Flujo de información en la célula Transcripción

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Flujo de información en la célula Transcripción"

Transcripción

1 Flujo de información en la célula Transcripción Proceso de síntesis de ARN dirigido por el ADN. Una hebra es copiada (hebra molde) Relacionado con expresión génica Algunas regiones que se transcriben no son traducidas a proteínas (ARNr, ARNt, ARNpn) Proceso similar a replicación 1 2 Diferencias con replicación: Uso de ribonucleótidos Uracilo por Timina Tipos de ARN Propiedades comunes: Todos son producidos por transcripción Todos cumplen un papel en la síntesis proteica Generalmente con estructuras secundarias y terciarias complejas Adición de nucleótidos por RNA Polimerasa Formación temporal de un duplex ADN-ARN El producto es de cadena simple 3 4

2 ARN celulares, abundancia y función Características de la transcripción 6 % 80% 10% 4 % La transcripción está fuertemente regulada. Apenas un 0.01% de los genes se está expresando en una célula eucariota en un momento dado. Dirigido por una ARN Polimerasa Una hebra de ADN sirve de molde La enzima no requiere cebador La enzima elonga una cadena en dirección 5`-3` Formación de enlace 3-5 fosfodiéster La síntesis sólo se inicia en secuencias específicas llamadas promotores Desenrrollamiento parcial del ADN 5 6 Nomenclatura transcripcional Una hebra de ADN sirve de molde (hebra molde) ARN polimerasa bacteriana Unica ARNPolimerasa bacteriana Multímero de varias subunidades subunidad σ70 se une a secuencias específicas en las posiciones 10 y 35 del promotor El transcripto es igual a la hebra codificante y complementario a la hebra molde la subunidad α queda en posición upstream (Sense) (Antisense) CCTTACTTACTGTTACGCCG GGAATGCCTGACAATGCGGC CCUUACUUACUGUUACGCCG las subunidades b y b se asocian con el sitio de inicio el sitio de inicio de la transcripción es +1 downstream = dirección de la transcripción 7 8

3 Promotores bacterianos Modelo de la ARN Polimerasa bacteriana El modelo muestra la interacción de la holoenzima con el promotor formando el complejo abierto. Hebra molde en gris 9 10 Transcripción en bacterias: iniciación El proceso de la transcripción 1. Reconimiento de la hebra molde Unión de la polimerasa al promotor (Formación de un complejo cerrado) Formación de una burbuja de ADN de cadena simple (complejo abierto) 2. Iniciación Síntesis de los primeros 9 o 10 nucleótidos Varios eventos abortivos, donde el ARN es liberado Pasado este punto (10 nucleótidos) se libera sigma y comienza la longación 11 12

4 Transcripción en bacterias: elongación Terminación transcripcional en bacterias Reconocimiento de señales particulares que indican donde terminar la síntesis La burbuja de transcripción se desestabiliza y colapsa liberándose el ARN Rho independiente bucle autocomplementario Rho dependiente proteína Rho se une al ARN Varios eventos abortivos, donde el ARN es liberado Pasado este punto (10 nucleótidos) se libera sigma y comienza la elongación Adición de nucleótidos al extremo 3 hidroxilo de la cadena creciente Diferencias entre la transcripción procariota y eucariota ARN polimerasas eucariotas ARNm policistrónico transcripción y traducción acopladas ARN Polimerasa única ARNm monocistrónico transcripción y procesamiento acoplados 3 ARN Polimerasas diferentes INCAPACES DE RECONOCER EL PROMOTOR Polimerasa localización genes transcritos inhibición por a-amanitina Pol I nucleolo ARNr insensible Pol II nucleoplasma ARNm, ARNpn muy sensible Pol III nucleoplasma ARNt, ARNr 5S sensible 15 16

5 La polimerasa II eucariota es similar a la bacteriana......aunque más compleja Proteínas ARN Polimerasas Factores de Transcripción Modificadores Transcripción en eucariotas Factores específicos Polimerasa II Factores generales Todas las polimerasas eucariotas necesitan Factores Transcripcionales basales para reconocer los promotores e iniciar la transcripción Iniciación en eucariotas Modificadores 19 Señales Promotores Potenciadores 20

6 Promotores regulados eucariotas Secuencias de reconocimiento específico para Factores de Transcripción Estructura modular Factores transcripcionales Proteínas de unión a sitios específicos de ADN Se asocian a Promotores y potenciadores Estructura modular: dominios de unión al ADN dominios de activación Los Factores Transcripcionales son proteínas de unión al ADN Reconocen secuencias específicas en promotores y potenciadores Se ensamblan cooperativamente sobre el ADN mediante interacciones proteína-proteína Potenciadores Activación de la Transcripción Potenciadores (enhancers) reguladores en cis Función a distancia Independientemente de orientación Sitios de union a factores de transcripción 23 24

7 Los factores de transcripción específicos colaboran en el ensamblado del complejo de iniciación Existen activadores, represores y mediadores Factores específicos colaboran para colocar los FBasales en el promotor y éstos posicionan las polimerasas La mayoría de los genes regulados por factores transcripcionales múltiples Los factores basales se ensamblan secuencialmente y posicionan la ARN polimerasa Elongación en eucariotas, el papel del CTD CTD- CARBOXI TERMINAL DOMAIN de la RNA Polimerasa II c/repetidos de 7 péptidos (26-52aa) Unicos a pol II Su fosforilación es esencial para la elongación La fosforilación depende de uno de los factores generales 27 28

8 PROCESAMIENTO DE ARN EN EUCARIOTAS El ciclo transcripcional eucariota Todo ARN se procesa. Los ARNr se transcriben juntos y por corte se generan fragmentos menores. Los ARNt se procesan y sufren modificaciones de bases. Los ARNm sufren 4 tipos de modificaciones: - Capping. -Cola poli A. - Corte y empalme de intrones (Splicing) -Editing Transcripción Y Procesamiento de ARNr Genes dispuestos en tándem: aproximadamente 200 copias de genes de ARNr en Genoma Humano (Cromosomas con satélites). En interfase se ven como Nucleolos: zonas de transcripción y unión a proteínas ribosómicas. Unidad Transcripcional Ribosomal Transcriptos como un gran precursor policistrónico de nt (ARNr 45S). Los transcriptos son metilados Procesados secuencialmente (degradación de las secuencias intermedias) 31 32

9 Transcripción y Procesamiento del ARNt Transcriptos como mono o policistrónicos Los transcriptos son procesados secuencialmente Formación del trébol Degradación de extremos y adición de brazo aceptor CCA Eliminación de intrones Modificación de bases Modificaciones de bases en el ARNt Procesamiento de los ARN mensajeros Capping Estructura de la Caperuza

10 Poliadenilación en extremo 3 El mecanismo de la Poliadenilación Proceso secuencial dependiente de : Reconocimiento de secuencias en el transcripto Interacción ARN-proteinas específicas Interacción proteína-proteína Corte y empalme (splicing( splicing) ) de intrones y exones Hibridación ADN-ARN ARN el gen de la ovoalbúmina 39 40

11 El proceso de corte y empalme Tipos de intrones Ensamblado secuencial de partículas riboproteicas (SNURPs) Apareamiento de bases con el mrna Corte y empalme Liberación del intrón U1 snrnp U2 snrnp GU intron A AG Pre mrna U4, U6, U5 snrnp Salida del intron Ligacion de los exones Reconocimiento de señales de procesamiento El spliceosoma Estructura riboproteica encargada del procesamiento de los intrones Apareamiento de bases del ARN precursor con el ARN del SNURP Ensamblado secuencial de partículas riboproteicas (SNURPs) 43 44

12 El splicing consiste en dos transesterificaciones sucesivas Ribozimas ARN que elimina sus propios intrones ARN que elimina intrones de otros ARN ARN que cataliza su propia replicación TIPO I Algunos genes de ARNr Estructura terciaria de un intron tipo I de un ARN de Tetrahymena que se autoelimina del resto del ARN TIPO II Mitocondria y cloroplastos Una visión moderna de la expresión génica 47

Flujo de información en la célula

Flujo de información en la célula 1 Flujo de información en la célula Transcripción Proceso de síntesis de ARN dirigido por el ADN. Una hebra es copiada (hebra molde) Relacionado con expresión génica Algunas regiones que se transcriben

Más detalles

Acido ribonucleico RNA En RNA U aparea con A

Acido ribonucleico RNA En RNA U aparea con A Metabolismo del RNA Transcripcion, enzimas, localizacion, inhibicion En procariotas, factor sigma En eucariotas, sequencias cis-regulatorios, TATA, inr, enhancer In eucariotas, Pol II, TF, iniciacion,

Más detalles

Transcripción y Procesamiento del RNA

Transcripción y Procesamiento del RNA Transcripción y Procesamiento del RNA Transcripción Síntesis de RNA a partir de DNA DNA Transcripción Otros snrna, snorna, sirna, mirna RNA de transferencia trna RNA ribosomal rrna RNA mensajero mrna Estructura

Más detalles

Dogma central de la Biología Molecular. Replicación ADN. Transcripción ARN. Traducción. Proteínas

Dogma central de la Biología Molecular. Replicación ADN. Transcripción ARN. Traducción. Proteínas Dogma central de la Biología Molecular ADN ARN Proteínas Replicación Transcripción Traducción Replicación En la horquilla se encuentra enzimas y proteínas con funciones diferentes Primasa ADN polimerasa

Más detalles

Expresión del material hereditario. Regulación en procariontes. Regulación en Eucariontes.

Expresión del material hereditario. Regulación en procariontes. Regulación en Eucariontes. Expresión del material hereditario. Regulación en procariontes. Regulación en Eucariontes. Genética Moderna. Griffiths, Gelbart, Miller, Lewontin. Capítulo 3. La Función de los Genes. Capítulo 14. Regulación

Más detalles

TRANSCRIPCIÓN. Mathews C.K.; Van Holde K.E.; Ahern, K. G (2002). Bioquímica, 3ª ed. Addison Wesley

TRANSCRIPCIÓN. Mathews C.K.; Van Holde K.E.; Ahern, K. G (2002). Bioquímica, 3ª ed. Addison Wesley TRANSCRIPCIÓN Nelson DL y Cox MM (2000) Lehninger Principios de Bioquímica 3ª ed Ed Omega Nelson DL y Cox MM. (2000). Lehninger Principios de Bioquímica, 3ª ed. Ed. Omega. Mathews C.K.; Van Holde K.E.;

Más detalles

Tema 7. Transcripción en procariotas ADN ARN. Proteínas. Transcripción. Molde. Dogma central de la Biología Molecular. Replicación.

Tema 7. Transcripción en procariotas ADN ARN. Proteínas. Transcripción. Molde. Dogma central de la Biología Molecular. Replicación. Dogma central de la Biología Molecular Tema 7. Transcripción en procariotas ADN Replicación ARN Transcripción 1 Proteínas Traducción 2 Transcripción Molde Molde Sustratos Aparato de transcripción 3 4 Unidad

Más detalles

LA TRANSCRIPCIÓN El paso de la información del ADN al ARN. Realizado por José Mayorga Fernández

LA TRANSCRIPCIÓN El paso de la información del ADN al ARN. Realizado por José Mayorga Fernández LA TRANSCRIPCIÓN El paso de la información del ADN al ARN Realizado por José Mayorga Fernández Diferencias entre la transcripción en eucariotas y en procariotas. Transcripción en procariotas En procariotas

Más detalles

ARN polimerasas Eucariotas

ARN polimerasas Eucariotas Transcripción ARN polimerasas Eucariotas ARN polimerasa II Eucariota Factor Subunidades Peso Función TFIID TBP TAF s 1 12 38 kda 15-250 kda Reconocimiento TATA (promotor) Reclutamiento de TFIIB Regulación

Más detalles

Dr. Antonio Barbadilla

Dr. Antonio Barbadilla Dr. Antonio Barbadilla 1 DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR Replicación ADN Transcripción ARN m Traducción Proteínas Replicación ADN Transcripción Retrotranscripción ARN m Traducción Proteínas DOGMA

Más detalles

Expresión Génica GENOMA. Transcripción TRANSCRIPTOMA. Traducción PROTEOMA

Expresión Génica GENOMA. Transcripción TRANSCRIPTOMA. Traducción PROTEOMA Expresión Génica GENOMA Transcripción Acceso al genoma Ensamblado del complejo de iniciación de la transcripción Síntesis de ARN Procesamiento del ARN Estabilidad del ARN (degradación, localización) TRANSCRIPTOMA

Más detalles

Capítulo 12. TRANSCRIPCIÓN Esquemas

Capítulo 12. TRANSCRIPCIÓN Esquemas TRANSCRIPCIÓN Esquemas La síntesis del ARN se realiza utilizando como molde una de las cadenas de ADN, denominada molde, negativa o no codificante. Se copia la secuencia de ADN ubicando ribonucleótidos

Más detalles

TRANSCRIPCIÓN, TRADUCCIÓN, REGULACIÓN EXPRESIÓN GENÉTICA (Docentes: Marina González Gabriela Gómez - Sede Montes de Oca)

TRANSCRIPCIÓN, TRADUCCIÓN, REGULACIÓN EXPRESIÓN GENÉTICA (Docentes: Marina González Gabriela Gómez - Sede Montes de Oca) TRANSCRIPCIÓN, TRADUCCIÓN, REGULACIÓN EXPRESIÓN GENÉTICA (Docentes: Marina González Gabriela Gómez - Sede Montes de Oca) 1) La secuencia de nucleótidos reconocida por la ARN polimerasa se conoce como:

Más detalles

Expresión Génica GENOMA. Transcripción TRANSCRIPTOMA. Traducción PROTEOMA

Expresión Génica GENOMA. Transcripción TRANSCRIPTOMA. Traducción PROTEOMA Expresión Génica GENOMA Transcripción Acceso al genoma Ensamblado del complejo de iniciación de la transcripción Síntesis de ARN Procesamiento del ARN Estabilidad del ARN (degradación, localización) TRANSCRIPTOMA

Más detalles

El Dogma Central de la Biología Molecular v.1. Manuel J. Gómez Laboratorio de Bioinformática Centro de Astrobiología INTA- CSIC

El Dogma Central de la Biología Molecular v.1. Manuel J. Gómez Laboratorio de Bioinformática Centro de Astrobiología INTA- CSIC El Dogma Central de la Biología Molecular v.1 Manuel J. Gómez Laboratorio de Bioinformática Centro de Astrobiología INTA- CSIC Flujo de información Material genético Proteínas Replicación Transcripción

Más detalles

Genética molecular I SÍNTESIS DE ARN (TRANSCRIPCIÓN)

Genética molecular I SÍNTESIS DE ARN (TRANSCRIPCIÓN) Genética molecular I SÍNTESIS DE ARN (TRANSCRIPCIÓN) Temario selectividad Tema 11.- Expresión de la información genética: Transcripción y Traducción. 6.- Descripción del mecanismo de la transcripción (iniciación,

Más detalles

Bases moleculares de la herencia

Bases moleculares de la herencia Bases moleculares de la herencia i. Qué moléculas son las portadoras de la información hereditaria? ii. Cómo se preserva y trasmite la información hereditaria? iii. Cómo se expresa esta información? Dogma

Más detalles

Distintos tipos de ARN en el citoplasma. El dogma central. Nomenclatura transcripcional. Que es un gen? Una hebra de ADN sirve de molde (hebra molde)

Distintos tipos de ARN en el citoplasma. El dogma central. Nomenclatura transcripcional. Que es un gen? Una hebra de ADN sirve de molde (hebra molde) El dogma central Distintos tipos de ARN en el citoplasma La principal función de los genes es la manufactura de proteinas. La hipótesis de la secuencia : El orden de las bases en una porcion del ADN representa

Más detalles

Ácidos nucleicos. 3ª y 4ª Parte: Transcripción y traducción I & II. Tema 11 de Biología NS Diploma BI Curso Ácidos nucleicos 1/33

Ácidos nucleicos. 3ª y 4ª Parte: Transcripción y traducción I & II. Tema 11 de Biología NS Diploma BI Curso Ácidos nucleicos 1/33 Ácidos nucleicos 3ª y 4ª Parte: Transcripción y traducción I & II Tema 11 de Biología NS Diploma BI Curso 2011-2013 Ácidos nucleicos 1/33 Expresión de la información genética Ya se ha visto cómo la información

Más detalles

TRANSCRIPCION Y TRADUCCION

TRANSCRIPCION Y TRADUCCION TRANSCRIPCION Y TRADUCCION BibliograJa: CurKs. 7ma edición. Capítulo 10. (Código fotocopiadora 2160) htp://www.curksbiologia.com/indice_figuras_animadas Asignatura: Biología para IRNR Profesora Responsable:

Más detalles

A qué da lugar el mensaje del ADN?

A qué da lugar el mensaje del ADN? A qué da lugar el mensaje del ADN? Cómo se lee el mensaje? FLUJO DE INFORMACIÓN DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR (enunciado por F. Crick) DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR ACTUALIZADO TRANSCRIPCIÓN

Más detalles

Del ADN a las Proteínas

Del ADN a las Proteínas Del ADN a las Proteínas ADN MATERIAL GENETICO CAPACIDAD PARA ALMACENAR INFORMACION ESTABILIDAD FISICA Y QUIMICA PARA NO PERDER INFORMACION CAPACIDAD PARA TRANSFERIR INFORMACION A CELULAS HIJAS Y HACERLO

Más detalles

1948: Enuncian la hipótesis denominada : UN GEN UNA ENZIMA

1948: Enuncian la hipótesis denominada : UN GEN UNA ENZIMA 1948: Enuncian la hipótesis denominada : UN GEN UNA ENZIMA En defensa de Crick.. . Es el paso de ADN a ARN. Proceso fundamental para la síntesis de proteínas. La ENZIMA necesaria para hacer una copia

Más detalles

TEMA 17. LA EXPRESIÓN DEL MENSAJE GENÉTICO.

TEMA 17. LA EXPRESIÓN DEL MENSAJE GENÉTICO. TEMA 17. LA EXPRESIÓN DEL MENSAJE GENÉTICO. 1.-El DOGMA central de la biología molecular. 2.- Transcripción 2.1. Transcripción en procariotas. 2.2. Transcripción en eucariotas. 3.- El código genético.

Más detalles

BIOLOGÍA MOLECULAR U.D. 2 ÁCIDOS NUCLEICOS II

BIOLOGÍA MOLECULAR U.D. 2 ÁCIDOS NUCLEICOS II BIOLOGÍA MOLECULAR U.D. 2 ÁCIDOS NUCLEICOS II ÍNDICE II 4.3. PROPIEDADES FISICOQUÍMICAS DE LOS ÁC. NUCLEICOS 5. ESTRUCTURA DEL ADN 5.1. TIPOS DE ARN. 5.1.1. ARNm 5.1.2. ARNr 5.1.3. ARNt 5.1.4. ARN con

Más detalles

Expresión de la información genética

Expresión de la información genética Expresión de la información genética La expresión de la información genética en todos los seres vivos se lleva a cabo a través de dos procesos: El proceso de transcripción donde se transcribe el mensaje

Más detalles

Orígenes de replicación en los cromosomas eucariotas

Orígenes de replicación en los cromosomas eucariotas Orígenes de replicación en los cromosomas eucariotas REPLICON: unidad del DNA en la cual ocurren actos individuales de replicación. El replicón contiene un origen donde comienza la replicación y un final

Más detalles

EXPRESIÓN DEL MENSAJE GENÉTICO

EXPRESIÓN DEL MENSAJE GENÉTICO EXPRESIÓN DEL MENSAJE GENÉTICO La información genética es la causa de la síntesis de proteínas específicas, entre ellas las enzimas, responsables de las características estructurales y funcionales de un

Más detalles

SÍNTESIS DE PROTEÍNAS

SÍNTESIS DE PROTEÍNAS SÍNTESIS DE PROTEÍNAS SINTESIS DE PROTEÍNAS FLUJO DE INFORMACIÓN ESTRUCTURA DEL RNA TRANSCRIPCIÓN CAMBIOS POST TRANSCRIPCIONALES CÓDIGO GENÉTICO TRADUCCIÓN POLIRRIBOSOMAS MUTACIONES MODIFICACIONES POSTRADUCCIONALES

Más detalles

Transcripción. - Generalidades - DNA RNA. - Mecanismo. - Modelos Protein. - Moléculas. - Métodos de detección de RNA. Chromosome RNA DNA

Transcripción. - Generalidades - DNA RNA. - Mecanismo. - Modelos Protein. - Moléculas. - Métodos de detección de RNA. Chromosome RNA DNA TRANSCRIPCIÓN Transcripción - Generalidades Chromosome - DNA RNA - Mecanismo - Modelos Protein RNA - Moléculas - Métodos de detección de RNA DNA Transcripción - Primer proceso de la expresión genética

Más detalles

Principales tipos de ARN producidos en las Células

Principales tipos de ARN producidos en las Células Víctor Hugo Casco Principales tipos de ARN producidos en las Células Tipo de ARN ARN mensajero ARN ribosomal ARN de transferencia ARNs pequeños nucleares ARNs pequeños nucleolares Otros ARNs no codificantes

Más detalles

Dogma central. ADN - ARN - Proteínas

Dogma central. ADN - ARN - Proteínas Composición del ARN Dogma central ADN - ARN - Proteínas El origen de la vida y el ARN ADN a ARN ARN (ácido ribonucléico) Polímero de nucleótidos La pentosa de los nucleótidos es la Ribosa Polímero monohebra

Más detalles

Transcripción en eucariontes

Transcripción en eucariontes Transcripción en eucariontes Diferentes tipos de RNA polimerasas! 1. RNA Polimerasa I sintetiza RNA ribosomal (rrna) 5.8S, 18S y 28S.! 2. RNA Polimerasa II sintetiza RNAs mensajeros (mrna), RNAs pequeños

Más detalles

MORFOFISIOLOGÍA HUMANA I. PRIMER SEMESTRE. PRIMER AÑO.

MORFOFISIOLOGÍA HUMANA I. PRIMER SEMESTRE. PRIMER AÑO. MORFOFISIOLOGÍA HUMANA I. PRIMER SEMESTRE. PRIMER AÑO. TEMA 1: CÉLULA. ACTIVIDAD ORIENTADORA 18. TÍTULO: GENÉTICA MOLECULAR. TRANSCRIPCIÓN. MSc. Ileana Rodríguez Cabrera SUMARIO 1. Características generales

Más detalles

Transcripción en eucariontes

Transcripción en eucariontes Transcripción en eucariontes Diferentes tipos de RNA polimerasas 1. RNA Polimerasa I sintetiza RNA ribosomal (rrna) 5.8S, 18S y 28S. 2. RNA Polimerasa II sintetiza RNAs mensajeros (mrna), RNAs pequeños

Más detalles

Transcripción. replicación DNA. transcripción RNA. traducción. Prot. Introducción. Transcripción procariótica. Prof.

Transcripción. replicación DNA. transcripción RNA. traducción. Prot. Introducción. Transcripción procariótica. Prof. Introducción El flujo de información genética sigue el siguiente camino : DNA RNA Prot replicación transcripción traducción Los ARN existentes en eucariontes son : ARNm : ARN mensajero ARNt : ARN transferencia

Más detalles

IV Plan común. Tema 2: Flujo de información génica Transcripción y traducción del ADN

IV Plan común. Tema 2: Flujo de información génica Transcripción y traducción del ADN IV Plan común Tema 2: Flujo de información génica Transcripción y traducción del ADN Objetivo Analizar los procesos moleculares involucrados en la transcripción del ADN. Pregunta oficial PSU La siguiente

Más detalles

Transcripción y Procesamiento del RNA

Transcripción y Procesamiento del RNA Facultad de Química, UNAM Dogma Central de la Biología Molecular. Flujo de la Información Genética Replicación 1630 Genética y Biología Molecular Transcripción y Procesamiento del RNA Transcripción. Síntesis

Más detalles

Tema 8. Funcionamiento del DNA (I)

Tema 8. Funcionamiento del DNA (I) Tema 8. Funcionamiento del DNA (I) Genética CC. Mar 2004-05 Objetivos Transcripción RNAs y procesamiento Genética CC Mar 2004/5 D. Posada, Universidad de Vigo 2 1 Dogma Central de la Biología Molecular

Más detalles

RECOMENDACIONES DE SELECTIVIDAD

RECOMENDACIONES DE SELECTIVIDAD RECOMENDACIONES DE SELECTIVIDAD 1. Se recomienda que los procesos de replicación del ADN, transcripción y traducción se expliquen tomando como referencia lo que acontece en una célula procariótica sin

Más detalles

Actualmente, se acepta que un gen se traduce en una cadena polipeptídica (formará proteínas enzimáticas y no enzimáticas)

Actualmente, se acepta que un gen se traduce en una cadena polipeptídica (formará proteínas enzimáticas y no enzimáticas) EXPRESIÓN DE LA INFORMACIÓN GENÉTICA El ADN es el material genético y se expresa formando cadenas polipeptídicas. El llamado dogma central de la biología molecular explica que el ADN se duplica(1), se

Más detalles

comprende todos aquellos del gen a nivel de traducción o transcripción, regulando los productos funcionales de un gen. Los niveles de regulación de la

comprende todos aquellos del gen a nivel de traducción o transcripción, regulando los productos funcionales de un gen. Los niveles de regulación de la La regulación genética comprende todos aquellos procesos que afectan la acción del gen a nivel de traducción o transcripción, regulando los productos funcionales de un gen. Los niveles de regulación de

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge TRANSCRIPCIÓN INTRODUCCIÓN En las rutas de transmisión de la información genética, se denomina transcripción al proceso de trasvase de la información contenida en el ADN, a la molécula de ARN. Constituye

Más detalles

Presentación organizada con fines didácticos por José Antonio Pascual Trillo

Presentación organizada con fines didácticos por José Antonio Pascual Trillo Presentación organizada con fines didácticos por José Antonio Pascual Trillo www.japt.es Teoría UN GEN - UNA ENZIMA EXPERIMENTOS DE BEADLE Y TATUM (1941). Beadle y Tatum recibieron el Premio Nobel en 1958

Más detalles

EXAMEN DE LA PRIMERA PARTE (30%) NOMBRE CÓDIGO FECHA. El examen consta de un total de 20 puntos y el tiempo máximo para contestar es de 1 hora.

EXAMEN DE LA PRIMERA PARTE (30%) NOMBRE CÓDIGO FECHA. El examen consta de un total de 20 puntos y el tiempo máximo para contestar es de 1 hora. 1 PONTIFICIA UNIVERSIDAD JAVERIANA MAESTRÍA EN INFORMÁTICA CURSO DE BIOINFORMÁTICA EXAMEN DE LA PRIMERA PARTE (30%) NOMBRE CÓDIGO FECHA El examen consta de un total de 20 puntos y el tiempo máximo para

Más detalles

TEMA 3: Expresión Génica

TEMA 3: Expresión Génica TEMA 3: Expresión Génica Genómica Estructural: composición de los Genomas ADN Génico y Relacionado: 37% (1.5% CODIFICANTE, EXONES!!) ADN No Codificante: 63% (44 % ELEMENTOS TRANSPONIBLES) 1.5% 44% CONCEPTO

Más detalles

TRANSCRIPCIÓN CONCEPTO DE OPERÓN Y PROMOTOR. González Pérez Ana Karen Robledo Sarmiento Danely

TRANSCRIPCIÓN CONCEPTO DE OPERÓN Y PROMOTOR. González Pérez Ana Karen Robledo Sarmiento Danely TRANSCRIPCIÓN CONCEPTO DE OPERÓN Y PROMOTOR González Pérez Ana Karen Robledo Sarmiento Danely Transcripción Es la copia de un gen en un ARNm Ribosa Uracilo Cadena sencilla Operón Se define como una unidad

Más detalles

Los avances en las distintas ramas de la biología permitieron a Francis Crick enunciar en 1970 el DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR:

Los avances en las distintas ramas de la biología permitieron a Francis Crick enunciar en 1970 el DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR: SÍNTESIS DE PROTEÍNAS La información genética del ADN debe descodificarse para poder ser utilizada por la célula, ya que el ADN como tal tiene una escasa acción sobre el funcionamiento de los organismos:

Más detalles

DEL ADN A LAS PROTEÍNAS

DEL ADN A LAS PROTEÍNAS Trabajo Práctico 2.1 DEL ADN A LAS PROTEÍNAS La mayoría de los genomas de todas las formas de vida celular están compuestos por ADN (ácido desoxirribonucleico), mientras que algunos pocos virus tienen

Más detalles

Tema 22: DEL ADN A LAS PROTEÍNAS (EXPRESIÓN GÉNICA)

Tema 22: DEL ADN A LAS PROTEÍNAS (EXPRESIÓN GÉNICA) Tema 22: DEL ADN A LAS PROTEÍNAS (EXPRESIÓN GÉNICA) 1.- EL ADN COMO MATERIAL HEREDITARIO 2.- CONCEPTO DE GEN 3.- FLUJO DE INFORMACIÓN GENÉTICA 4.- TRANSCRIPCIÓN: SÍNTESIS DEL ARN 5.- MADURACIÓN DEL ARN

Más detalles

BIOQUÍMICA GENERAL. MSc. Dania Martín

BIOQUÍMICA GENERAL. MSc. Dania Martín BIOQUÍMICA GENERAL MSc. Dania Martín UNIDAD V: ÁCIDOS NUCLEICOS - CLASE #14 OBJETIVOS Señalar los procesos del ADN y Código Genético CONTENIDO Señalamiento de los procesos del ADN. Diagramar los procesos

Más detalles

El flujo de la información genética: TRANSCRIPCIÓN

El flujo de la información genética: TRANSCRIPCIÓN El flujo de la información genética: TRANSCRIPCIÓN Diferencias en la composición de ADN y ARN Diferencias en la composición de ADN y ARN Estructura secundaria del ARN Clases de ARN Clases de ARN El ARN

Más detalles

Transcripción y Procesamiento del RNA

Transcripción y Procesamiento del RNA SÍNTESIS DE RNA o TRANSCRIPCIÓN Facultad de Química, UNAM 1630 Genética y Biología Molecular Transcripción y Procesamiento del RNA Es el proceso mediante el cual se sintetiza RNA a partir de DNA. El RNA

Más detalles

Tema 17: PROCESAMIENTO POST-TRANSCRIPCIONAL

Tema 17: PROCESAMIENTO POST-TRANSCRIPCIONAL Tema 17: PROCESAMIENTO POST-TRANSCRIPCIONAL Tipos de ARN: ARNm, ARNr, ARNt, ARNhn, ARNsn, ARNsc Procesamiento en procariotas Procesamiento en eucariotas ARNm: Adición de caperuza y poli(a) Edición Splicing

Más detalles

La síntesis de proteínas

La síntesis de proteínas La síntesis de proteínas La Transcripción La información para fabricar todas las proteínas está almacenada en las moléculas de ADN de los cromosomas. La sucesión de bases en las moléculas de ADN es un

Más detalles

Regulación de la expresión génica en eucariotas

Regulación de la expresión génica en eucariotas Regulación de la expresión génica en eucariotas La regulación génica es más compleja en eucariotas Procariotas Eucariotas ADN desnudo cromatina N cromosomas 1 muchos Asociación sí no transcr.-traducc.

Más detalles

Características e importancia del código genético

Características e importancia del código genético Características e importancia del código genético Estudio del ADN como portador de la información genética. Concepto de gen. Mecanismos responsables de su transmisión y variación. Los procesos de transcripción-traducción

Más detalles

CAPÍTULO 2 FLUJO DE LA INFORMACIÓN BIOLÓGICA FACULTAD DE AGRONOMÍA CURSO DE BIOQUÍMICA

CAPÍTULO 2 FLUJO DE LA INFORMACIÓN BIOLÓGICA FACULTAD DE AGRONOMÍA CURSO DE BIOQUÍMICA CAPÍTULO 2 FLUJO DE LA INFORMACIÓN BIOLÓGICA FACULTAD DE AGRONOMÍA CURSO DE BIOQUÍMICA Contenido 2.1 Información biológica e interacciones no covalentes. 2.2 Almacenamiento de la información biológica

Más detalles

ADN. Estructura primaria del ADN. Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótidos

ADN. Estructura primaria del ADN. Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótidos GENÉTICA MOLECULAR ADN ESTRUCTURA ADN Estructura primaria del ADN Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótidos Azúcar; desoxirribosa Bases nitrogenadas;

Más detalles

Ciclo de Capacitaciones

Ciclo de Capacitaciones Colaboradores: Ciclo de Capacitaciones Capítulo 1 - Conceptos de Biología Celular y Molecular 09 de Junio del 2017 Indice Objetivo Entregar herramientas teóricas acerca de la teoría celular y molecular

Más detalles

BIOLOGÍA MOLECULAR: GENÓMICA,

BIOLOGÍA MOLECULAR: GENÓMICA, T-replicación BIOLOGÍA MOLECULAR: GENÓMICA, PROTEÓMICA Y METABOLÓNICA (1) (2) (3) Proteina Metabolitos y macromoléculas Genoma Transcriptoma Proteoma Metaboloma La información que contiene el DNA se transmite

Más detalles

TEMA 4 REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS

TEMA 4 REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS TEMA 4 REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS Necesidad de regular la expresión génica Control positivo y negativo. Sistemas enzimáticos inducibles y represibles El operón lac de E. coli Elementos

Más detalles

Bases moleculares de la herencia. Transcripción.

Bases moleculares de la herencia. Transcripción. UNIVERSIDAD AUTÓNOMA DE SINALOA Unidad Académica de Ciencias de la Nutrición y Gastronomía. Bases moleculares de la herencia. Transcripción. Dr. Javier Magaña 1. Anna Islas 2. Diego Moreira 2. Eduardo

Más detalles

ADN. Estructura primaria del ADN. Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótidos

ADN. Estructura primaria del ADN. Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótidos GENÉTICA MOLECULAR ADN ESTRUCTURA ADN Estructura primaria del ADN Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótidos Azúcar; desoxirribosa Bases nitrogenadas;

Más detalles

Composición química de los ácidos nucleicos

Composición química de los ácidos nucleicos Ácidos Nucleicos Composición química de los ácidos nucleicos Los ácidos nucleicos tienen tres componentes principales Las bases nitrogenadas pueden ser purinas o pirimidinas Los nucleótidos incluyen fosfato,

Más detalles

Transcripción Gen Transcripción (hebra codificante 5-3 ) templado o molde (3-5 ) catalizada por la ARN polimerasa

Transcripción Gen Transcripción (hebra codificante 5-3 ) templado o molde (3-5 ) catalizada por la ARN polimerasa Transcripción Gen: unidad de ADN que contiene la información para especificar la síntesis de un polipéptido o de un ARN funcional (ARNt, ARNr) Transcripción es la síntesis de una cadena de ARN que representa

Más detalles

TEMA 14. Fisiología celular. Genética molecular.

TEMA 14. Fisiología celular. Genética molecular. TEMA 14. Fisiología celular. Genética molecular. La genética molecular es la parte de la Biología que se encarga de estudiar las moléculas que contienen, transmiten de una generación a la siguiente y permiten

Más detalles

Regulación de la Expresión Génica en Eucariotas

Regulación de la Expresión Génica en Eucariotas Regulación de la Expresión Génica en Eucariotas Regulación de la Expresión Génica En los organismos pluricelulares existe una clara diferenciación celular y reparto de funciones, que dan lugar a la formación

Más detalles

GENÉTICA MOLECULAR TRANSCRIPCIÓN DEL ARN Y TRADUCCIÓN DE PROTEÍNAS

GENÉTICA MOLECULAR TRANSCRIPCIÓN DEL ARN Y TRADUCCIÓN DE PROTEÍNAS GENÉTICA MOLECULAR TRANSCRIPCIÓN DEL ARN Y TRADUCCIÓN DE PROTEÍNAS Conceptos Previos MATERIAL GENÉTICO que son su unidad estructural son los NUCLEÓTIDOS Adenina (A) Timina (T) Citosina (C) Guanina (G)

Más detalles

ARN mensajero. Síntesis y procesamiento. Corte y empalme. Capping. Poliadenilación. Estabilidad. Genética 1 er Curso. Facultad de Medicina TEMA 0-3

ARN mensajero. Síntesis y procesamiento. Corte y empalme. Capping. Poliadenilación. Estabilidad. Genética 1 er Curso. Facultad de Medicina TEMA 0-3 Facultad de Medicina Genética 1 er Curso TEMA 0-3 EXPRESIÓN GÉNICA: TRANSCRIPCIÓN Y TRADUCCIÓN ARN mensajero. La transcripción en eucariotas. Ribosomas. La traducción. ARN mensajero Apartados Síntesis

Más detalles

Tema 3. Expresión del material hereditario. Del ADN a la proteína. El Código Genético ALFREDO DE BUSTOS RODRÍGUEZ

Tema 3. Expresión del material hereditario. Del ADN a la proteína. El Código Genético ALFREDO DE BUSTOS RODRÍGUEZ Tema 3 Expresión del material hereditario. Del a la proteína. El Código Genético ALFREDO DE BUSTOS RODRÍGUEZ 1 Diámetro Vuelta completa 34Å Surco menor Esqueleto azúcar-fosfato Surco mayor Par de bases

Más detalles

21/09/2017. CONCEPTOS BÁSICOS Introducción Biología Molecular y Citogenética

21/09/2017. CONCEPTOS BÁSICOS Introducción Biología Molecular y Citogenética 1 2 3 CONCEPTOS BÁSICOS Introducción Biología Molecular y Citogenética Glosario Biología molecular: Parte de la biología que estudia los procesos vitales de los seres vivos en función de las características

Más detalles

Los tres tipos de RNA celular en E.coli son sintetizados por la misma RNA polimerasa según las instrucciones dadas por un DNA molde.

Los tres tipos de RNA celular en E.coli son sintetizados por la misma RNA polimerasa según las instrucciones dadas por un DNA molde. Reacción catalizada por la RNA polimerasa Los tres tipos de RNA celular en E.coli son sintetizados por la misma RNA polimerasa según las instrucciones dadas por un DNA molde. La RNA polimerasa de E. coli

Más detalles

Regulación de la expresión génica

Regulación de la expresión génica Regulación de la expresión génica Regulación de la expresión génica Mecanismos y sistemas que controlan la expresión de los genes Utilidad de la expresión génica Niveles de control de la expresión génica

Más detalles

Biología III. 2º Bachillerato METABOLISMO Y AUTOPERPETUACIÓN. Los genes y su función

Biología III. 2º Bachillerato METABOLISMO Y AUTOPERPETUACIÓN. Los genes y su función Biología 2º Bachillerato III. METABOLISMO Y AUTOPERPETUACIÓN 15 Los genes y su función 1. La replicación semiconservativa del DNA 2. El mecanismo de la replicación 3. La expresión del mensaje genético

Más detalles

Nombre 10 de Marzo de Lee cuidadosamente las instrucciones para responder a las siguientes preguntas

Nombre 10 de Marzo de Lee cuidadosamente las instrucciones para responder a las siguientes preguntas EXAMEN I. BIOLOGÍA MOLECULAR CLAVE (9147) Nombre 10 de Marzo de 2009 Lee cuidadosamente las instrucciones para responder a las siguientes preguntas I. Relaciona las dos columnas, escribiendo en la primer

Más detalles

4) Los alelos para una característica determinada se encontrarán:

4) Los alelos para una característica determinada se encontrarán: Choice 2 (2) 1) La inserción de un gen de insulina humana en el cromosoma de una bacteria, permite obtener la insulina humana sintetizada por dicha bacteria. Esto es posible porque ambas células comparten:

Más detalles

Trascripción. Traducción

Trascripción. Traducción Trascripción y Traducción 1 2 Tipos de ARN 3 Molécula lineal que contiene información genética copiada del ADN. Tiene regiones codificadoras y regiones no codificadoras como la cabeza o líder y la cola.

Más detalles

DEL GEN A LA PROTEINA

DEL GEN A LA PROTEINA DEL GEN A LA PROTEINA Parte I: Transcripción Capítulo 12 Expresión de Genes fenotipo Nivel molecular afecta la estructura y función de las células lo que determina que caracteres son expresados (fenotipo)

Más detalles

TEMA 9: Transcripción.

TEMA 9: Transcripción. TEMA 9: Transcripción. Para expresar la información del DNA se copian trozos, segmentos de información. Se trasncribe y la información del DNA pasa al RNA. Hay genes que se expresan en todas las células,

Más detalles

Procesamiento del ARN

Procesamiento del ARN ARN 2009 Procesamiento del ARN Departamento de Química Biológica Expresión de genes Propiedades del ARN Generalmente simple cadena (Alto grado de plegamiento) El azúcar es ribosa: -OH en 2 (-H en deoxi)

Más detalles

ADN. Nucleótido. Molécula orgánica formada por tres componentes: Estructura primaria del ADN

ADN. Nucleótido. Molécula orgánica formada por tres componentes: Estructura primaria del ADN GENÉTICA MOLECULAR ADN ESTRUCTURA ADN Estructura primaria del ADN Cadena lineal de nucleótidos que se unen por enlace fosfodiéster en sentido carbono 5 3 Nucleótido. Molécula orgánica formada por tres

Más detalles

CONCEPTOS BÁSICOS. Introducción Biología Molecular y Citogenética

CONCEPTOS BÁSICOS. Introducción Biología Molecular y Citogenética CONCEPTOS BÁSICOS Introducción Biología Molecular y Citogenética Glosario Biología molecular: Parte de la biología que estudia los procesos vitales de los seres vivos en función de las características

Más detalles

ACIDOS NUCLEICOS. Dra. Elena Alvarado León Área de Genética y Biología Celular Depto. De Morfología Humana Fac. de Medicina UNT

ACIDOS NUCLEICOS. Dra. Elena Alvarado León Área de Genética y Biología Celular Depto. De Morfología Humana Fac. de Medicina UNT ACIDOS NUCLEICOS Dra. Elena Alvarado León Área de Genética y Biología Celular Depto. De Morfología Humana Fac. de Medicina UNT ÁCIDOS NUCLEICOS Son las biomoléculas esenciales de un organismo Monómero:

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles

Genética molecular (II)

Genética molecular (II) Genética molecular (II) ESTRUCTURA DE UN GEN Cada molécula de ADN está formada por una sucesión de genes. Desde un punto de vista molecular un gen es una unidad de transcripción (desde el punto de vista

Más detalles

Cátedra Biología Molecular

Cátedra Biología Molecular Teórico Práctico de Problemas Nº 2 Replicación. PCR. Transcripción en procariotas y eucariotas. Regulación de la expresión génica. 1. Indique la o las respuestas correctas a. Los factores de transcripción

Más detalles

Programa materia Genética Molecular UNIDAD 1. ADN COMO MATERIAL GENETICO

Programa materia Genética Molecular UNIDAD 1. ADN COMO MATERIAL GENETICO Programa materia Genética Molecular CICY UNIDAD 1. ADN COMO MATERIAL GENETICO 1.1. Identificación del ADN como depósito de información genética 1.2. Propiedades químicas y físicas del ADN 1.3. Topología

Más detalles

4.5 Estructura y función del ARN, ARNm, ARNr y ARNt. Morelos Pérez Alberto Vitrago Flores Gregorio

4.5 Estructura y función del ARN, ARNm, ARNr y ARNt. Morelos Pérez Alberto Vitrago Flores Gregorio 4.5 Estructura y función del ARN, ARNm, ARNr y ARNt Morelos Pérez Alberto Vitrago Flores Gregorio Ácido ribonucleico (ARN) El ARN es la molécula que se encarga de dirigir las etapas intermedias de la síntesis

Más detalles

REPLICACIÓN, TRASNCRIPCIÓN Y TRADUCCIÓN. Material complementario

REPLICACIÓN, TRASNCRIPCIÓN Y TRADUCCIÓN. Material complementario REPLICACIÓN, TRASNCRIPCIÓN Y TRADUCCIÓN Material complementario Definiciones Replicación: proceso por el cual una molécula de DNA se duplica para dar lugar a dos moléculas de DNA hijas idénticas. Transcripción:

Más detalles

Regulación de la expresión génica

Regulación de la expresión génica Regulación de la expresión génica Estrategias de la regulación metabólica. A. Regulación de la cantidad de una proteína B. Regulación de su actividad Procesos regulatorios que afectan los niveles de una

Más detalles

Control de Expresión Génica Procariota. Profesor: Javier Cabello Schomburg, MS

Control de Expresión Génica Procariota. Profesor: Javier Cabello Schomburg, MS Control de Expresión Génica Procariota Profesor: Javier Cabello Schomburg, MS Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la

Más detalles

3.1 Replicación y reparación del ADN.

3.1 Replicación y reparación del ADN. 3 Replicación, trascripción y traducción del material genético. Objetivo: Describir como una célula duplica su material genético precisamente a partir del ADN y explicar como decodifica y utiliza la información

Más detalles

Estructura y partes de un gen.

Estructura y partes de un gen. UNIVERSIDAD AUTÓNOMA DE SINALOA Unidad Académica de Ciencias de la Nutrición y Gastronomía. Estructura y partes de un gen. Dr. Javier Magaña 1. Anna Islas 2. Diego Moreira 2. Eduardo Vargas 2. 1. Responsable

Más detalles

F.I.G.: Experimento de Volkin and Astrachan, 1956

F.I.G.: Experimento de Volkin and Astrachan, 1956 F.I.G.: Experimento de Volkin and Astrachan, 1956 Pi 32 Ultracentrifugación en CsCl y BrEt DNA 5 Bacterias más fagos RNA Aislamiento de ácidos nucleicos Cómo seguiría el experimento? Qué esperaría? F.I.G.:

Más detalles

UNIDAD ÁCIDOS NUCLEICOS II

UNIDAD ÁCIDOS NUCLEICOS II UNIDAD ÁCIDOS NUCLEICOS II DIRECTRICES Y ORIENTACIONES GENERALES PARA LAS PRUEBAS DE ACCESO A LA UNIVERSIDAD BLOQUE I. CUÁL ES LA COMPOSICIÓN DE LOS SERES VIVOS? LAS MOLÉCULAS DE LA VIDA I. PRINCIPALES

Más detalles

OBJETIVOS. Comprender la forma a través de la cual nuestro material genético se mantiene en el tiempo. Analizar el trayecto de la información genética

OBJETIVOS. Comprender la forma a través de la cual nuestro material genético se mantiene en el tiempo. Analizar el trayecto de la información genética REPLICACIÓN NM4 OBJETIVOS Comprender la forma a través de la cual nuestro material genético se mantiene en el tiempo. Analizar el trayecto de la información genética CONOCIMIENTOS PREVIOS NECESARIOS COMPOSICIÓN

Más detalles

REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS

REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS Flujo de la Información Genética Dogma central transcripción traducción ADN ARN Proteína replicación Regulación de la Expresión Génica En los organismos

Más detalles

Traducción de la información genética

Traducción de la información genética Traducción de la información genética Traducción Proceso altamente conservado en todos los organismos Costo energético muy alto (en bacterias de crecimiento rápido se invierte 80% de la energía) Altamente

Más detalles

Regulación génica. Necesaria tanto en procariotas como eucariotas. Todas las células del cuerpo tienen el mismo material genético

Regulación génica. Necesaria tanto en procariotas como eucariotas. Todas las células del cuerpo tienen el mismo material genético Regulación génica Necesaria tanto en procariotas como eucariotas Todas las células del cuerpo tienen el mismo material genético Bacterias responden a su ambiente expresando los genes apropiados. Economía

Más detalles