Cultivo in vitro: propagación de plantas

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Cultivo in vitro: propagación de plantas"

Transcripción

1 Cultivo in vitro: propagación de plantas Hojas de enraizando crisantemo Plántula de crisantemo en envase Magenta Un cultivo in vitro es aquel realizado sobre un medio nutritivo en condiciones estériles. Puede ser de: plantas, semillas, embriones, órganos, explantos, células y protoplástos.

2 Características del cultivo in vitro: Es empleado a microescala Hay optimización de las condiciones ambientales No se produce el patrón normal de desarrollo de una planta Hace factible la manipulación de las célula individuales o tejidos. Fundamental para transformación genética.

3 Pioneros del Cultivo in vitro

4 Tipos de Cultivo in vitro. Propagación y regeneración de plantas Plantas regeneradas ORGANOGÉNESIS EMBRIOGÉNESIS Callos Suspensión de células Protoplastos Explantos: trozos hojas, tallos, meristemos, etc. Planta donante Microesporas/gametos

5 Callos Suspensión de células Protoplastos Explantos: trozos hojas, tallos, meristemos, etc. Microesporas/gametos

6 Condiciones de los cultivos in vitro ESTERILIDAD!!

7 Esterilización del material vegetal Se emplean medios nutritivos muy ricos, por lo que la esterilización de todo el material es esencial

8 TOTIPOTENCIA Capacidad de las células vegetales de regenerar un organismo completo. REPROGRAMACIÓN DESARROLLO Se altera el patrón de células que estaban completamente diferenciadas. COMPETENTES No todas las células que responden al cambio de programa de desarrollo.

9 Diferenciación Cambios de forma y función de orgánulos, células y tejidos DESARROLLO Morfogénesis Organización de la estructura de tejidos y órganos. Arquitectura y simetría de la planta Crecimiento Incremento biomasa por división y elongación celular

10 Microescala

11 Auxinas Se transporta polarmente desde el ápice de parte aérea o raíz. El transporte de larga distancia se produce por el floema. Junto con las citoquininas son esenciales para la viabilidad de las plantas: no hay mutantes deficientes. La estructura química de las auxinas es diversa. Pueden acumularse en formas inactivas conjugadas a oligosacáridos y aminoácidos.

12 Auxinas naturales encontradas en plantas Auxinas sintetizadas químicamente

13 Proliferación de raíces secundarias Control Alta [auxina] [Auxina] > 10-8 M causa el inicio de divisiones celulares en el periciclo. Regeneración de plantas favoreciendo el enraizamiento

14 Interacción con citoquinina y ácido abscísico en la dominancia apical de tallo Escisión del ápice causa proliferación de tallos axilares La auxina está implicada en la redistribución de las citoquininas sintetizadas en la raíz hacia el ápice. Escisión del ápice: mayor nivel de citoquinina en las yemas laterales. El ácido abscísico se acumula en las yemas laterales latentes. La escisión del ápice disminuye su contenido.

15 Citoquininas: descubiertas en cultivos in vitro Las se descubrieron al buscar factores que indujeran divisiones celulares y promoviesen el crecimiento de material vegetal. Se probaron multitud de substancias: extractos de levadura, jugo de tomate, etc. La leche de coco (rica en zeatina) fue muy efectiva, más en conjunción con auxina Skoog descubrió que DNA desnaturalizado de esperma de arenque era muy efectivo en promover división celular La kinetina fue la primera citoquinina identificada producida de síntesis por la degradación térmica de DNA

16 Diferentes tipos de citoquininas Sintética Natural Sintética Bencilamino purina (BAP)

17 Producción de callos por acumulación de citoquininas: Agrobacterium CALLO tejido desdiferenciado continua división. en AGALLA tumor producido por la infección de Agrobacterium tumefaciens por acumulación de citoquininas y auxinas

18 En la infección, se produce la inserción de genes bacterianos en el genoma de la célula vegetal, portados en el T-DNA. Éstos codifican enzimas para la síntesis de dichas fitohormonas.

19 Proliferación de parte aérea Control + Citoquinina

20 Distintas moléculas tienen diferente actividad Auxinas y citoquininas tienen diferente nivel de actividad biológica según la molécula empleada: establecer la dosis.

21 Regeneración por organogénesis Concentración de IAA (mg/l) 0 0,005 0,03 0,18 1,18 3,0 Concentración de kinetina (mg/l) 1,0 0,2 0 HOJA CALLO RAÍZ

22 Regeneración de plantas por organogénesis El callo se somete a una relación auxina/citoquinina baja, para inducir la formación de parte aérea. En condiciones de esterilidad, se secciona la parte aérea formada. Se transplanta a un medio de cultivo con una relación auxina/citoquinina alta, para inducir la formación de raíces. Una vez generadas raíces, se transfieren a un sustrato con alta capacidad de retención de agua (p. ej. turba). Las plántulas se cultivan en condiciones de humedad óptima para evitar su desecación, hasta que la raíz se afianza.

23 Protoplastos Obtención enzimática

24 Diversos materiales se pueden incorporar a un protoplasto: orgánulos, DNA plasmídico, bacterias, etc.

25 Variación somaclonal

26 Perjudicial: indeseable en la generación de plantas transgénicas Beneficiosa

27 Transformación de plantas: Agrobacterium Inserción del T-DNA con oncogenes y genes de metabolismo de opinas

28 Pioneros del desarrollo de vectores de transformación basados en Agrobacterium Jeff Schell Mark Van Montagu

29 Plásmido Ti de Agrobacterium tumefaciens

30 Estructura general del T-DNA LB RB

31 Genes vir NO se transfieren

32 SELECCIÓN DE PLANTAS TRANSGÉNICAS

33 Selección de trasngénicos con kanamicina

34 Sólo unas pocas células son transgénicas: varios pasos de selección

35 Vectores binarios desarmados derivados del plásmido Ti de A. tumefaciens

36 LB Nos T MnSOD 35S 35S nptii 35S T RB Cebadores específicos utilizados Fragmento Rubisco (349 pb) nptii (317 pb) 35S (234 pb) Nos term (127 pb) Cebador positivo tccctgtttcaaggaagc Rbcs01F gaagagcatcaggggctc nptii01f tgccatcattgcgataaagg 35S01F gaatcctgttgccggtcttgcg nos01f Cebador negativo gtcgcataaaattgaaggag Rbcs02R gaagaactcgtcaagaaggc nptii02r cctctccaaatgaaatgaac 35S02R gcgggactctaatcataaaaac nos02r

37

38

Cultivo in vitro. Definición

Cultivo in vitro. Definición Definición Cultivo sobre un medio nutritivo, en condiciones estériles, de plantas, semillas, embriones, órganos, tejidos, células y protoplastos, debido a la propiedad de totipotencia de las células vegetales

Más detalles

Hormonas vegetales: reguladores del crecimiento y desarrollo. Hormonas vegetales:

Hormonas vegetales: reguladores del crecimiento y desarrollo. Hormonas vegetales: Laboratorio de Biología Molecular Vegetal - Facultad de Ciencias. http://bmv.fcien.edu.uy Hormonas vegetales: Hormonas vegetales: reguladores del crecimiento y desarrollo CRECIMIENTO: : aumento de tamaño

Más detalles

MICROPROPAGACIÓN. 1. Introducción. 2. Etapas de la micropropagación

MICROPROPAGACIÓN. 1. Introducción. 2. Etapas de la micropropagación 1. Introducción. MICROPROPAGACIÓN La microspropagación consiste en la propagación de un genotipo a gran escala a través del empleo de técnicas de cultivo in vitro. El cultivo es una herramienta para el

Más detalles

Los cultivos celulares y sus aplicaciones II (cultivos de células vegetales)

Los cultivos celulares y sus aplicaciones II (cultivos de células vegetales) Los cultivos celulares y sus aplicaciones II (cultivos de células vegetales) Lic. María Eugenia Segretín INGEBI-CONICET - Dpto. FBMyC, FCEyN-UBA El término genérico cultivo de tejidos vegetales involucra

Más detalles

Morfogénesis: la ruta organogénica versus la ruta embriogénica

Morfogénesis: la ruta organogénica versus la ruta embriogénica Morfogénesis: la ruta organogénica versus la ruta embriogénica Apellidos, nombre Gisbert Doménech, Carmina (cgisbert@btc.upv.es) Departamento Centro Departamento de Biotecnología ETSIAMN-Universidad Politécnica

Más detalles

Biotecnología de Plantas

Biotecnología de Plantas Biotecnología de Plantas Desafíos para la expresión de genes introducidos 1. Importancia del promotor y elementos enhancers 2. Hay dos factores principales que determina si los genes se expresan en el

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Fisiología a Vegetal. Citoquininas

Fisiología a Vegetal. Citoquininas Fisiología a Vegetal itoquininas Dra. Karen Peña-Rojas itoquininas (Ks) - Haberlant (191): Descubrió sustancia que promovía la división celular. - Miller y Lethan (1964): Descubren la Zeatina en granos

Más detalles

Dinero que mueve la Ingeniería Genética

Dinero que mueve la Ingeniería Genética Biotecnología de Plantas Desafíos para la expresión de genes introducidos 1. Importancia del promotor y elementos enhancers 2. Hay dos factores principales que determina si los genes se expresan en el

Más detalles

Cultivos in vitro de tejidos vegetales

Cultivos in vitro de tejidos vegetales Desde hace 50 años se ha demostrado el avance en el desarrollo de la biotecnología vegetal, principalmente en la propagación de especies vegetales. Para este propósito existe toda una tecnología biológica

Más detalles

Autor: Andrés M. Gatica Arias, Dr.sc.agr

Autor: Andrés M. Gatica Arias, Dr.sc.agr Autor: Andrés M. Gatica Arias, Dr.sc.agr Introducción Es de rigurosa justicia emancipar la enseñanza de todo extraño poder, y convertirla en una función social, sin otra ley que la libre indagación y

Más detalles

Ingeniería Genética II

Ingeniería Genética II Ingeniería Genética II Expresión de proteínas recombinantes Vectores de expresión Características adicionales: - Promotor regulable - Terminador de la transcripción - Sitio de reconocimiento por el ribosoma

Más detalles

CULTIVO IN VITRO DE TEJIDOS VEGETALES

CULTIVO IN VITRO DE TEJIDOS VEGETALES CULTIVO IN VITRO DE TEJIDOS VEGETALES María Elena Daorden E.E.A. INTA SanPedro CULTIVO IN VITRO DE TEJIDOS VEGETALES Conjunto de técnicas que permiten el mantenimiento y/o crecimiento de células o tejidos

Más detalles

MACROPROPAGACION INTRODUCCION

MACROPROPAGACION INTRODUCCION MACROPROPAGACION INTRODUCCION Con el fin de introducirnos en el estudio de hormonas y reguladores, primero es necesario definirlos: "Una hormona vegetal es un compuesto de naturaleza orgánica que sintetizado

Más detalles

Proceso para transformación de células de plantas con Agrobacterium tumefaciens

Proceso para transformación de células de plantas con Agrobacterium tumefaciens Proceso para transformación de células de plantas con Agrobacterium tumefaciens Transformar Agrobacterium con plásmidos (vectores) conteniendo los genes vir y el T-DNA con los genes deseados. Cocultivar

Más detalles

EDICIÓN Nº 35. Cultivo in vitro de plantas y su relación con la Biotecnología

EDICIÓN Nº 35. Cultivo in vitro de plantas y su relación con la Biotecnología Cultivo in vitro de plantas y su relación con la Biotecnología El cultivo in vitro (término que literalmente significa en vidrio), incluye muchas técnicas destinadas a introducir, multiplicar y regenerar,

Más detalles

Aportes de la propagación Invitro a la agricultura campesina

Aportes de la propagación Invitro a la agricultura campesina Aportes de la propagación Invitro a la agricultura campesina Ana María López G. Grupo de investigación en biodiversidad y biotecnología ubioteve@utp.edu.co Qué es una semilla? Estaca Semilla (Asexual)

Más detalles

Transgénicos naturales y transgénicos de laboratorio

Transgénicos naturales y transgénicos de laboratorio Transgénicos naturales y transgénicos de laboratorio Inés Ponce de León Dept. Biología Molecular Instituto de Investigaciones Biológicas Clemente Estable Organismos genéticamente modificados (OGMs) Un

Más detalles

Cultivo in vitro Plantas. Servicio de cultivo de plantas

Cultivo in vitro Plantas. Servicio de cultivo de plantas 1 Servicio de cultivo de plantas 1 2 I. Información general del Servicio de Cultivo de Plantas. Aplicaciones Las técnicas de cultivo in vitro de tejidos vegetales proporcionan los medios para producir

Más detalles

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria

GLOSARIO. Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria GLOSARIO Ácido Desoxirribonucleico (ADN).- Molécula almacenadora de información hereditaria que se encuentra en el núcleo de la célula. Las bases del ADN son 4: Adenina, Timina, Citosina y Guanina representadas

Más detalles

Tema 8 LA BIOTECNOLOGÍA EN PLANTAS GM. Prof. Gloria Morcillo Ortega

Tema 8 LA BIOTECNOLOGÍA EN PLANTAS GM. Prof. Gloria Morcillo Ortega 8 LA BIOTECNOLOGÍA EN LA AGRICULTURA: PLANTAS GM Prof. Gloria Morcillo Ortega 1 Introducción 8.1 Importancia de las plantas para la alimentación 8.2 Unas bases de Botánica 8.3 La modificación genética

Más detalles

28/10/2013. Marco Conceptual GRUPOS DE HORMONAS HORMONAS VEGETALES. Eventos Fisiológicos

28/10/2013. Marco Conceptual GRUPOS DE HORMONAS HORMONAS VEGETALES. Eventos Fisiológicos Marco Conceptual Eventos Fisiológicos Muerte Abscisión Senescencia Maduración Crecimiento de frutos Amarre de frutos Apertura de flores Formación de flores Crecimiento vegetativo y radicular UNA La Molina,

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Universidad Católica Ávila

Universidad Católica Ávila Universidad Católica Ávila de Curso Académico 2014/2015 Planes de Estudio Máster Universitario en Biotecnología Agroalimentaria por la Universidad Católica Santa Teresa de Jesús de Ávila Facultad de Ciencias

Más detalles

23. CRECIMIENTO Y DESARROLLO VEGETAL.

23. CRECIMIENTO Y DESARROLLO VEGETAL. 23. CRECIMIENTO Y DESARROLLO VEGETAL. Introducción. Cinética. Localización de las zonas de crecimiento. Concepto de fitohormona. Interacciones entre fitohormonas. Conceptos de mecanismo y modo de acción.

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL

LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

Propagación in vitro de Carica papaya var. PTM-331 a partir de meristemos apicales

Propagación in vitro de Carica papaya var. PTM-331 a partir de meristemos apicales Rev. peru. biol. 18(3): 343-347 (Diciembre 2011) Facultad de Ciencias Biológicas UNMSM Propagación in vitro de Carica ISSN papaya 1561-0837 variedad PTM-331 ISSN 1727-9933 (on line) Propagación in vitro

Más detalles

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014

QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

El cultivo in vitro en la reproducción vegetativa en plantas de vivero

El cultivo in vitro en la reproducción vegetativa en plantas de vivero Montserrat Estopà Bagot montse@cultiusroig.com Doctora en Biología Jefe del Departamento I+D Cultius Roig revista 50 EXTRA 2005 Situación actual El cultivo in vitro en la reproducción vegetativa en plantas

Más detalles

estambres POLINIZACIÓN FERTILIZACIÓN megasporas (óvulos) saco embrionario Generalmente están fusionados y forman el gineceo

estambres POLINIZACIÓN FERTILIZACIÓN megasporas (óvulos) saco embrionario Generalmente están fusionados y forman el gineceo 1 estambres microsporas polen esperma POLINIZACIÓN FERTILIZACIÓN Generalmente están fusionados y forman el gineceo megasporas (óvulos) saco embrionario 2 El desarrollo embrionario ocurre como consecuencia

Más detalles

EL ADN y la INGENIERÍA GENÉTICA

EL ADN y la INGENIERÍA GENÉTICA IES LAS VIÑAS MANILVA. MÁLAGA. CMC. Susana Serradilla EL ADN y la INGENIERÍA GENÉTICA EL GENOMA HUMANO GENOMA: Conjunto de genes de un ser vivo. GENOMA HUMANO: Conjunto de genes de la especie humana PROYECTO

Más detalles

Reguladores de crecimiento empleados en la fruticultura

Reguladores de crecimiento empleados en la fruticultura Enrique Sánchez- Técnico INTA E-mail: esanchez@correo.inta.gov.ar Reguladores de crecimiento empleados en la fruticultura Los reguladores de crecimiento son fitohormonas que tienen distintos usos en fruticultura.

Más detalles

Propagación de plantas por cultivo in vitro: una biotecnología que nos acompaña hace mucho tiempo

Propagación de plantas por cultivo in vitro: una biotecnología que nos acompaña hace mucho tiempo Propagación de plantas por cultivo in vitro: una biotecnología que nos acompaña hace mucho tiempo Ing.Agr. Alicia Castillo, MSc Investigadora, Unidad de Biotecnología, INIA Las Brujas La expresión cultivo

Más detalles

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA ESCUELA DE CIENCIAS AGRICOLAS, PECUARIAS Y DEL MEDIO AMBIENTE 30161 PROPAGACIÓN Y MICROPROPAGACIÓN DE PLANTAS UNIDAD III Maria Isabel Aristizabal Guerra (Directora

Más detalles

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico

Radiación y Cáncer. Karel van Wely 23-10 - 2012. -) El cáncer, consecuencia de un problema biológico Radiación y Cáncer Karel van Wely 23-10 - 2012 -) Una definición del cáncer -) El cáncer, consecuencia de un problema biológico -) el ambiente, donde aparece el cáncer? -) estadios diferentes de la carcinogénesis

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

17.- INGENIERÍA GENÉTICA

17.- INGENIERÍA GENÉTICA 17.- INGENIERÍA GENÉTICA SECUENCIACIÓN DEL ADN Se puede hacer de todo el ADN o de genes sueltos. Sabiendo la secuencia de un gen se puede comparar con el gen de un individuo y saber si está mutado. 1.

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Fundamentos para la evaluación visual de la fisiología arbórea. La abscisión otoñal

Fundamentos para la evaluación visual de la fisiología arbórea. La abscisión otoñal Fundamentos para la evaluación visual de la fisiología arbórea La abscisión otoñal 1. Introducción La fotosíntesis y la eficiencia fotosintética El control arbóreo la estructura arbórea la altura máxima

Más detalles

Seminarios en Biotecnología y Bioseguridad de OGMs

Seminarios en Biotecnología y Bioseguridad de OGMs Seminarios en Biotecnología y Bioseguridad de OGMs Agro-infiltración (expresión transitoria por transformación de Agrobacterium) Dra. Rocío Díaz de la Garza ITESM 14 de noviembre de 2014 10:00 a 12:00

Más detalles

XII SIMPOSIUM INTERNACIONAL DE LA UVA DE MESA - SIUVA

XII SIMPOSIUM INTERNACIONAL DE LA UVA DE MESA - SIUVA Rol de los Aminoácidos en el Cultivo de Vid XII SIMPOSIUM INTERNACIONAL DE LA UVA DE MESA - SIUVA 2011 La Molina, 06 y 07 de Julio, 2011 Ing. M.Sc. Federico Ramírez D. Gerente Técnico Aminoácidos Las plantas

Más detalles

Técnica Eficiente para una Multiplicación con Calidad Productiva y Sanitaria

Técnica Eficiente para una Multiplicación con Calidad Productiva y Sanitaria Micropropagación de Alcachofas: Técnica Eficiente para una Multiplicación con Calidad Productiva y Sanitaria Si bien una planta de alcachofa proveniente de un proceso in vitro, tiene un costo mucho más

Más detalles

Fisiología a Vegetal. Hormonas Vegetales ó Fitohormonas, y Reguladores de Crecimiento

Fisiología a Vegetal. Hormonas Vegetales ó Fitohormonas, y Reguladores de Crecimiento Fisiología a Vegetal Hormonas Vegetales ó Fitohormonas, y Reguladores de Crecimiento Dra. Karen Peña-Rojas El ambiente genera efectos en las plantas y por lo tanto, las plantas deben ser capaces de percibir

Más detalles

TEMA 26. MUERTE CELULAR PROGRAMADA. SENESCENCIA Y ABSCISIÓN

TEMA 26. MUERTE CELULAR PROGRAMADA. SENESCENCIA Y ABSCISIÓN TEMA 26. MUERTE CELULAR PROGRAMADA. SENESCENCIA Y ABSCISIÓN No hay evidencias claras de apoptosis, un proceso de muerte celular muy ordenado y con unas características bien definidas que elimina de forma

Más detalles

APLICACIÓN DE LA METODOLOGÍA MOLECULAR I

APLICACIÓN DE LA METODOLOGÍA MOLECULAR I APLICACIÓN DE LA METODOLOGÍA MOLECULAR I DIGANÓSTICO DE ENFERMEDADES INFECCIOSAS Amplificación de la Señal en DNA Ramificado Amplification) (Branched DNA Singal Es un sistema similar al ELISA, en el cual

Más detalles

Capítulo 7.3. Resumen para no expertos

Capítulo 7.3. Resumen para no expertos Resumen para no expertos Comunicación bacteriana y síntesis de antibióticos La comunicación es un factor esencial para todos los seres vivos. Las bacterias, en concreto, se comunican utilizando pequeños

Más detalles

ALIMENTOS DE IMPORTANCIA COMERCIAL OBTENIDOS DE PROCESOS BIOTECNOLÓGICOS Lectura Lección Evaluativa Unidad 3

ALIMENTOS DE IMPORTANCIA COMERCIAL OBTENIDOS DE PROCESOS BIOTECNOLÓGICOS Lectura Lección Evaluativa Unidad 3 ALIMENTOS DE IMPORTANCIA COMERCIAL OBTENIDOS DE PROCESOS BIOTECNOLÓGICOS Lectura Lección Evaluativa Unidad 3 En un mundo donde los recursos son día a día más escasos es necesario encontrar rápidamente

Más detalles

Tema 3. El medio de cultivo 2

Tema 3. El medio de cultivo 2 Tema 3 El medio de cultivo 2 Suplementos orgánicos Vitaminas Las plantas no producen vitaminas Tiamina (Vit. B1) Metabolismo carbohidratos y síntesis de aa Myo-inositol Formación pectinas y hemicelulosas

Más detalles

Tema 7. El cultivo in vitro y la Mejora de plantas

Tema 7. El cultivo in vitro y la Mejora de plantas Tema 7 El cultivo in vitro y la Mejora de plantas CULTIVO IN VITRO INVESTIGACIÓN BÁSICA SOBRE FISIOLOGÍA VEGETAL INVESTIGACIÓN APLICADA ORIENTADA A PRODUCCIÓN Y MEJORA VEGETAL -Cultivo de ápices caulinares

Más detalles

Una Alternativa Biotecnológica para la Industria del Tequila Cultivo de Callos de Agave tequilana Weber Var. Azul

Una Alternativa Biotecnológica para la Industria del Tequila Cultivo de Callos de Agave tequilana Weber Var. Azul Una Alternativa Biotecnológica para la Industria del Tequila Cultivo de Callos de Agave tequilana Weber Var. Azul Raúl Erick Juárez Hernández 1, Karla Karina Valenzuela Sánchez 2, Sosa Morales María Elena

Más detalles

VII. TÉCNICAS DE MULTIPLICACIÓN RÁPIDA EN PAPAS

VII. TÉCNICAS DE MULTIPLICACIÓN RÁPIDA EN PAPAS VII. TÉCNICAS DE MULTIPLICACIÓN RÁPIDA EN PAPAS Lorena Sotomayor T; Patricio Méndez L. Las plantas de papa tienen la característica de generar tubérculos desde diferentes estructuras tales como: estolones,

Más detalles

III.-Capítulo 3. Transformación genética

III.-Capítulo 3. Transformación genética III.-Capítulo 3 Transformación genética Díaz, Marina L.; Zappacosta, Diego C.; Franzone, Pascual M.; Ríos, Raúl D. 1 Introducción El mejoramiento genético vegetal se originó hace aproximadamente 10.000

Más detalles

PROTOCOLO- FASE I FASE 1.- MICROPROPAGACIÓN DEL MATERIAL VEGETAL. Chopo (Populus sp. 3 meses)

PROTOCOLO- FASE I FASE 1.- MICROPROPAGACIÓN DEL MATERIAL VEGETAL. Chopo (Populus sp. 3 meses) PROTOCOLO- FASE I PROTOCOLO- FASE I FASE 1.- MICROPROPAGACIÓN DEL MATERIAL VEGETAL 1º.- Preparación del medio de cultivo o crecimiento: Ve a la poyata y toma un vaso de precipitados llénalo de agua destilada

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

LA NUEVA BIOTECNOLOGÍA

LA NUEVA BIOTECNOLOGÍA LA NUEVA BIOTECNOLOGÍA Ingeniería genética: técnicas que permiten manipular la información genética de un ser vivo. TECNOLOGÍA TRADICIONAL DEL ADN RECOMBINANTE CLONACIÓN DE GENES: Obtención de muchas copias

Más detalles

DESARROLLO DE CONTENIDOS LA NUTRICIÓN VEGETAL

DESARROLLO DE CONTENIDOS LA NUTRICIÓN VEGETAL CONTENIDOS - Nutrición. Proceso de intercambio de materia y energía. - Procesos implicados: - La incorporación de nutrientes en los vegetales. - El transporte de la savia bruta. - El intercambio de gases

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles

Sobre los ganadores del Premio Mundial de Alimentación 2013 Wolrd Food Prize 2013

Sobre los ganadores del Premio Mundial de Alimentación 2013 Wolrd Food Prize 2013 Sobre los ganadores del Premio Mundial de Alimentación 2013 Wolrd Food Prize 2013 Tres distinguidos científicos -Marc Van Montagu de Bélgica y Mary-Dell Chilton y Robert T. Fraley de Estados Unidos - compartirán

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Ácidos nucleicos: ADN y ARN

Ácidos nucleicos: ADN y ARN Unidad I Genética Ácidos nucleicos: ADN y ARN Definición Los ácidos nucleicos son compuestos orgánicos constituidos por unidades llamadas nucleótidos. Su función principal es transmitir las características

Más detalles

Curso 2012-2013. BTG_114: Saber analizar, sintetizar y utilizar el razonamiento crítico en ciencia.

Curso 2012-2013. BTG_114: Saber analizar, sintetizar y utilizar el razonamiento crítico en ciencia. 1. DESCRIPCIÓN DE LA ASIGNATURA Grado: Biotecnología Doble Grado: Asignatura: Biotecnología Vegetal Módulo: Bioingeniería y Procesos Biotecnológicos. Sistemas Biológicos Departamento: Fisiología, Anatomía

Más detalles

Información técnica y fisiológica del cultivo de piña.

Información técnica y fisiológica del cultivo de piña. Ave. Dr. Gustavo Baz 176-3 San Jerónimo Tepetlacalco Tlalnepantla, Estado de México México CP 54090 +52 (55) 53-61-82-62. Laboratorios Agroenzymas S.A. de C.V. Información técnica y fisiológica del cultivo

Más detalles

IES Pando Departamento de Biología y Geología 1

IES Pando Departamento de Biología y Geología 1 IES Pando Departamento de Biología y Geología 1 2 Células en diversos estadios del ciclo celular en la raíz de ajo. 3 Diversos aspectos del núcleo durante el ciclo celular Ciclo celular 4 Repartición del

Más detalles

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar.

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA. Lee atentamente el texto y las preguntas antes de contestar. PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR OPCIÓN C BIOLOGÍA DATOS DEL ASPIRANTE Apellidos: CALIFICACIÓN PRUEBA Nombre: D.N.I. o Pasaporte: Fecha de nacimiento: / / Instrucciones: Lee atentamente

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

DATOS DE LA ASIGNATURA

DATOS DE LA ASIGNATURA DATOS DE LA ASIGNATURA Denominación: Ingeniería Genética Aplicada Código: 58127 Clase: Optativa Curso: 2º Carácter: Cuatrimestral Cuatrimestre: 2º Créditos LRU: 6 Teóricos: 4.5 Prácticos: 1.5 Créditos

Más detalles

Trasformación de células vegetales Obtención de plantas transgénicas

Trasformación de células vegetales Obtención de plantas transgénicas Trasformación de células vegetales Obtención de plantas transgénicas Diana Carranza Domínguez. ÍNDICE: 1.- INTRODUCCIÓN 2.-Agrobacterium COMO MÉTODO DE TRANSFORMACIÓN VEGETAL: 2.1.- Agrobacterium tumefaciens

Más detalles

Biotecnología microbiana para cultivos con residuo cero

Biotecnología microbiana para cultivos con residuo cero Biotecnología microbiana para cultivos con residuo cero Manuel Megías Guijo Universidad de Sevilla- ResBioAgro, S.L. Tecnología de invernaderos-cta 13 de mayo de 2014 Concepto de Residuo cero Es un concepto

Más detalles

CONTROL DE LA ACTIVIDAD CELULAR

CONTROL DE LA ACTIVIDAD CELULAR CONTROL DE LA ACTIVIDAD CELULAR Sumario Las Moléculas de los Seres Vivos Control de la actividad celular 1. Las reacciones celulares básicas 2. El control de las reacciones celulares 3. Los modelos de

Más detalles

TEMARIO DE TEORÍA CUATRIMESTRE: 1º CARÁCTER: OPTATIVA CRÉD. TEÓ.: 3,00 CRÉD. PRÁC.: 3,00

TEMARIO DE TEORÍA CUATRIMESTRE: 1º CARÁCTER: OPTATIVA CRÉD. TEÓ.: 3,00 CRÉD. PRÁC.: 3,00 CURSO: 2003/04 CENTRO: FAC. CC. EXPERIMENTALES ESTUDIOS: LICENCIADO EN QUÍMICAS-2000 ASIGNATURA: INGENIERIA DE ACIDOS NUCLEICOS CÓDIGO: 5008307 CICLO: 2º CURSO: OPT CUATRIMESTRE: 1º CARÁCTER: OPTATIVA

Más detalles

Proyecto GENOMA HUMANO

Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles

Trabajo Práctico Nº 13 Hormonas Vegetales (Reguladores de Crecimiento)

Trabajo Práctico Nº 13 Hormonas Vegetales (Reguladores de Crecimiento) Trabajo Práctico Nº 13 Hormonas Vegetales (Reguladores de Crecimiento) Introducción: El desarrollo normal de una planta depende de la interacción de factores externos: luz, nutrientes, agua y temperatura,

Más detalles

GENÉTICA BACTERIANA. Elementos genéticos. GENOMA BACTERIANO es el conjunto de elementos genéticos autorreplicativos que tiene una bacteria

GENÉTICA BACTERIANA. Elementos genéticos. GENOMA BACTERIANO es el conjunto de elementos genéticos autorreplicativos que tiene una bacteria GENÉTICA BACTERIANA I. Elementos genéticos I. Elementos genéticos II. Variabilidad genética III. Genómica y concepto de especie GENOMA BACTERIANO es el conjunto de elementos genéticos autorreplicativos

Más detalles

MULTIPLICACIÓN MASIVA DE SEMILLA SANA DE VARIEDADES DE CAÑA DE AZÚCAR MEDIANTE CULTIVO DE TEJIDOS VEGETALES

MULTIPLICACIÓN MASIVA DE SEMILLA SANA DE VARIEDADES DE CAÑA DE AZÚCAR MEDIANTE CULTIVO DE TEJIDOS VEGETALES Contrato IG-CT-020 CENTRO DE INVESTIGACIÓN DE LA CAÑA DE AZÚCAR DEL ECUADOR CINCAE Una división de la FUNDACIÓN PARA LA INVESTIGACIÓN AZUCARERA DEL ECUADOR FIADE Publicación Técnica No. 1 MULTIPLICACIÓN

Más detalles

La ingeniería genética

La ingeniería genética Objetivos Antes de empezar En esta quincena aprenderás a: Biotecnología moderna. tradicional Ingeniería genética y manipulación del genoma. Alimentos transgénicos. La clonación. El genoma humano Problemas

Más detalles

Crecimiento y Cultivo Celular CULTIVO IN-VITRO DE RAÍCES TRANSFORMADAS

Crecimiento y Cultivo Celular CULTIVO IN-VITRO DE RAÍCES TRANSFORMADAS CULTIVO IN-VITRO DE RAÍCES TRANSFORMADAS Las raíces de plantas superiores tienen la capacidad de sintetizar gran diversidad de metabolitos secundarios y adaptar su metabolismo en respuesta al estrés causado

Más detalles

Establecimiento in vitro de cuatro variedades de caña de azúcar a partir de explantes foliares y yemas axilares. José Francisco Araya Contreras

Establecimiento in vitro de cuatro variedades de caña de azúcar a partir de explantes foliares y yemas axilares. José Francisco Araya Contreras Establecimiento in vitro de cuatro variedades de caña de azúcar a partir de explantes foliares y yemas axilares José Francisco Araya Contreras ZAMORANO Carrera de Ciencia y Producción Agropecuaria Noviembre,

Más detalles

CÉLULAS MADRE VEGETALES

CÉLULAS MADRE VEGETALES Crisanto Gutiérrez es investigador en el Centro de Biología Molecular Severo Ochoa, centro mixto del Consejo Superior de Investigaciones BIOLOGÍA DEL DESARROLLO CÉLULAS MADRE VEGETALES Las plantas poseen

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Abonado eficiente y rentable en fertirrigación. Solub

Abonado eficiente y rentable en fertirrigación. Solub Abonado eficiente y rentable en fertirrigación. Solub ENTEC Solub - OPTIMIZACIÓN DEL USO DEL NITRÓGENO EN FERTIRRIGACIÓN La optimización del aporte de fertilizantes nitrogenados es uno de los aspectos

Más detalles

PREGUNTAS PAU. DIVISIÓN CELULAR Y CÉLULA VEGETAL

PREGUNTAS PAU. DIVISIÓN CELULAR Y CÉLULA VEGETAL PREGUNTAS PAU. DIVISIÓN CELULAR Y CÉLULA VEGETAL 1.-El esquema representa una serie de reacciones químicas (metabolismo) que tienen lugar en el interior de una célula. a.- Identifica los orgánulos I y

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

ATLAS de HISTOLOGÍA VEGETAL y ANIMAL. Tejidos vegetales. Pilar Molist, Manuel A. Pombal, Manuel Megías

ATLAS de HISTOLOGÍA VEGETAL y ANIMAL. Tejidos vegetales. Pilar Molist, Manuel A. Pombal, Manuel Megías ATLAS de HISTOLOGÍA VEGETAL y ANIMAL Tejidos vegetales 1. MERISTEMOS Pilar Molist, Manuel A. Pombal, Manuel Megías Departamento de Biología Funcional y Ciencias de la Salud. Facultad de Biología. Universidad

Más detalles

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA

MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA DATOS DE LA EMPRESA Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC- SODERCAN), Avda. Herrera Oria s/n. Santander. El tutor CSIC fue Raúl Fernández

Más detalles

file:///c:/documents%20and%20settings/administrador/mis%20docu...

file:///c:/documents%20and%20settings/administrador/mis%20docu... [ Principal ] [ contenido ] [ introducción ] [ ciclo celular ] [ divisiones celulares ] [ ciclos de vida ] [ mendel ] [ otras relaciones alélicas ] [ ligados ] [ sexo y herencia ] [ interacción ] [ estructura

Más detalles

REGENERACIÓN IN VITRO VÍA ORGANOGÉNESIS Y AISLAMIENTO DE PROTOPLASTOS DE Gmelina arborea A PARTIR DE PLANTAS IN VITRO. LIESEL GAMARRA REINOSO

REGENERACIÓN IN VITRO VÍA ORGANOGÉNESIS Y AISLAMIENTO DE PROTOPLASTOS DE Gmelina arborea A PARTIR DE PLANTAS IN VITRO. LIESEL GAMARRA REINOSO REGENERACIÓN IN VITRO VÍA ORGANOGÉNESIS Y AISLAMIENTO DE PROTOPLASTOS DE Gmelina arborea A PARTIR DE PLANTAS IN VITRO. LIESEL GAMARRA REINOSO TRABAJO DE GRADO Presentado como requisito parcial para optar

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

PRACTICAS DE BIOTECNOLOGÍA VEGETAL

PRACTICAS DE BIOTECNOLOGÍA VEGETAL PRACTICAS DE BIOTECNOLOGÍA VEGETAL INDICE 1. MICROPROPAGACIÓN 1.1. Medios de cultivo. 1.1.1. Medio de Cultivo de Murashige y Skoog. 1.1.1.1. Elaboración de Soluciones Madre del medio de cultivo Murashige

Más detalles

REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA

REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA REGULACIÓN TRANSCRIPCIONAL DE LA EXPRESIÓN GENICA Niveles de organización de los seres humanos Biología Molecular Básica e Ingeniería Genética T.M. Claudia Troncoso M. Regulación expresión génica Diversidad

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge CRECIMIENTO Y DIFERENCIACIÓN CELULAR CICLO CELULAR El ciclo celular se describe como la secuencia general de acontecimientos que se producen durante la vida de una célula eucariota y se divide en cuatro

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

EVALUACIÓN DE TRATAMIENTOS DE DESINFECCIÓN EN SEGMENTOS NODALES DE Guadua angustifolia PARA EL ESTABLECIMIENTO DEL CULTIVO in vitro

EVALUACIÓN DE TRATAMIENTOS DE DESINFECCIÓN EN SEGMENTOS NODALES DE Guadua angustifolia PARA EL ESTABLECIMIENTO DEL CULTIVO in vitro EVALUACIÓN DE TRATAMIENTOS DE DESINFECCIÓN EN SEGMENTOS NODALES DE Guadua angustifolia PARA EL ESTABLECIMIENTO DEL CULTIVO in vitro PRESENTADO POR: LORENA ALEXANDRA RAMÍREZ CORREA ASESORADO POR: NIDIA

Más detalles

MÓDULO DE TRABAJO MÉTODOS BIOTECNOLÓGICOS

MÓDULO DE TRABAJO MÉTODOS BIOTECNOLÓGICOS UNIVERSIDAD PRIVADA JOSE CARLOS MARIATEGUI FACULTAD DE INGENIERIA AGRONÓMICA MÓDULO DE TRABAJO MÉTODOS BIOTECNOLÓGICOS CONSULTOR ING. HERNÁN ALBARRACIN MORE CIP 69179 MOQUEGUA - PERÚ INDICE I. INTRODUCCIÓN

Más detalles

AMINOÁCIDOS SE PUEDEN UNIR POR ENLACES PEPTÍDICOS

AMINOÁCIDOS SE PUEDEN UNIR POR ENLACES PEPTÍDICOS Tema 4. Proteínas: funciones biológicas y estructura primaria. Enlace peptídico. Péptidos y proteínas. Diversidad de funciones biológicas. Niveles de organización estructural de las proteínas. Separación

Más detalles