PAQUIPODOL AISLADO DE LA PLANTA Crotón ciliatoglanduliferus INHIBE LA ENZIMA QUE FOTOLIZA EL AGUA EN CLOROPLASTOS.

Tamaño: px
Comenzar la demostración a partir de la página:

Download "PAQUIPODOL AISLADO DE LA PLANTA Crotón ciliatoglanduliferus INHIBE LA ENZIMA QUE FOTOLIZA EL AGUA EN CLOROPLASTOS."

Transcripción

1 Memorias del XIV Congreso de Bioenergética y Biomembranas. Sociedad Mexicana de Bioquímica A.C. 13 al 18 noviembre 2005; Oaxaca, Oaxaca. PAQUIPODOL AISLADO DE LA PLANTA Crotón ciliatoglanduliferus INHIBE LA ENZIMA QUE FOTOLIZA EL AGUA EN CLOROPLASTOS. King-Díaz B 1., González-Vázquez R 1., Aguilar M.I 2., De Santiago-Gómez J.R 3. y Lotina-Hennsen B 1. 1 Depto. de Bioquímica, 2 Depto. de Farmacia, Fac. de Química; 3Laboratorio de plantas vasculares, Fac. de Ciencias, Universidad Nacional Autónoma de México. Cd. Universitaria, Deleg. Coyoacan. C.P México D.F. Tel: Fax: Resumen En este trabajo, se realizó el estudio químico bio-dirigido, de las hojas de la planta Crotón ciliatoglanduliferus, lo que resulto en el aislamiento de una mezcla de flavonoides, que al separarse se obtuvo retusina (5-hidroxi-3,7,3,4 - tetrametoxiflavona) y paquipodol (5,4 -dihidroxi-3,7,3 -trimetoxiflavona). Al ensayar los compuestos sobre la síntesis de ATP, paquipodol fue el más activo como inhibidor. El I 50 fue de 51 µm. Los datos indican que paquipodol se comporta como inhibidor de la reacción de Hill, dado que inhibe el transporte de electrones en sus tres estados (basal, fosforilante y desacoplado) en cloroplastos aislados de hojas espinaca. El fotosistema II (FSII) medido de H 2 O a DCPIP, así como la reacción parcial de H 2 O a SiMo (silicomolibdato) fueron inhibidos por concentraciones crecientes de paquipodol. Sin embargo, el fotosistema I (FSI) y la reacción parcial del FSII medido de DPC a DCPIP no fueron afectados por el compuesto. Estos resultados indican que el sitio de acción de paquipol se encuentra en el FSII a nivel de la enzima que fotoliza el agua. Los resultados fueron corroborados al medir la fluorescencia de la clorofila a. Retusina no fue estudiado debido a que es un inhibidor débil de la síntesis de ATP (inhibe un 20% aprox.). La diferencia estructural entre retusina y paquipodol es el grupo OH en la posición 4 que tiene paquipodol, lo que indica que este grupo es importante para la actividad inhibitoria. Introducción. Crotón ciliatoglanduliferus Ort. (Euphorbiaceae) es una planta que se encuentra en la región de Tehuacan Puebla, y en el Estado de Guerrero. Ha sido usada como repelente a insectos y en la medicina tradicional [1]. Por cromatografía biodirigida, el estudio químico del extracto hexánico de las hojas de la planta permitió el aislamiento de dos flavonoides: retusin y paquipodol. Retusin y paquipodol han sido aislados anteriormente en las plantas del genero Ballota, como son Ballota glandulosissima [2], B. Inaequidens [3] y de otras plantas como Larrea cuneifolia [4]. Éstos compuestos presentan propiedades antifungicidas [2,3] y antimutagénicas [5]. A la fecha su efecto sobre la fotosíntesis no ha sido reportado.

2 Como parte de nuestras investigaciones en productos naturales con actividad biocida, estos compuestos fueron estudiados sistemáticamente en su actividad como potenciales herbicidas. En este trabajo reportamos el efecto sobre diferentes actividades fotosintéticas de concentraciones crecientes de paquipodol (hasta 300 µm), empleando métodos polarográficos, y la técnica de medición de la curva de inducción de fluorescencia de clorofila a de FSII (curva de Kautsky) [6]. La medición de los cambios en la curva de inducción de la fluorescencia de la clorofila a, han sido utilizados en investigaciones sobre la fotosíntesis y pueden ser utilizados para el estudio de compuestos que inhiben al FSII. Materiales y métodos Las hojas de C. ciliatoglanduliferus fueron recolectadas en el estado de Guerrero y secadas. Aproximadamente 500 g de hoja fueron molidas y extraídas exhaustivamente con hexano. El solvente fue evaporado al vació para dar 15 g del extracto crudo que inhibió la síntesis de ATP (Fig.1). El valor de I 50 fue de 34 ppm. Sintesís de ATP (%) [Extracto hexánico] ppm Fig. 1. Efecto de concentraciones crecientes del extracto hexánico obtenido de las hojas de C. ciliatoglanduliferus sobre la síntesis de ATP de tilacoides de espinaca. El control fue de 942 µm de ATP mg -1 Chl h -1. El extracto fue fraccionado por columna cromatográfica y eluído con un gradiente de hexano-etoac (acetato de etilo). En la fracción 80:20 cristalizó espontáneamente la mezcla de flavonoides 5-hidroxi-3,7,3,4 -tetrametoxiflavona y 5,4 -dihidroxi-3,7,3 -trimetoxiflavona (50 mg). Estos compuestos fueron separados por cromatografía en capa fina y sus estructuras fueron confirmadas comparando su punto de fusión y propiedades espectroscopicas (UV, 1 HNMR, 13 NMR y MC, con datos anteriormente publicados [4,7,8]. Aislamiento de cloroplastos y determinación de clorofila. Los cloroplastos fueron aislados de hojas de espinaca (Spinacea oleracea L.) tal como se ha publicado previamente [9,10]. Él medio de aislamiento contiene sacarosa 400 mm, MgCl 2 5 mm, KCl 10 mm y Tricina 30 mm (ph = 8.0). Después fueron resuspendidos en el mismo medio y almacenados en la obscuridad por 1 h a 4 ºC. La clorofila fue cuantificada según el método de Strain [11]. Determinación de la síntesis de ATP y el transporte de electrones. La síntesis de ATP fue determinada utilizando un microelectrodo Orion Mod. Ross conectado a un potenciómetro con escala expandida como reporta Dilley [12], el rango de ph en el que se realizaron las medidas fue entre 8.0 y 8.1. El medio de reacción para la

3 síntesis de ATP contiene sacarosa100 mm, KCl 10 mm, MgCl 2 5 mm, KCN0.5 mm, Tricina 1 mm (ph = 8.0) y MV (metil viologeno) 50 µm como aceptor de electrones exógeno en la presencia de ADP 1 mm y KH 2 PO 4 3 mm. El transporte de electrones no-cíclico de H 2 O a MV fue determinado utilizando un electrodo tipo Clark conectado a un monitor de oxígeno YSI (Yellow Spring Instrument) mod La velocidad del transporte de electrones basal fue medido iluminando los cloroplastos (20 µg de clorofila) por un minuto, en un medio similar al de la síntesis de ATP, en este medio se utilizó tricina 15 mm en lugar de 1, y no se uso ADP ni KH 2 PO 4. El transporte de electrones fosforilante no-cíclico fue medido de la misma manera que el basal, y se agregó ADP 1 mm y KH 2 PO 4 3 mm. El transporte de electrones desacoplado fue ensayado en el medio basal y se le agrego NH 4 Cl 6 mm [13,14]. Flujo de electrones desacoplado de FSI y FSII. El transporte de electrones desacoplado de FSII fue medido de H 2 O a DCPIP (diclorofenolindofenol) usando el medio para el transporte basal mas DBMIB (2,5-dibromo-3-metil-6-isoproil-pbenzoquinona) 1 µm como inhibidor del flujo de electrones a FSI, DCPIP 100 µm/ K 3 [Fe(CN) 6 ] 500 µm y NH 4 Cl 6 mm. MV fue omitido [13]. La reacción parcial del flujo de electrones del FSII de H 2 O a SiMo (silicomolibdato de sodio) fue determinado con el medio de transporte de electrones basal sin MV, en este caso el DBMIB se cambio por DCMU (3-(3,4 -diclorofenil)-1,1- dimetilurea) 10 µm y el DCPIP/ K 3 [Fe(CN) 6 se cambio por SiMo. La reacción parcial desacoplada del FSII de DPC (difenil carbazida) a DCPIP oxidado, fue medida como DCPIP reducido en un espectrofotómetro marca Beckman DU 650 con tilacoides previamente incubados con Tris 0.8 M (ph = 8.0) durante 30 min. a 4 ºC [14]. El transporte de electrones desacoplado del FSI se determino en forma similar al transporte de electrones basal no cíclico mas DCMU10 µm, DCPIP 100 µm reducido con ascorbato y NH 4 Cl 6 mm [15]. El valor de I 50 para cada actividad es determinado como la concentración de compuesto que produce el 50 % de inhibición. Medición de la fluorescencia de la clorofila a de FSII. Las curvas de inducción de la fluorescencia de la clorofila a fueron medidas a temperatura ambiente utilizando un fluorometro Handy PEA (Plant Efficient Analyzer) Hansatech como ha descrito anteriormente Strasser et al., [6] y King-Díaz et al., [16]. Alícuotas de 20 µg de cloroplastos frescos fueron incubados por 5 min en la oscuridad. Cada alícuota fue lisada en fresco con medio de transporte de electrones basal. La máxima fluorescencia producida por la muestra fue generada usando una lámpara de 6 diodos que emiten un pulso de luz roja de alta intensidad a 650 nm. La duración del pulso fue de 2 s. Resultados y discusión Del extracto hexánico de hoja de la planta C. ciliatoglanduliferus que inhibió la síntesis de ATP (Fig. 1), se obtuvo una mezcla de compuestos que al ser separada por cromatografía de capa fina dio como resultado dos flavonoides que al ser caracterizados estructuralmente correspondieron a retusina (5-hidroxi-3,7,3,4 - tetrametoxiflavona) y paquipodol (5,4 -dihidroxi-3,7,3 -trimetoxiflavona).

4 MeO O MeO O 3' 4' OH 2' 5' 1' 2 6' OH O 6 10 OH 4 O 3 (Retusina) (Paquipodol) Efectos de retusina y paquipodol sobre las actividades fotosintéticas. Tanto retusina como paquipodol inhibieron la síntesis de ATP de H 2 O a MV acoplada al transporte de electrones en cloroplastos lisados en fresco como se observa en la Fig Sintesis de ATP (%) [Flavonoides retusina y paquipodol] µm Fig. 2. Efecto de concentraciones crecientes de ( ) retusina y paquipodol ( ) sobre la síntesis de ATP en tilacoides de espinaca. El valor del control de la síntesis de ATP fue de 1200 µm de ATP/mg -1 Chl h -1 De los dos compuestos, paquipodol fue el que presento mayor actividad como inhibidor de la síntesis de ATP con un I 50 de 51 µm. Retusina solo inhibió esta actividad en un 20% aproximadamente, por lo que no se estudio en las siguientes actividades. Estos resultados sugieren que el grupo -OH libre del paquipodol en la posición 4 es requerido para que el compuesto presente inhibición de la síntesis de ATP, ya que cuando esta metoxilado como en retusina pierde actividad. Para elucidar el mecanismo y sitio de acción del paquipodol, se midieron sus efectos sobre el transporte de electrones cíclico en sus tres estados (basal, fosforilante y desacoplado) de H 2 O a MV. Como se puede observar en la gráfica 3, a medida que la concentración de paquipodol aumenta se inhibe el flujo de electrones en diferentes grados, siendo los transportes de electrones fosforilante y desacoplado los más inhibidos con I 50 de 30 y 76 µm respectivamente.

5 Flujo de electrones (%) [Paquipodol] µm Fig. 3. Efectos del paquipodol sobre el transporte de electrones nociclico basal ( ), fosforilante ( ) y desacoplado ( ) de agua a MV. Los valores de los controles fueron 600, 1401 y 1734 µequiv. e - mg Chl -1 h -1. El flujo de electrones basal fue el menos inhibido, lo que sugiere que durante la fosforilación y el transporte de electrones desacoplado el sitio en donde inhibe el paquipodol esta expuesto, pero en condiciones basales el sitio se encuentra oculto. Localización del sitio de interacción del paquipodol en los fotosistemas. Para localizar el sitio de acción del paquipodol en la cadena transportadora de electrones al actuar como inhibidor de la reacción de Hill, el efecto del compuesto fue ensayado sobre los FSI y FSII, así como en las reacciones parciales, utilizando donadores, aceptores e inhibidores de electrones adecuados para tal efecto [17]. La tabla 1 muestra como paquipodol inhibe tanto el FSII desacoplado como la reacción parcial desacoplada de FSII de H 2 O a SiMo. Sin embargo, no presenta efecto sobre el FSI medido de DCPIP reducido a MV. Los resultados indican que paquipodol inhibe el transporte de electrones de FSII de H 2 O a Q A. Table 1. Efecto de las concentraciones crecientes de paquipodol en los transportes de electrones desacoplados de FSII, reacciones parciales de FSII y FSI. PSII H 2 O to DCPIP SiMo to DCPIP DPC to DCPIP PSI DCPIPred to MV Conc. (µm) µequiv. e - mg -1 Chl h -1 % µequiv. e - mg -1 Chl h -1 % µm DCPIPred mg -1 Chl h -1 % µequiv. e - mg -1 Chl h -1 % Para determinar el sitio de inhibición del paquipodol en el FSII se midió el flujo de electrones de DPC a DCPIP en condiciones desacopladas con cloroplastos tratados con Tris 0.8 M. Los datos mostrados en la tabla 1 indican que el paquipodol no inhibe en este tramo de la cadena, por lo tanto el sitio de inhibición se encuentra en el lado donador del FSII. Medida de la fluorescencia de la clorofila a en presencia de paquipodol. Para corroborar el sitio de interacción del paquipodol en el FSII, cloroplastos lisados en fresco fueron incubados por 5 min en la oscuridad a temperatura

6 ambiente con diferentes concentraciones de paquipodol. Cloroplastos incubados con 10 µm de DCMU y Tris 0.8 M fueron usados como controles positivos (Fig. 4). Fluorescence yield (Relative) , Time (ms) 10 µm DCMU Control 150 µm 300 µm 600 µm 0.8 M Tris Fig. 4. Curvas de inducción de fluorescencia de la clorofila a de cloroplastos lisados en fresco e infiltrados con paquipodol. DCMU y Tris fueron usados como control positivo. Los detalles son mostrados en material y métodos. Los datos son el resultado de 3 replicas. La curva control en tilacoides muestra una secuencia polifásica OJIP similar a la ya descrita por Strasser para plantas, algas verdes y cianobacterias [6]. La adición de 10 µm de DCMU induce un aumento rápido de la fluorescencia durante los 2 primeros ms de iluminación y transforma la secuencia OJIP en OJ [6]. Cuando los tilacoides son tratados con Tris, un conocido inhibidor del sitio donador de electrones en el FSII, da como resultado una reducción en la fluorescencia máxima, aparece la fase K que consiste de un rápido aumento de la fluorescencia a 300 µs y después la fluorescencia disminuye a un nivel cercano a F 0 (fluorescencia inicial). Las fases J e I ya no se observan en la curva [18]. En la Fig. 2 se muestra el incremento en la supresión de la fase J (a 2 ms) y la aparición del paso K a medida que la concentración de paquipodol va en aumento, la aparición del paso K indica que el lado donador del FSII esta siendo bloqueado por paquipodol. Los valores de F 0 y F M (fluorescencia máxima) disminuyeron de 2 a 1000 ms (Tabla 2 y Figura 4), estos resultados también indican la creación de silent reaction centres o centros de reacción silenciosos [19] los cuales son centros de reacción que funcionan como trampas para disipar la energía de excitación creando moléculas de Q A no reducidas. Table 2. Efecto sobre los parámetros de la fluorescencia en tilacoides con DCMU, incubados en la oscuridad con Tris 0.8 M y con concentraciones crecientes de paquipodol. Compound F 0 F m F v / Fm Area Control µm DCMU Mm tris Paquipodol (µm)

7 Conclusiones De los estudios realizados se encontró por primera vez que retusina y paquipodol son constituyentes de la planta de Crotón ciliatoglanduliferus Ort. (Euphorbiaceae). Los resultados sugieren que paquipodol actúa como inhibidor de la reacción de Hill a nivel de la enzima que fotoliza el agua creando centros de reacción silenciosos e inhibiendo la enzima que fotolisa el agua. El grupo OH en la posición 4 en la estructura de paquipodol es determinante para la actividad inhibitoria del compuesto. Este compuesto es prometedor como un nuevo bioherbicida biodegradable, pero futuros estudios in vivo y la síntesis y estudio del mecanismo de acción de sus derivados son necesarios. Referencias [1] Huerta A., Lopez-Olguin J.F., Aragon A., Budia F., Del Estal P., Vinuela E. Effect of a powder and watery extract of Croton ciliatoglanduliferus Ort. (Euphorbiaceae) incorporated into the diet of Spodoptera littoralis (Boisduval) (Lepidoptera: Noctuidae). Boletín de Sanidad Vegetal de Plagas, 28 (2002) [2] Çitoğlu G.S., Sever B., Antus S., Baitz-Gács E., Altanlar N. Antifungal flavonoids from Ballota glandulosissima. Pharmaceutical Biology 41, (2003) [3] Çitoğlu G.S., Sever B., Antus S., Batiz-Gács E. Altanlar N. Antifungal diterpenoids and flavonoids from Ballota inaequidens. Pharmaceutical Biology, 42 (2004) [4] Valesi A.G., Rodriguez E., Velde G.V., Mabry T.J. Methylated flavonols in Larrea cuneifolia. Phytochemistry, 11 (1972) [5] Miyazawa M., Okuno Y., Nakamura S., Kosaka H. Antimutagenic activity of flavonoids from Pogostemon cablin. J. Agric. Food Chem. 48 (2000) [6] Strasser R.J., Srivastava A., Govindjee. Polyphasic chlorophyll a fluorescence transient in plants and cianobacteria. Photochem. Photobiol. 66 (1995) [7] Agrawal P.K. En: Carbon-13 NMR of flavonoids. Elsevier, Amsterdan, 1989, pp [8] Schmidt T.J., Merfort I., Matthiesen U. Resolution of complex mixtures of flavonoid aglycones by analysis of gas chromatographic-mass spectrometric data. J. Cromatography, 634 (1993) [9] Mills J.D., Mitchell P., Shurmann P., Modulation of coupling ATPase activity in intact chloroplasts. FEBS Lett. 112 (1980) [10] Garza-Ortíz A., King-Díaz B., Sosa-Torres M.E., Lotina-Hennsen B. Interference of ruthenium red analogues at photosystem II of spinach thylakoids.. J. Photochem. Photobiol. B. 76 (2004) [11] Strain H.H., Cope T., Svec M.A., Analytical procedures for the isolation, identification, estimation and investigation of the chlorophylls. Methods Enzymol. 23 (1971) [12] Dilley R.A. Ion transport (H +, K +, Mg 2+ exchange phenomena), Methods Enzymol. 24 (1972)

8 [13] Saha S., Ouitrakul R., Isawa S., Good N. Electron transport and phosphorylation in chloroplasts as a function of the electron acceptor. J. Biol. Chem. 245 (1971) [14] Giaquinta R.T., Selman B.R., Anderson B.J., Dilley R.A., Inhibition of coupling factor activity of chloroplast membrane by diazonium compounds. J. Biol. Chem. 249 (1974) [15] Vernon L.P., Shaw E.R. Photoreduction of 2,5-dichlorophenol indophenol by diphenylcarbazide: A photosystem 2 reaction catalysed by Tris-washed chloroplasts and subchloroplast fragments. Plant Physiol. 44 (1969) [16] King-Díaz B., Montes-Ayala J., Barba-Behrens N., Castillo-Blum S.E., Escartín- Guzmán C., Iglesias-Prieto R., Lotina-Hennsen B., Interference by nickel(ii) salts and their emizco coordination compounds on the chloroplasts redox chain, Z. Naturforsch 53c (1998) [17] Allen J.F., Holmes N.G. Electron transport partial reactions. En: Hipkinns M.F., Baker N.R. (Eds.) Photosynthesis, Energy Transduction. Chapter 5, A practical Approach. IRL Press, Oxford UK, 1986, pp [18] Strasser B.J., Donor side capacity of photosystem probed by chlorophyll a fluorescence transients. Photosynth. Research, 52 (1997) [19] Tóth S.Z., Schansker G., Strasser RJ. In intact leaves, the maximum fluorescence level (F M ) is independent of the redox state of the plastoquinone pool: A DCMU-inhibition study. Biochem. Biophys. Acta, 1708 (2005)

MANUAL DE PRACTICAS DE FISIOLOGIA VEGETAL

MANUAL DE PRACTICAS DE FISIOLOGIA VEGETAL MANUAL DE PRACTICAS DE FISIOLOGIA VEGETAL Facultad de Ciencias Agropecuarias - UNER Autores: Lallana, V.H. y Lallana, Ma. del C. (2001) FOTOSINTESIS Contenido: A. Reacción de Hill B. Extracción y separación

Más detalles

TÉCNICAS POLAROGRÁFICAS: DETERMINACIÓN DE FOTOSÍNTESIS Y RESPIRACIÓN EN SUSPENSIONES CELULARES DE CIANOBACTERIAS

TÉCNICAS POLAROGRÁFICAS: DETERMINACIÓN DE FOTOSÍNTESIS Y RESPIRACIÓN EN SUSPENSIONES CELULARES DE CIANOBACTERIAS TÉCNICAS POLAROGRÁFICAS: DETERMINACIÓN DE FOTOSÍNTESIS Y RESPIRACIÓN EN SUSPENSIONES CELULARES DE CIANOBACTERIAS 1. BASES TEÓRICAS MEDIDA DE LOS INTERCAMBIOS DE OXÍGENO EN FOTOSÍNTESIS Y RESPIRACIÓN MEDIANTE

Más detalles

1. En la microfotografía indique tilacoides, granas, estroma y membrana interna y externa.

1. En la microfotografía indique tilacoides, granas, estroma y membrana interna y externa. TEMA 8 FOTOSINTESIS Antes de realizar la guía deberá revisar: 1. Ultraestructura del cloroplasto. 2. Espectro electromagnético y espectro visible. 3. Concepto de autotrofía Evaluación: 1. En la microfotografía

Más detalles

Cap. 8 Fotosíntesis. Dra. Ramírez Page 1

Cap. 8 Fotosíntesis. Dra. Ramírez Page 1 Fotosíntesis transforma la energía solar capturada en los cloroplastos en energía química almacenada en azúcares y otros compuestos orgánicos. Materia prima: CO 2 y H 2 O y energía. Directa e indirectamente

Más detalles

Fotosíntesis. Conceptos y fases 27-09-2014

Fotosíntesis. Conceptos y fases 27-09-2014 Fotosíntesis Conceptos y fases o La mayoría de los autótrofos vegetales fabrican su propio alimento utilizando la energía luminosa. o La energía de luz se convierte en la energía química que se almacena

Más detalles

Presentación organizada por José Antonio Pascual Trillo

Presentación organizada por José Antonio Pascual Trillo Presentación organizada por José Antonio Pascual Trillo La fotosíntesis es un proceso que se desarrolla en dos etapas: Reacciones lumínicas: es un proceso dependiente de la luz (etapa clara), requiere

Más detalles

Tema 14. La Fase luminosa de la fotosíntesis Javier Corzo. Departamento de Bioquímica y Biología Molecular Universidad de La Laguna

Tema 14. La Fase luminosa de la fotosíntesis Javier Corzo. Departamento de Bioquímica y Biología Molecular Universidad de La Laguna Tema 14. La Fase luminosa de la fotosíntesis Javier orzo. Departamento de Bioquímica y Biología Molecular Universidad de La Laguna 1. Vamos a considerar como fotosíntesis exclusivamente al proceso de transformación

Más detalles

2º BACHILLERATO TEMA 13: ANABOLISMO

2º BACHILLERATO TEMA 13: ANABOLISMO 1. Los cloroplastos. La fotosíntesis. 1.1. Los cloroplastos. Orgánulos redondeados similares a las mitocondrias, de origen endosimbiótico, típicos de células vegetales. Su tamaño es de 3-19 de longitud

Más detalles

Fotosíntesis. CO 2 + 2H 2 O! (CH 2 O) + O 2 ü+ H 2 O

Fotosíntesis. CO 2 + 2H 2 O! (CH 2 O) + O 2 ü+ H 2 O Fotosíntesis De la totalidad de la energía solar que llega a la Tierra cada año, sólo el 0,1 % queda aquí retenido en forma de biomasa. Por medio de la fotosíntesis, los organismos verdes captan la energía

Más detalles

LA FOTOSÍNTESIS. 6 CO2 + 12 H2O + Pigmentos en cloroplastos C6H12O6 + 6 O2 + 6 H2O

LA FOTOSÍNTESIS. 6 CO2 + 12 H2O + Pigmentos en cloroplastos C6H12O6 + 6 O2 + 6 H2O Importancia biológica la fotosíntesis (reacción global la fotosíntesis para la formación una molécula glucosa). La fase luminosa: fotolisis, fotorreducción y fotofosforilación (cíclica y acíclica). La

Más detalles

http://www.cbm.uam.es:8080/amserrano/bqe3bgoct06.pdf Alberto Martínez Serrano

http://www.cbm.uam.es:8080/amserrano/bqe3bgoct06.pdf Alberto Martínez Serrano http://www.cbm.uam.es:8080/amserrano/bqe3bgoct06.pdf Alberto Martínez Serrano Depto. Biología Molecular Facultad de Ciencias. Laboratorio CX-450. tel.: 91 497 3504 e-mail: amserrano@cbm.uam.es Concepto.

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

Cuantificación de Clorofila a

Cuantificación de Clorofila a Cuantificación de Clorofila a Clorofilas Las clorofilas son una familia de pigmentos de color verde que se encuentran en las cianobacterias y en todos aquellos organismos que contienen cloroplastos en

Más detalles

BIOENERGÉTICA CUESTIONARIO

BIOENERGÉTICA CUESTIONARIO BIOENERGÉTICA CUESTIONARIO 1) a) El esquema representa una mitocondria con diferentes detalles de su estructura. Identifique las estructuras numeradas del 1 al 8. b) Indique dos procesos de las células

Más detalles

La célula vegetal: aspectos estructurales y metabólicos diferenciados

La célula vegetal: aspectos estructurales y metabólicos diferenciados La célula vegetal: aspectos estructurales y metabólicos diferenciados Descripción de la célula vegetal La célula vegetal presenta algunas diferenciaciones morfológicas respecto a la célula animal: a) Tienen

Más detalles

Iván Ferrer Rodríguez, Ph.D. Catedrático

Iván Ferrer Rodríguez, Ph.D. Catedrático Iván Ferrer Rodríguez, Ph.D. Catedrático Fotosíntesis Parte II Capítulo 10, Reece, Urry, Cain, Wasserman, Minorsky, Jackson, 2009 Campbell Biology 9 th Edition Espectro electromagnético La luz es una forma

Más detalles

www.selectividadfacil.com

www.selectividadfacil.com 10.- ANABOLISMO Es la parte del metabolismo encargada de transformar la materia inorgánica en materia orgánica. Solo se lleva a cabo en células autótrofas mediante la fotosíntesis y la quimiosíntesis.

Más detalles

Grupo 605 Fuentes Bartolo Erika Rojano Montes Aarón Solís Pinson Ana Belén Velasco Gutiérrez Mariana

Grupo 605 Fuentes Bartolo Erika Rojano Montes Aarón Solís Pinson Ana Belén Velasco Gutiérrez Mariana Grupo 605 Fuentes Bartolo Erika Rojano Montes Aarón Solís Pinson Ana Belén Velasco Gutiérrez Mariana http://www.jardineria.pro/wp-content/uploads/2008/03/flor-de-un-dia.jpg Fotosíntesis Proceso de transformación

Más detalles

32. Estudio cinético de la actividad invertasa de levadura de panadería.

32. Estudio cinético de la actividad invertasa de levadura de panadería. 32. Estudio cinético de la actividad invertasa de levadura de panadería. Manuel Tena Aldave, Jesús V. Jorrín Novo Departamento de Bioquímica y Biología Molecular, Campus Universitario de Rabanales, Edificio

Más detalles

Laboratorio. Objetivos INTRODUCCIÓN. Al finalizar este laboratorio el estudiante podrá:

Laboratorio. Objetivos INTRODUCCIÓN. Al finalizar este laboratorio el estudiante podrá: Laboratorio 9 Fotosíntesis Objetivos Al finalizar este laboratorio el estudiante podrá: 1. Describir cuál es el rol de la luz y los pigmentos en la fotosíntesis. 2. Describir las reacciones principales

Más detalles

Guía de Biología: Fotosíntesis Fecha I.ANTECEDENTES GENERALES UNIDAD Nº: 4 Nombre Unidad: ECOLOGÍA CONTENIDOS NOTA II. ANTECEDENTES ALUMNO NOMBRE

Guía de Biología: Fotosíntesis Fecha I.ANTECEDENTES GENERALES UNIDAD Nº: 4 Nombre Unidad: ECOLOGÍA CONTENIDOS NOTA II. ANTECEDENTES ALUMNO NOMBRE Guía de Biología: Fotosíntesis Fecha I.ANTECEDENTES GENERALES UNIDAD Nº: 4 Nombre Unidad: ECOLOGÍA CONTENIDOS Fotosíntesis, Organismos autótrofos. FECHA DE ENTREGA: PUNTAJE TOTAL PUNTAJE OBTENIDO: NOTA

Más detalles

2. DESARROLLO EXPERIMENTAL

2. DESARROLLO EXPERIMENTAL otro lado, también ha crecido el interés por el desarrollo de materiales en forma de película delgada con propiedades termoluminiscentes. Las películas de carbono nitrurado depositadas por la técnica de

Más detalles

Proceso de fotosíntesis

Proceso de fotosíntesis Proceso de fotosíntesis Sumario Las moléculas de los seres vivos Control de la actividad celular Fuente de energía para las células Proceso de fotosíntesis: 1. Las condiciones necesarias para la fotosíntesis

Más detalles

EXPERIMENTAL. Materiales

EXPERIMENTAL. Materiales EXPERIMENTAL Materiales Los materiales que se utilizaron en la síntesis de los ligantes, de los complejos y en los estudios espectroscópicos como se encuentran disponibles comercialmente y se enuncian

Más detalles

Medición de oxígeno por método potenciométrico

Medición de oxígeno por método potenciométrico Medición de oxígeno por método potenciométrico F A Niederle 1, R E Madrid y C J Felice Laboratorio de Medios e Interfases (LAMEIN), Departamento de Bioingeniería, FACET-UNT/INSIBIO-CONICET. 1 E-mail: agustinniederle@hotmail.com

Más detalles

FOTOSINTESIS. Material elaborado por: J. Monza, S. Signorelli, O. Borsani y M. Sainz.

FOTOSINTESIS. Material elaborado por: J. Monza, S. Signorelli, O. Borsani y M. Sainz. FOTOSINTESIS Material elaborado por: J. Monza, S. Signorelli, O. Borsani y M. Sainz. Las plantas, algas y cianofíceas (bacterias verde-azules), sintetizan materia orgánica a partir de moléculas inorgánica:

Más detalles

2.-FISIOLOGÍA CELULAR

2.-FISIOLOGÍA CELULAR 2.-FISIOLOGÍA CELULAR METABOLISMO CELULAR Metabolismo. Conjunto de reacciones químicas que se dan en un organismo vivo. Se pueden clasificar en dos grandes grupos. Catabolismo: Reacciones degradativas

Más detalles

Catabolismo de la glucosa Ocurre en cuatro etapas:

Catabolismo de la glucosa Ocurre en cuatro etapas: 1 Catabolismo de la glucosa Ocurre en cuatro etapas: 1.- Glucólisis 2.- Descarboxilación oxidativa 3.- Ciclo de Krebs 4.- Cadena respiratoria o fosforilación oxidativa 1.- GLUCÓLISIS Ocurre en el citoplasma.

Más detalles

HSCoA. CH 3 CO-SCoA COO HO C COO. Citrato. Sintasa. Aconitasa COO COO. Citrato NADH + H + + CO 2 COO І І І І. S-CoA Succinil-CoA

HSCoA. CH 3 CO-SCoA COO HO C COO. Citrato. Sintasa. Aconitasa COO COO. Citrato NADH + H + + CO 2 COO І І І І. S-CoA Succinil-CoA IL DE KREBS HSoA AD + Malato H 2 ADH + H + Malato deshidrogenasa H H HH Fumarato hidratasa xalacetato H 2 H 3 -SoA itrato Sintasa H itrato H 2 Aconitasa H is-aconitato H 2 Aconitasa Fumarato FADH 2 H H

Más detalles

TEMA 17: EL ANABOLISMO.

TEMA 17: EL ANABOLISMO. 1 TEMA 17: EL ANABOLISMO. El anabolismo es la fase del metabolismo en la que a partir de unos pocos precursores sencillos y relativamente oxidados se obtienen moléculas orgánicas cada vez más complejas

Más detalles

Energía de la luz H 2 O + CO 2 O 2 + CH 2 O dador aceptor dador aceptor reducido oxidado oxidado reducido

Energía de la luz H 2 O + CO 2 O 2 + CH 2 O dador aceptor dador aceptor reducido oxidado oxidado reducido TEMA 14. EL A ABOLISMO 1.A ABOLISMO 2.LA FOTOSÍ TESIS 2.1.ECUACIÓ DE LA FOTOSÍ TESIS. 2.2.FASES DE LA FOTOSÍ TESIS. 3.FASE LUMI OSA 3.1.CAPTACIÓ DE LA LUZ. LOS FOTOSISTEMAS. 3.2.TRA SPORTE O CICLICO DE

Más detalles

RECUPERACIÓN DE METALES PRECIOSOS POR ELECTRÓLISIS, DE EFLUENTES DE LA INDUSTRIA DE CONVERTIDORES CATALITICOS

RECUPERACIÓN DE METALES PRECIOSOS POR ELECTRÓLISIS, DE EFLUENTES DE LA INDUSTRIA DE CONVERTIDORES CATALITICOS RECUPERACIÓN DE METALES PRECIOSOS POR ELECTRÓLISIS, DE EFLUENTES DE LA INDUSTRIA DE CONVERTIDORES CATALITICOS Velázquez López Mariana 1, Dr. Alatorre Ordaz Martin Alejandro 2 1 Universidad de Guanajuato,

Más detalles

PRÁCTICAS DE FISIOLOGÍA VEGETAL

PRÁCTICAS DE FISIOLOGÍA VEGETAL PRÁCTICAS DE FISIOLOGÍA VEGETAL (Guiones elaborados por los profesores de prácticas) PRIMER CUATRIMESTRE Lugar: Laboratorio de docencia de Fisiología Vegetal Departamento de Biología Vegetal Los alumnos

Más detalles

Fotosíntesis. PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece. Lectures by Chris Romero

Fotosíntesis. PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece. Lectures by Chris Romero Fotosíntesis PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero El proceso que alimenta la biosfera Fotosíntesis es el proceso que convierte la luz solar

Más detalles

Bombas de Protones. Adalberto Benavides Mendoza. Universidad Autónoma Agraria Antonio Narro, correo electrónico: abenmen@uaaan.mx

Bombas de Protones. Adalberto Benavides Mendoza. Universidad Autónoma Agraria Antonio Narro, correo electrónico: abenmen@uaaan.mx Bombas de Protones Adalberto Benavides Mendoza Universidad Autónoma Agraria Antonio Narro, correo electrónico: abenmen@uaaan.mx 1. INTRODUCCIÓN Para su funcionamiento las células requieren de energía bioquímica

Más detalles

Clasificación de los mecanismos de transporte de solutos a través de membranas

Clasificación de los mecanismos de transporte de solutos a través de membranas Clasificación de los mecanismos de transporte de solutos a través de membranas 1. Transporte no mediado o difusión simple (Bicapa lipídica) ( G < 0) 2. Transporte mediado (Proteínas de membrana) 2.1. T.

Más detalles

Conductividad en disoluciones electrolíticas.

Conductividad en disoluciones electrolíticas. Conductividad en disoluciones electrolíticas. 1.- Introducción 2.- Conductores 3.- Definición de magnitudes 3.1- Conductividad específica 3.2 Conductividad molar " 4. Variación de la conductividad (, ")

Más detalles

Interface Recolectora de Datos 7000-I

Interface Recolectora de Datos 7000-I Sistema de adquisición de datos que combina una computadora lap-top e interface. Es por esto que no requiere una computadora adicional por que es una computadora laptop completa. Lo que maximiza la utilización

Más detalles

UNIDAD 3: SOLUCIONES

UNIDAD 3: SOLUCIONES UNIDAD 3: SOLUCIONES 1 Las soluciones son mezclas homogéneas. Estas constan de dos o más componentes en una única fase, por ejemplo agua con sal de cocina, o azúcar en agua Para estudiar o trabajar con

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

NUTRICION MICROBIANA

NUTRICION MICROBIANA NUTRICION MICROBIANA La nutrición es el proceso por el que los microorganismos toman del medio donde habitan las sustancias químicas que necesitan para crecer Dichas sustancias se denominan nutrientes

Más detalles

Resolución de la competición estructural DNA cuádruple / dúplex

Resolución de la competición estructural DNA cuádruple / dúplex Resolución de la competición estructural DNA cuádruple / dúplex Joaquim Jaumot 1, Romà Tauler 2, Ramón Eritja 2, Raimundo Gargallo 1 1: Dept. Química Analítica, Universidad de Barcelona 2: Centro de Investigación

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Universidad Católica Agropecuaria del Trópico Seco Pbro. Francisco Luis Espinoza Pineda Fundación 1968-2011

Universidad Católica Agropecuaria del Trópico Seco Pbro. Francisco Luis Espinoza Pineda Fundación 1968-2011 Universidad Católica Agropecuaria del Trópico Seco Pbro. Francisco Luis Espinoza Pineda Fundación 1968-2011 Carrera: Medicina Veterinaria y Zootecnia Asignatura: Bioquímica Oxidaciones Biológicas Introducción

Más detalles

TEMA 13. EL METABOLISMO CELULAR 5. PROCESOS DE OXIDO-REDUCCIO E EL METABOLISMO

TEMA 13. EL METABOLISMO CELULAR 5. PROCESOS DE OXIDO-REDUCCIO E EL METABOLISMO TEMA 13. EL METABOLISMO CELULAR 1. METABOLISMO CELULAR: GE ERALIDADES. 2. RUTAS METABÓLICAS. 3. TIPOS DE PROCESOS METABÓLICOS. 4. TIPOS METABOLICOS DE SERES VIVOS. 5. PROCESOS DE OXIDO-REDUCCIO E EL METABOLISMO

Más detalles

UNIVERSIDAD DE ANTIOQUIA FACULTAD DE QUÍMICA FARMACÉUTICA PROGRAMA DE ASIGNATURA PROGRAMA QUÍMICA FARMACÉUTICA

UNIVERSIDAD DE ANTIOQUIA FACULTAD DE QUÍMICA FARMACÉUTICA PROGRAMA DE ASIGNATURA PROGRAMA QUÍMICA FARMACÉUTICA UNIVERSIDAD DE ANTIOQUIA FACULTAD DE QUÍMICA FARMACÉUTICA PROGRAMA DE ASIGNATURA PROGRAMA QUÍMICA FARMACÉUTICA 200/ 2 / ASIGNATURA ANÁLISIS INSTRUMENTAL ÁREA O NÚCLEO TEMÁTICO BASICA CÓDIGO QSQ-387 SEMESTRE

Más detalles

CINÉTICA DE OXIDACIÓN DE VANADIO EN EL COMPLEJO [VO(acac) 2 ]

CINÉTICA DE OXIDACIÓN DE VANADIO EN EL COMPLEJO [VO(acac) 2 ] CINÉTICA DE XIDACIÓN DE VANADI EN EL CMPLEJ [V(acac) 2 ] Mariano Parga Aguilar, Noel García Reyes, Jorge Ramírez-rtiz Unidad Académica de Ciencias Químicas UAZ, Km 0.5 Carr. Cd. Cuauhtémoc, Gpe, Zac. 98600.

Más detalles

Respiración celular y Fotosíntesis

Respiración celular y Fotosíntesis Respiración celular y Fotosíntesis 3ª Parte: Fotosíntesis Tema 14 de Biología NS Diploma BI Curso 2012-2014 Anabolismo A partir de los precursores metabólicos obtenidos en las reacciones catabólicas, la

Más detalles

METODOLOGÍA DE DETECCIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS Y CIANOTOXINAS. Antonio Quesada Universidad Autónoma de Madrid

METODOLOGÍA DE DETECCIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS Y CIANOTOXINAS. Antonio Quesada Universidad Autónoma de Madrid METODOLOGÍA DE DETECCIÓN Y CUANTIFICACIÓN DE CIANOBACTERIAS Y CIANOTOXINAS Antonio Quesada Universidad Autónoma de Madrid Índice Identificación y cuantificación de cianobacterias potencialmente tóxicas

Más detalles

TÍTULO: Determinación de clorofilas en muestras vegetales mediante espectrofotometría ultravioleta/visible

TÍTULO: Determinación de clorofilas en muestras vegetales mediante espectrofotometría ultravioleta/visible Página 1 de 7 1.- INTRODUCCIÓN Bajo condiciones de estrés debido al crecimiento en presencia de metales pesados, muchas plantas intercambian el ion central de la clorofila, Mg 2+, por iones divalentes

Más detalles

Fotosíntesis. Laboratorio 9 Biol 3051

Fotosíntesis. Laboratorio 9 Biol 3051 Fotosíntesis Laboratorio 9 Biol 3051 Objetivos Describir cuál es el rol de la luz y los pigmentos en la fotosíntesis. Describir las reacciones principales que ocurren en la fotosíntesis. Identificar los

Más detalles

Anabolismo Fotosíntesis: Importancia como proceso biológico. Organismos que la realizan. Localización celular en procariotas y eucariotas.

Anabolismo Fotosíntesis: Importancia como proceso biológico. Organismos que la realizan. Localización celular en procariotas y eucariotas. Anabolismo Fotosíntesis: Importancia como proceso biológico. Organismos que la realizan. Localización celular en procariotas y eucariotas. Fotosíntesis oxigénica y anoxigénica: características y diferencias.

Más detalles

Procesamiento de Energía Metabolismo y ATP

Procesamiento de Energía Metabolismo y ATP Procesamiento de Energía Metabolismo y ATP Trabajo en clase 1. Qué es el metabolismo? 2. Qué papel juegan las enzimas en las vías metabólicas? 3. Cómo son las vías catabólicas relacionadas con la producción

Más detalles

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción

UNIDAD 4. Reparto entre dos disolventes. Separaciones por Extracción UNIDAD 4 Reparto entre dos disolventes. Separaciones por Extracción Introducción En los análisis químicos es necesario, después de la toma de muestra y su disolución en el disolvente adecuado, aislar el

Más detalles

Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar

Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar 5. METODOLOGIA Se trabajó con jugo de zanahorias obtenidas de tres fuentes diferentes elegidas al azar (supermercado, mercado de San Pedro Cholula y tienda de verduras). Revisando la bibliografía se encontraron

Más detalles

Biología I. Bioenergética. Examen resuelto del bloque 4: Luis Antonio Mendoza Sierra y Enrique Mendoza Sierra Editorial Trillas ISBN 978-607-17-0640-9

Biología I. Bioenergética. Examen resuelto del bloque 4: Luis Antonio Mendoza Sierra y Enrique Mendoza Sierra Editorial Trillas ISBN 978-607-17-0640-9 Biología I Luis Antonio Mendoza Sierra y Enrique Mendoza Sierra Editorial Trillas ISBN 978-607-17-0640-9 Examen resuelto del bloque 4: Bioenergética D.R. 2011, Luis Antonio Mendoza Sierra Este documento

Más detalles

Electrólisis. Electrólisis 12/02/2015

Electrólisis. Electrólisis 12/02/2015 Electrólisis Dr. Armando Ayala Corona Electrólisis La electrolisis es un proceso mediante el cual se logra la disociación de una sustancia llamada electrolito, en sus iones constituyentes (aniones y cationes),

Más detalles

PRUEBAS DE BIODEGRADABILIDAD E INDUCCIÓN DE LA BIODEGRADACIÓN DE DETERGENTES. Evangelina POLACO MENDOZA y Víctor Manuel LUNA PABELLO

PRUEBAS DE BIODEGRADABILIDAD E INDUCCIÓN DE LA BIODEGRADACIÓN DE DETERGENTES. Evangelina POLACO MENDOZA y Víctor Manuel LUNA PABELLO PRUEBAS DE BIODEGRADABILIDAD E INDUCCIÓN DE LA BIODEGRADACIÓN DE DETERGENTES Evangelina POLACO MENDOZA y Víctor Manuel LUNA PABELLO Universidad Nacional Autónoma de México, Facultad de Química, Departamento

Más detalles

CUERPO SUPERIOR FACULTATIVO OPCIÓN: QUÍMICA. I. TEORIA BASICA SOBRE ANALISIS QUiMICOS INORGANICOS

CUERPO SUPERIOR FACULTATIVO OPCIÓN: QUÍMICA. I. TEORIA BASICA SOBRE ANALISIS QUiMICOS INORGANICOS CUERPO SUPERIOR FACULTATIVO OPCIÓN: QUÍMICA I. TEORIA BASICA SOBRE ANALISIS QUiMICOS INORGANICOS TEMA 1. Volumetrías de neutralización. Aplicaciones. TEMA 2. Volumetrías de oxidación-reducción. Aplicaciones.

Más detalles

EVALUACIÓN DE LA TOXICIDAD DEL EDTA Y METAL EDTA EN MICROORGANISMOS DE UN SISTEMA DE LODOS ACTIVADOS QUE TRATA EFLUENTE DE LA INDUSTRIA CELULOSA

EVALUACIÓN DE LA TOXICIDAD DEL EDTA Y METAL EDTA EN MICROORGANISMOS DE UN SISTEMA DE LODOS ACTIVADOS QUE TRATA EFLUENTE DE LA INDUSTRIA CELULOSA EVALUACIÓN DE LA TOXICIDAD DEL EDTA Y METAL EDTA EN MICROORGANISMOS DE UN SISTEMA DE LODOS ACTIVADOS QUE TRATA EFLUENTE DE LA INDUSTRIA CELULOSA M. Cristina Diez Jerez. Químico Lab. Doctor en Ciencias

Más detalles

1. Desarrollar ejercicios aplicados a las temáticas desarrolladas en el curso estructura de la materia

1. Desarrollar ejercicios aplicados a las temáticas desarrolladas en el curso estructura de la materia Cronograma de Actividades GUÍA DE ACTIVIDADES Evaluación Nacional por Proyecto 401581 Estructura de la Materia 2015-II Fecha de Inicio y cierre: Ver agenda de actividades del curso Peso evaluativo: 125

Más detalles

CROMATOGRAFIA LIQUIDA DE ALTA RESOLUCION

CROMATOGRAFIA LIQUIDA DE ALTA RESOLUCION CROMATOGRAFIA LIQUIDA DE ALTA RESOLUCION Componentes de un Cromatógrafo Suministro de Solvente Procesador de Muestras Columna Detector Procesador de Datos Ubicación GASES I.C.-H.P.L.C. L.C.-G.P.C. 50 500

Más detalles

MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE

MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE CAPÍTULO 8 MEDICIÓN Y ANÁLISIS DE CONTAMINANTES DEL AIRE Fuente: National Geographic - Noviembre 2000 INTRODUCCIÓN La medición de los contaminantes sirve para varias funciones tales como: Provee un criterio

Más detalles

Conciencia Tecnológica ISSN: 1405-5597 contec@mail.ita.mx Instituto Tecnológico de Aguascalientes México

Conciencia Tecnológica ISSN: 1405-5597 contec@mail.ita.mx Instituto Tecnológico de Aguascalientes México Conciencia Tecnológica ISSN: 1405-5597 contec@mail.ita.mx Instituto Tecnológico de Aguascalientes México Jaime Leal, José E.; Medina Valtierra, J. "SIMULEX". Simulador en excel para cinética química homogénea

Más detalles

CONTROL DE PROCESO EN BIODIGESTORES

CONTROL DE PROCESO EN BIODIGESTORES !!!! Grupo AquaLimpia CONTROL DE PROCESO EN BIODIGESTORES Preparado por AquaLimpia Engineering e.k. Uelzen - Alemania Julio 2013 2 Derechos reservados Propiedad intelectual Aqualimpia Engineering e.k Prohibida

Más detalles

Capítulo 6. Fotosíntesis y el cloroplasto. BIOLOGÍA CELULAR Y MOLECULAR Capítulo 6. 1. Fotosíntesis Introducción y el al cloroplasto

Capítulo 6. Fotosíntesis y el cloroplasto. BIOLOGÍA CELULAR Y MOLECULAR Capítulo 6. 1. Fotosíntesis Introducción y el al cloroplasto Capítulo 6. 1. Fotosíntesis Introducción y el al cloroplasto estudio de la biología celular y molecular Capítulo 6 Fotosíntesis y el cloroplasto 6.1 Estructura y función del cloroplasto 6.2 Una revisión

Más detalles

3. Principios de medición de la calidad del aire

3. Principios de medición de la calidad del aire 3. Principios de medición de la calidad del aire 3.1. Medición. Medir es contar, comparar una unidad con otra, dar una valoración numérica, asignar un valor, asignar números a los objetos. Todo lo que

Más detalles

Práctica 6 : FOTOSÍNTESIS Y TRANSPIRACIÓN

Práctica 6 : FOTOSÍNTESIS Y TRANSPIRACIÓN Práctica 6 : FOTOSÍNTESIS Y TRANSPIRACIÓN I.- Objetivos Al final del laboratorio el estudiante debe ser capaz de: * Describir el rol de la luz y los pigmentos en la fotosíntesis. * Identificar la clorofila

Más detalles

FACULTAD DE QUIMICA UNAM

FACULTAD DE QUIMICA UNAM 1 FACULTAD DE QUIMICA UNAM QUÍMICA ANALÍTICA INSTRUMENTAL I Serie de problemas Potenciometría iónica selectiva Sensores y biosensores Dr. 2004 2 QUIMICA ANALITICA INSTRUMENTAL I Serie de problemas: Sensores

Más detalles

Andrea Pavlisko, Andrea Ortega & Zulema Coppes Petricorena Departamento de Biociencias Facultad de Química, UDELAR biotecmar@fq.edu.

Andrea Pavlisko, Andrea Ortega & Zulema Coppes Petricorena Departamento de Biociencias Facultad de Química, UDELAR biotecmar@fq.edu. AGUA EN LOS SISTEMAS BIOQUÍMICOS Y EN LOS ALIMENTOS: PRÁCTICAS SENCILLAS Andrea Pavlisko, Andrea Ortega & Zulema Coppes Petricorena Departamento de Biociencias Facultad de Química, UDELAR biotecmar@fq.edu.uy

Más detalles

ANABOLISMO. FOTOLITÓTROFOS o FOTOAUTÓTROFOS: vegetales, bacterias fotosintéticas del azufre, algunos protistas

ANABOLISMO. FOTOLITÓTROFOS o FOTOAUTÓTROFOS: vegetales, bacterias fotosintéticas del azufre, algunos protistas ANABOLISMO 1. FORMAS DE NUTRICIÓN Para entender mejor cómo se produce el anabolismo es necesario que recordemos antes las distintas formas de nutrición de los organismos en función de la materia que intercambian

Más detalles

UNIVERSIDAD TECNOLOGICA NACIONAL FACULTAD REGIONAL ROSARIO DEPARTAMENTO DE INGENIERIA QUIMICA CATEDRA DE QUIMICA GENERAL

UNIVERSIDAD TECNOLOGICA NACIONAL FACULTAD REGIONAL ROSARIO DEPARTAMENTO DE INGENIERIA QUIMICA CATEDRA DE QUIMICA GENERAL UNIVERSIDAD TECNOLOGICA NACIONAL FACULTAD REGIONAL ROSARIO DEPARTAMENTO DE INGENIERIA QUIMICA CATEDRA DE QUIMICA GENERAL ESTUDIO DE LA SOLUBILIDAD Y LOS FACTORES QUE LA AFECTAN OBJETIVOS 1. Interpretar

Más detalles

GUÍA DOCENTE. Fisiología Vegetal

GUÍA DOCENTE. Fisiología Vegetal 1. DESCRIPCIÓN DE LA ASIGNATURA Grado: Biotecnología Doble Grado: Asignatura: Fisiología Vegetal Módulo: Fundamentos de Biología, Microbiología y Genética (nº 2) Departamento: Fisiología, Anatomía y Biología

Más detalles

MEMBRANAS 2. http://www.changeipadwallpaper.com/wp-content/uploads/1024ipad/scenery/rafts%20landscape.jpg BALSAS Y TRANSPORTE

MEMBRANAS 2. http://www.changeipadwallpaper.com/wp-content/uploads/1024ipad/scenery/rafts%20landscape.jpg BALSAS Y TRANSPORTE MEMBRANAS 2 http://www.changeipadwallpaper.com/wp-content/uploads/1024ipad/scenery/rafts%20landscape.jpg BALSAS Y TRANSPORTE MICRODOMINIOS DE ESFINGOLÍPIDOS Y COLESTEROL MAS GRUESO Y MAS ORDENADO (MENOS

Más detalles

TEMA 11. EL ANABOLISMO.

TEMA 11. EL ANABOLISMO. TEMA 11. EL ANABOLISMO. 1. Rutas anabólicas comunes. 1 Existe un anabolismo exclusivo de seres autótrofos en el que se obtienen moléculas orgánicas sencillas como la glucosa a partir de materia inorgánica.

Más detalles

Obligatoria asignatura Programa elaborado por:

Obligatoria asignatura Programa elaborado por: PROGRAMA DE ESTUDIO Programa Educativo: Licenciatura en Biología, Ing. Ambiental y Gestión Ambiental Área de Formación : General BIOQUÍMICA Horas teóricas: 2 Horas prácticas: 4 Total de Horas: 6 Total

Más detalles

ELECTROOBTENCIÓN DE ZINC UTILIZANDO CELDA DE ELECTRODIALISIS REACTIVA

ELECTROOBTENCIÓN DE ZINC UTILIZANDO CELDA DE ELECTRODIALISIS REACTIVA UNIVERSIDAD DE SANTIAGO DE CHILE FACULTAD DE INGENIERIA DEPARTAMENTO DE INGENIERIA METALURGICA ELECTROOBTENCIÓN DE ZINC UTILIZANDO CELDA DE ELECTRODIALISIS REACTIVA Profesor Dr. GERARDO CIFUENTES MOLINA

Más detalles

OBTENCIÓN DE CARBONATO DE SODIO (P 5)

OBTENCIÓN DE CARBONATO DE SODIO (P 5) OBTENCIÓN DE CARBONATO DE SODIO (P 5) Objetivos - Estudio descriptivo del carbonato de sodio y de sus usos industriales - Realización de la síntesis de carbonato de sodio y su comparación con el método

Más detalles

MODELADO Y CONTROL MULTIVARIABLE DE TEMPERATURA Y HUMEDAD EN UN INVERNADERO

MODELADO Y CONTROL MULTIVARIABLE DE TEMPERATURA Y HUMEDAD EN UN INVERNADERO MODELADO Y CONTROL MULTIVARIABLE DE TEMPERATURA Y HUMEDAD EN UN INVERNADERO Autor: Cristina Sánchez Pérez Directores: José Luis Guzmán Sánchez y Jorge Antonio Sánchez Molina 19 de septiembre de 2014 2

Más detalles

METABOLISMO DE NITROGENO EN PLANTAS

METABOLISMO DE NITROGENO EN PLANTAS METABOLISMO DE NITROGENO EN PLANTAS Material elaborado por: P. Díaz, O. Borsani, S. Signorelli y J. Monza. Las transaminasas transfieren grupos aminos Las reacciones de transaminación catalizadas por transaminasas

Más detalles

DETERMINACIÓN DE OCRATOXINA A Método HPLC (columna inmunoafinidad y multifuncional) Detectar y cuantificar la presencia de ocratoxina A en alimentos.

DETERMINACIÓN DE OCRATOXINA A Método HPLC (columna inmunoafinidad y multifuncional) Detectar y cuantificar la presencia de ocratoxina A en alimentos. PRT- 711.04-185 Página 1 de 5 1. OBJETIVO Detectar y cuantificar la presencia de ocratoxina A en alimentos. 2. CAMPO DE APLICACIÓN Y ALCANCE El método es aplicable a cereales y sus derivados, pasas, vinos,

Más detalles

Manual Técnico de los Sensores

Manual Técnico de los Sensores Manual Técnico de los Sensores Manual Técnico de los Sensores Sensor de Temperatura 2 Descripción El sensor de temperatura permite el registro de temperaturas entre 20 C a 110 C. La punta de acero permite

Más detalles

EFECTO DE LA ADICIÓN DE SiO 2 A PELÍCULAS DE POLIPROPILENO Y POLIAMIDA SOBRE SUS PROPIEDADES DE BARRERA

EFECTO DE LA ADICIÓN DE SiO 2 A PELÍCULAS DE POLIPROPILENO Y POLIAMIDA SOBRE SUS PROPIEDADES DE BARRERA EFECTO DE LA ADICIÓN DE SiO 2 A PELÍCULAS DE POLIPROPILENO Y POLIAMIDA SOBRE SUS PROPIEDADES DE BARRERA V. N. Dougnac, B. C. Peoples, H. Palza y R. Quijada Departamento de Ingeniería Química y Biotecnología

Más detalles

TEMARIO PARA EL EXAMEN DE BIOQUÍMICA

TEMARIO PARA EL EXAMEN DE BIOQUÍMICA TEMARIO PARA EL EXAMEN DE BIOQUÍMICA PARTE I. ESTRUCTURA BIOLÓGICA Y QUÍMICA DE LAS PROTEÍNAS 1. CARACTERÍSTICAS QUÍMICAS DE LA MATERIA VIVA 1. La mayoría de los organismos están compuestos solamente de

Más detalles

5) EL METABOLISMO CELULAR: GENERALIDADES. ENZIMAS

5) EL METABOLISMO CELULAR: GENERALIDADES. ENZIMAS 5) EL METABOLISMO CELULAR: GENERALIDADES. ENZIMAS EL METABOLISMO: CONCEPTO La nutrición de las células supone una serie de complejos procesos químicos catalizados por enzimas que tienen como finalidad

Más detalles

ELECTROQUÍMICA. 1. Procesos electroquímicos (pila). 2. Potenciales normales de electrodo. 3. Ecuación de Nernst. 4. Electrolisis. 5. Leyes de Faraday.

ELECTROQUÍMICA. 1. Procesos electroquímicos (pila). 2. Potenciales normales de electrodo. 3. Ecuación de Nernst. 4. Electrolisis. 5. Leyes de Faraday. ELECTROQUÍMICA 1. Procesos electroquímicos (pila). 2. Potenciales normales de electrodo. 3. Ecuación de Nernst. 4. Electrolisis. 5. Leyes de Faraday. Química 2º bachillerato Electroquímica 1 0. CONOCIMIENTOS

Más detalles

CAPÍTULO 4 DESARROLLO EXPERIMENTAL

CAPÍTULO 4 DESARROLLO EXPERIMENTAL CAÍTUL 4 DEALL EXEIMETAL 4.1 Generalidades Los reactivos utilizados en las reacciones fueron de marca Aldrich. El desarrollo de las reacciones y los productos de reacción se siguió por medio de cromatografía

Más detalles

CARACTERIZACIÓN FITOQUÍMICA DEL EXTRACTO TOTAL DE LA VAINA DE FRIJOL (Phaseoli pericarpium) Y EVALUACIÓN DE SU ACTIVIDAD HIPOGLUCEMIANTE

CARACTERIZACIÓN FITOQUÍMICA DEL EXTRACTO TOTAL DE LA VAINA DE FRIJOL (Phaseoli pericarpium) Y EVALUACIÓN DE SU ACTIVIDAD HIPOGLUCEMIANTE CARACTERIZACIÓN FITOQUÍMICA DEL EXTRACTO TOTAL DE LA VAINA DE FRIJOL (Phaseoli pericarpium) Y EVALUACIÓN DE SU ACTIVIDAD HIPOGLUCEMIANTE Marilyn Paola Ruiz Mondragón, Marisol Viladomat Corona, Jose Luis

Más detalles

2.5.5.5. Características generales del anabolismo celular: divergencia metabólica y necesidades energéticas.

2.5.5.5. Características generales del anabolismo celular: divergencia metabólica y necesidades energéticas. 2.5.5.5. Características generales del anabolismo celular: divergencia metabólica y necesidades energéticas. 2.5.5.5.1. Concepto e importancia biológica de la fotosíntesis. 2.5.5.5.2. Etapas de la fotosíntesis

Más detalles

SÍNTESIS DEL RADIOTRAZADOR [18F]FES PARA USO PET, EN EL DIAGNÓSTICO Y TRATAMIENTO OPORTUNO DEL CANCER DE MAMA

SÍNTESIS DEL RADIOTRAZADOR [18F]FES PARA USO PET, EN EL DIAGNÓSTICO Y TRATAMIENTO OPORTUNO DEL CANCER DE MAMA SÍNTESIS DEL RADIOTRAZADOR [18F]FES PARA USO PET, EN EL DIAGNÓSTICO Y TRATAMIENTO OPORTUNO DEL CANCER DE MAMA Gutiérrez Mata Ana Gabriela, 1 Rodríguez Hidalgo María del Rosario, 1 Alcalá Martín del Campo

Más detalles

Int. Cl. 7 : G01N 33/04

Int. Cl. 7 : G01N 33/04 k 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 k Número de publicación: 2 144 36 21 k Número de solicitud: 009800009 1 k Int. Cl. 7 : G01N 33/04 A23C 11/10 k 12 SOLICITUD DE PATENTE A1 22 kfecha

Más detalles

Propiedades Físicas y Químicas de los Herbicidas. Lectura 2

Propiedades Físicas y Químicas de los Herbicidas. Lectura 2 Físicas y Químicas de los Herbicidas Lectura 2 Conceptos Básicos Química orgánica ciencia que estudia los compuestos a base de Carbono (número atómico 6 en la Tabla Periódica) Compuestos orgánicos pueden

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Lugar: Centro de Investigación en Ciencias del Mar y Limnología. Escuela de Biología. Universidad de Costa Rica.

Lugar: Centro de Investigación en Ciencias del Mar y Limnología. Escuela de Biología. Universidad de Costa Rica. 1 B0645 Curso Internacional de Posgrado: Mediciones de la fotosíntesis y de la fluorescencia de la clorofila y sus aplicaciones biotecnológicas en microalgas. Lugar: Centro de Investigación en Ciencias

Más detalles

UNIVERSIDAD AUTÓNOMA AGRARIA ANTONIO NARRO UNIDAD LAGUNA POSGRADO EN PRODUCCIÓN AGROPECUARIA. Programa Analítico BIOQUÍMICA CLAVE: PA-507

UNIVERSIDAD AUTÓNOMA AGRARIA ANTONIO NARRO UNIDAD LAGUNA POSGRADO EN PRODUCCIÓN AGROPECUARIA. Programa Analítico BIOQUÍMICA CLAVE: PA-507 UNIVERSIDAD AUTÓNOMA AGRARIA ANTONIO NARRO UNIDAD LAGUNA POSGRADO EN PRODUCCIÓN AGROPECUARIA Programa Analítico BIOQUÍMICA CLAVE: PA-507 Fecha de elaboración: Agosto/2010 1 PROGRAMA ANALÍTICO UNIVERSIDAD

Más detalles

La fosforilación oxidativa

La fosforilación oxidativa La fosforilación oxidativa arriba ) Bioenergética del transporte de electrones Transportadores de electrones en la mitocondria 4. Hierro. La reacción redox es la siguiente: Fe 2+ Fe 3+ + e - El átomo

Más detalles

Síntesis, caracterización y evaluación fotocatalítica de materiales TiO 2 dopados con nitrógeno bajo irradiación solar simulada

Síntesis, caracterización y evaluación fotocatalítica de materiales TiO 2 dopados con nitrógeno bajo irradiación solar simulada Síntesis, caracterización y evaluación fotocatalítica de materiales TiO 2 dopados con nitrógeno bajo irradiación solar simulada S. Murcia-López 1, M.C. Hidalgo 2, J.A. Navio 2., G. Restrepo 1, J.M. Marín

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Monitores de Calidad del Agua

Monitores de Calidad del Agua Monitores de Calidad del Agua Cuidando del aire que respiramos y el agua que bebemos Cloro Libre Q45H62 El elemento básico de detección utilizado en el monitor de cloro libre es un sensor de membrana semipermeable

Más detalles