santiago ÁCIDOS NUCLEICOS Por: Wilfredo Santiago Ácidos Nucleicos Formados por subunidades llamadas nucleótidos; pueden ser un solo nucleótido o una cadena larga de nucleótidos. Ácidos Nucleicos Nucleótidos individuales:

Más detalles

EDICIÓN EDICIÓN Nº 123

EDICIÓN EDICIÓN Nº 123 Síntesis de proteínas Colágeno, insulina, hemoglobina, bilirrubina resultan nombres conocidos. Son proteínas que forman parte de la vida cotidiana. De hecho, son uno de los componentes principales de las

Más detalles

Ácidos nucleicos. Qué son los ácidos nucleicos?

Ácidos nucleicos. Qué son los ácidos nucleicos? Ácidos nucleicos Qué son los ácidos nucleicos? Son cadenas largas formadas por nucleótidos, importantes para un ser vivo porque aportan la información genética de generación en generación, en base a ellos

Más detalles

LA NUEVA BIOTECNOLOGÍA

LA NUEVA BIOTECNOLOGÍA LA NUEVA BIOTECNOLOGÍA Ingeniería genética: técnicas que permiten manipular la información genética de un ser vivo. TECNOLOGÍA TRADICIONAL DEL ADN RECOMBINANTE CLONACIÓN DE GENES: Obtención de muchas copias

Más detalles