As was previously described, gene expression profiles of the 70 CCRCCs (performed on cdna
|
|
- María Soledad Vázquez Rivero
- hace 5 años
- Vistas:
Transcripción
1 RSNA, /radiol Appendix E1 Gene Expression Profiling Training Set As was previously described, gene expression profiles of the 70 CCRCCs (performed on cdna microarrays containing over 40,000 cdna clones and representing 27,290 unique UniGene clusters) were accessed from the Gene Expression Omnibus (GSE3538) (1). To filter the expression data to only those genes that were most variably expressed and well measured, we used the same filtering criteria as Zhao et al (1); array elements that varied at least two-fold from the median on at least five microarrays were selected for subsequent analysis (5332 cdna elements representing 4825 unique genes). Within these 5332 cdna elements, transcripts that were identified as part of the previously determined CCRCC prognostic gene expression signature were selected (217 transcripts representing 139 genes [Table E1]). Hierarchical clustering of the expression profiles are shown in Figure E1. Kaplan-Meier survival analysis was performed between the low and high prognostic patient groups, confirming that the 259 prognostic gene signatures remained a significant predictor of survival in our population (P =.0031). Validation Set Gene expression profiles of the 70 CCRCCs was performed on Illumina Human HT-12 v4 Expression BeadChip arrays (Illumina, San Diego, Calif), which contained 47,231 probes. Page 1 of 22
2 Quantile normalization was performed with the lumi R package (2). The expression arrays were filtered on the basis of the set of SPC transcripts that mapped to the Illumina probes. References 1. Zhao H, Ljungberg B, Grankvist K, Rasmuson T, Tibshirani R, Brooks JD. Gene expression profiling predicts survival in conventional renal cell carcinoma. PLoS Med 2006;3(1):e Du P, Kibbe WA, Lin SM. lumi: a pipeline for processing Illumina microarray. Bioinformatics 2008;24(13): Page 2 of 22
3 Table E1. Annotation of SPC Transcripts UniGene ID Gene Description Hs Myelin protein zero-like 2::myelin protein zero-like 2 Hs AA IMAGE: MPZL Hs Tubulin tyrosine ligase-like family, member 7::tubulin tyrosine ligase-like family, member 7 Hs H29858::H29951 IMAGE: TTLL Hs Rho-related BTB domain containing 1::Rho-related BTB domain containing 1 Hs AA182796::AA IMAGE: RHOBTB Hs Discoidin, CUB and LCCL domain containing 2::discoidin, CUB and LCCL domain containing 2 Hs H99544::H99543 IMAGE: DCBLD Hs Guanine nucleotide binding protein (G protein), gamma 11::guanine nucleotide binding protein (G protein), gamma 11 Hs AA IMAGE: GNG Hs Palmdelphin::palmdelphin Hs AA418728::AA IMAGE: PALMD Hs Discoidin, CUB and LCCL domain containing 2::discoidin, CUB and LCCL domain containing 2 Hs AI IMAGE: DCBLD Hs Interferon induced transmembrane protein 1 (9 27)::interferon induced transmembrane protein 1 (9 27) Hs AA419251::AA IMAGE: IFITM Hs CDNA clone IMAGE: Hs AA IMAGE: Hs KIAA1147::KIAA1147 Hs AA029331::AA IMAGE: KIAA Hs Ankyrin 3, node of Ranvier (ankyrin G)::ankyrin 3, node of Ranvier (ankyrin G)::Transcribed locus Hs ::Hs AA021558::AA IMAGE: ANK Page 3 of 22
4 Hs Transcribed locus, strongly similar to NP_ regulator of G-protein signaling 5 [Homo sapiens] Hs AA IMAGE: Hs RAS-like, estrogen-regulated, growth inhibitor::ras-like, estrogen-regulated, growth inhibitor Hs AA131239::AA IMAGE: RERG Hs.7946 Mitochondrial tumor suppressor 1::mitochondrial tumor suppressor 1 Hs AA IMAGE: MTUS Hs Lymphoid-restricted membrane protein::lymphoid-restricted membrane protein Hs AA457051::AA IMAGE: LRMP Hs Nonmetastatic cells 1, protein (NM23A) expressed in::nonmetastatic cells 1, protein (NM23A) expressed in Hs AA496628::AA IMAGE: NME Hs Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)::integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) Hs AA069027::AA IMAGE: ITGA Hs Zinc finger protein 189::zinc finger protein 189 Hs AA256471::AA IMAGE: ZNF Hs Vav 3 guanine nucleotide exchange factor::vav 3 guanine nucleotide exchange factor Hs W91879::W91952 IMAGE: VAV Hs Acyl-CoA synthetase medium-chain family member 2A::acyl-CoA synthetase medium-chain family member 2B Hs AA IMAGE: ACSM2B Hs Natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)::natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) Hs AI668687::N92291::AI734266::W24469 IMAGE: NPR Hs Transcribed locus Hs T68445::T68510 IMAGE: Hs Midline 1 (Opitz/BBB syndrome)::midline 1 (Opitz/BBB syndrome) Hs AA IMAGE: MID Hs Sprouty homolog 1, antagonist of FGF signaling (Drosophila)::sprouty homolog 1, antagonist of FGF signaling (Drosophila)::Transcribed locus Hs ::Hs AA055440::AA IMAGE: SPRY Page 4 of 22
5 Hs Transcribed locus::gm2 ganglioside activator::gm2 ganglioside activator Hs ::Hs AA983633::AI733175::AI IMAGE: GM2A Hs GNAS complex locus::gnas complex locus::transcribed locus Hs ::Hs AA285128::AA IMAGE: GNAS Hs Glutathione S-transferase A2::glutathione S-transferase A2 Hs T73468::T73535 IMAGE:82710 GSTA Hs Chromosome 5 open reading frame 23::chromosome 5 open reading frame 23 Hs N90806::W19519 IMAGE: C5orf Hs Glutathione S-transferase A2::glutathione S-transferase A2::Transcribed locus Hs.94107::Hs N59772::N78234 IMAGE: GSTA Hs Serine peptidase inhibitor, Kunitz type, 2::serine peptidase inhibitor, Kunitz type, 2 Hs AA031287::AA IMAGE: SPINT Hs CD52 molecule::cd52 molecule Hs AA435559::AA IMAGE: CD Hs Influenza virus NS1A binding protein::influenza virus NS1A binding protein Hs AA487115::AA IMAGE: IVNS1ABP Hs Lysyl oxidase::lysyl oxidase Hs AA452916::AA IMAGE: LOX Hs BCL2/adenovirus E1B 19kDa interacting protein 3-like::BCL2/adenovirus E1B 19kDa interacting protein 3-like Hs AA025112::AA IMAGE: BNIP3 L Hs Cytochrome P450, family 4, subfamily V, polypeptide 2::kallikrein B, plasma (Fletcher factor) 1 Hs AA450041::AA IMAGE: KLKB Hs GNAS complex locus::gnas complex locus Hs W88587 IMAGE: GNAS 1186 Hs Lysyl oxidase::lysyl oxidase::transcribed locus Hs ::Hs H80737::H80736 IMAGE: LOX Page 5 of 22
6 Hs Discoidin, CUB and LCCL domain containing 2::discoidin, CUB and LCCL domain containing 2 Hs AA457544::AA IMAGE: DCBLD Hs EH domain binding protein 1::EH domain binding protein 1 Hs AA IMAGE: EHBP Hs Golgi-localized protein::golgi-localized protein Hs T61269::T61321 IMAGE:77911 GOLSYN Hs Dimethylarginine dimethylaminohydrolase 1::dimethylarginine dimethylaminohydrolase 1 Hs AA478470::AA IMAGE: DDAH Hs Lysyl oxidase::lysyl oxidase::transcribed locus Hs ::Hs H99075::N26939 IMAGE: LOX Hs Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)::tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Hs AI IMAGE: TFPI Hs SH3 domain binding glutamic acid-rich protein like 2::SH3 domain binding glutamic acid-rich protein like 2 Hs W69271::W69558 IMAGE: SH3BGRL Hs Glutathione S-transferase A4::glutathione S-transferase A4 Hs N47484::N47483 IMAGE: GSTA Hs Major histocompatibility complex, class II, DR beta 3::major histocompatibility complex, class II, DR beta 1 Hs H52245::H52342 IMAGE: HLA-DRB Hs Endothelin receptor type B::endothelin receptor type B Hs N29914::N42964 IMAGE: EDNRB Hs Cadherin 1, type 1, E-cadherin (epithelial)::cadherin 1, type 1, E-cadherin (epithelial) Hs W86859 IMAGE: CDH Hs.8364 Pyruvate dehydrogenase kinase, isozyme 4::pyruvate dehydrogenase kinase, isozyme 4 Hs AA IMAGE: PDK Hs Egl nine homolog 3 (C. elegans)::egl nine homolog 3 (C. elegans) Hs AA IMAGE: EGLN Hs Leukemia inhibitory factor receptor alpha::leukemia inhibitory factor receptor alpha::transcribed locus Hs ::Hs H10192::H10240 IMAGE:46694 LIFR Page 6 of 22
7 Hs Elongation protein 3 homolog (S. cerevisiae)::elongation protein 3 homolog (S. cerevisiae) Hs AA482031::AA IMAGE: ELP Hs Interferon induced transmembrane protein 1 (9 27)::interferon induced transmembrane protein 1 (9 27) Hs AA IMAGE: IFITM Hs Poliovirus receptor-related 3::poliovirus receptor-related 3 Hs AA IMAGE: PVRL Hs Leukemia inhibitory factor receptor alpha::leukemia inhibitory factor receptor alpha::serine hydroxymethyltransferase 2 (mitochondrial)::serine hydroxymethyltransferase 2 (mitochondrial) Hs ::Hs ::6472 N67017::W04138 IMAGE: LIFR::SHMT Hs ST8 alpha-n-acetyl-neuraminide alpha-2,8-sialyltransferase 4::ST8 alpha-n-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Hs AA IMAGE: ST8SIA Hs Aldehyde dehydrogenase 6 family, member A1::aldehyde dehydrogenase 6 family, member A1 Hs AA196287::AA IMAGE: ALDH6A Hs Transmembrane and tetratricopeptide repeat containing 1::transmembrane and tetratricopeptide repeat containing 1 Hs T60061 IMAGE:81316 TMTC Hs.5025 Nebulette::nebulette Hs N77806::W16723 IMAGE: NEBL Hs Sortilin-related receptor, L (DLR class) A repeats-containing::sortilin-related receptor, L (DLR class) A repeats-containing Hs T51538::T51689 IMAGE:72391 SORL Hs Integrin, alpha 6::integrin, alpha 6 Hs H07142::H06635 IMAGE:44814 ITGA Hs L1 cell adhesion molecule::l1 cell adhesion molecule Hs AI IMAGE: L1CAM Hs Alpha-2-macroglobulin::alpha-2-macroglobulin Hs ::AA IMAGE: A2M Hs Cadherin 1, type 1, E-cadherin (epithelial)::cadherin 1, type 1, E-cadherin (epithelial) Hs T62868::T62718 IMAGE:79598 CDH Hs Growth arrest-specific 2 like 3::growth arrest-specific 2 like 3 Hs N20305::N27574 IMAGE: GAS2 L Page 7 of 22
8 Hs BCL2/adenovirus E1B 19kDa interacting protein 3-like::BCL2/adenovirus E1B 19kDa interacting protein 3-like Hs AA IMAGE: BNIP3 L Hs Discoidin, CUB and LCCL domain containing 2::discoidin, CUB and LCCL domain containing 2 Hs N21309::N31244 IMAGE: DCBLD Hs Elongation protein 3 homolog (S. cerevisiae)::elongation protein 3 homolog (S. cerevisiae) Hs AA IMAGE: ELP Hs Vascular cell adhesion molecule 1::vascular cell adhesion molecule 1 Hs H16591::H16637 IMAGE:49164 VCAM Hs RAB11 family interacting protein 3 (class II)::RAB11 family interacting protein 3 (class II) Hs R38361::T77413 IMAGE:23794 RAB11FIP Hs Actin binding LIM protein 1::actin binding LIM protein 1 Hs AA IMAGE: ABLIM Hs Guanylate binding protein 3::guanylate binding protein 1, interferon-inducible, 67kDa Hs AA486850::AA IMAGE: GBP Hs chromosome 5 open reading frame 13::Chromosome 5 open reading frame 13 Hs H60560::H60254 IMAGE: C5orf Hs B-cell CLL/lymphoma 2::B-cell CLL/lymphoma 2 Hs W63749::W61100 IMAGE: BCL Hs Serine peptidase inhibitor, Kunitz type, 2::serine peptidase inhibitor, Kunitz type, 2 Hs AA458849::AA IMAGE: SPINT Hs myosin VB::Acetyl-Coenzyme A acyltransferase 2 Hs AA219282::AA IMAGE: MYO5B Hs Transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)::transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)::transcribed locus Hs ::Hs AA394236::AA IMAGE: TFAP2C Hs MOCO sulphurase C-terminal domain containing 2::MOCO sulphurase C-terminal domain containing 2::Transcribed locus Hs ::Hs T63490::T63565 IMAGE:81449 MOSC Page 8 of 22
9 Hs Caldesmon 1::caldesmon 1 Hs AA447737::AA IMAGE: CALD Hs Netrin 4::netrin 4 Hs R76614::R76613 IMAGE: NTN Hs CTP synthase::ctp synthase Hs W44416::W45678 IMAGE: CTPS Hs.8379 Transcribed locus Hs.8379 T41071::T40203 IMAGE: Hs Ral guanine nucleotide dissociation stimulator-like 1::ral guanine nucleotide dissociation stimulator-like 1::actin related protein 2/3 complex, subunit 5, 16kDa::Actin related protein 2/3 complex, subunit 5, 16kDa Hs ::Hs ::10092 AA169173::AA IMAGE: RGL1::ARPC Hs Family with sequence similarity 131, member C::family with sequence similarity 131, member C Hs AA IMAGE: FAM131C Hs Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)::tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) Hs H91294::H91389 IMAGE: TFPI Hs Ectonucleotide pyrophosphatase/phosphodiesterase 3::ectonucleotide pyrophosphatase/phosphodiesterase 3 Hs AA IMAGE: ENPP Hs POU class 5 homeobox 1::POU class 5 homeobox 1 Hs AA IMAGE: POU5F Hs Glutathione S-transferase A4::glutathione S-transferase A4 Hs AA152347::AA IMAGE: GSTA Hs Glypican 6::glypican 6 Hs AA456147::AA IMAGE: GPC Hs Endothelial cell-specific molecule 1::endothelial cell-specific molecule 1 Hs W46577::W46667 IMAGE: ESM Hs Angiogenin, ribonuclease, RNase A family, 5::angiogenin, ribonuclease, RNase A family, 5 Hs AA IMAGE: ANG Hs Aldehyde dehydrogenase 6 family, member A1::aldehyde dehydrogenase 6 family, member A1 Hs N62179::N77107 IMAGE: ALDH6A Page 9 of 22
10 Hs Ankyrin 3, node of Ranvier (ankyrin G)::ankyrin 3, node of Ranvier (ankyrin G) Hs AA IMAGE: ANK Hs Influenza virus NS1A binding protein::influenza virus NS1A binding protein Hs AI IMAGE: IVNS1ABP Hs Family with sequence similarity 13, member A1::family with sequence similarity 13, member A1 Hs N51424 IMAGE: FAM13A Hs Family with sequence similarity 84, member B::family with sequence similarity 84, member B Hs AI IMAGE: FAM84B Hs Coagulation factor II (thrombin) receptor-like 1::coagulation factor II (thrombin) receptor-like 1::Transcribed locus Hs ::Hs AA454652::AA IMAGE: F2RL Hs Aldehyde dehydrogenase 6 family, member A1::aldehyde dehydrogenase 6 family, member A1 Hs AI IMAGE: ALDH6A Hs Sortilin-related receptor, L (DLR class) A repeats-containing::sortilin-related receptor, L (DLR class) A repeats-containing Hs AI IMAGE: SORL Hs KIAA0746 protein::kiaa0746 protein Hs AA IMAGE: KIAA Hs CDNA FLJ13937 fis, clone Y79AA Hs R53446::R53445 IMAGE: Hs Interferon induced transmembrane protein 1 (9 27)::interferon induced transmembrane protein 1 (9 27) Hs AA058323::AA IMAGE: IFITM Hs UDP glucuronosyltransferase 2 family, polypeptide B4::UDP glucuronosyltransferase 2 family, polypeptide B4 Hs N53031::N73214 IMAGE: UGT2B Hs.3281 Neuronal pentraxin II::neuronal pentraxin II Hs AA IMAGE: NPTX Hs Transforming, acidic coiled-coil containing protein 1::transforming, acidic coiled-coil containing protein 1 Hs H47327::H47413 IMAGE: TACC Page 10 of 22
11 Hs Coagulation factor II (thrombin) receptor-like 1::coagulation factor II (thrombin) receptor-like 1 Hs AI IMAGE: F2RL Hs Solute carrier family 5 (sodium/glucose cotransporter), member 12::solute carrier family 5 (sodium/glucose cotransporter), member 12 Hs AA994816::AI IMAGE: SLC5A Hs.66 Interleukin 1 receptor-like 1::interleukin 1 receptor-like 1 Hs AA128153::AA IMAGE: IL1RL Hs Natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)::natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) Hs AI IMAGE: NPR Hs Leukemia inhibitory factor receptor alpha::leukemia inhibitory factor receptor alpha Hs AA131466::AA IMAGE: LIFR Hs Transmembrane protein 159::transmembrane protein 159 Hs H09934::H09933 IMAGE:46355 TMEM Hs TBC1 domain family, member 8B (with GRAM domain)::tbc1 domain family, member 8B (with GRAM domain) Hs AA287032::AA IMAGE: TBC1D8B Hs RAS-like, estrogen-regulated, growth inhibitor::ras-like, estrogen-regulated, growth inhibitor Hs AA IMAGE: RERG Hs Transforming growth factor, alpha::transforming growth factor, alpha Hs AA IMAGE: TGFA Hs Acyl-CoA thioesterase 7::acyl-CoA thioesterase 7::Transcribed locus Hs ::Hs AA035455::AA IMAGE: ACOT Hs insulin receptor::insulin receptor Hs T47312::T47311 IMAGE:70749 INSR Hs Caldesmon 1::caldesmon 1::Transcribed locus Hs ::Hs AA426421::AA IMAGE: CALD Hs Homo sapiens, clone IMAGE: , mrna Hs H19307::H19013 IMAGE: Hs Family with sequence similarity 13, member A1::family with sequence similarity 13, member A1 Hs AA IMAGE: FAM13A Page 11 of 22
12 Hs Transcribed locus Hs AA IMAGE: Hs Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)::integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) Hs AA IMAGE: ITGA Hs Aldehyde dehydrogenase 3 family, member A2::aldehyde dehydrogenase 3 family, member A2 Hs AA418697::AA IMAGE: ALDH3A Hs Aldehyde oxidase 1::aldehyde oxidase 1 Hs AI IMAGE: AOX Hs Transforming, acidic coiled-coil containing protein 1::transforming, acidic coiled-coil containing protein 1 Hs AA IMAGE: TACC Hs Caldesmon 1::caldesmon 1 Hs H52087::H51958 IMAGE: CALD Hs Sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A::sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A Hs AA236561::AA IMAGE: SEMA6A 3980 Hs Chromosome 11 open reading frame 57::chromosome 11 open reading frame 57::Transcribed locus, strongly similar to NP_ hypothetical protein LOC55216 isoform b [Homo sapiens] Hs ::Hs W04502::W31402 IMAGE: C11orf Hs ST8 alpha-n-acetyl-neuraminide alpha-2,8-sialyltransferase 4::ST8 alpha-n-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Hs AA IMAGE: ST8SIA Hs Yippee-like 2 (Drosophila)::yippee-like 2 (Drosophila) Hs AA IMAGE: YPEL Hs.7946 Mitochondrial tumor suppressor 1::mitochondrial tumor suppressor 1 Hs AA496896::AA IMAGE: MTUS Hs RAB11 family interacting protein 3 (class II)::RAB11 family interacting protein 3 (class II) Hs R44896::R24299 IMAGE:33977 RAB11FIP Hs.4104 Chromosome 14 open reading frame 129::chromosome 14 open reading frame 129::Transcribed locus Hs ::Hs AA233790::AA IMAGE: C14orf Page 12 of 22
13 Hs Transmembrane and tetratricopeptide repeat containing 1::transmembrane and tetratricopeptide repeat containing 1 Hs AA447480::AA IMAGE: TMTC Hs.904 Amylo-1, 6-glucosidase, 4-alpha-glucanotransferase (glycogen debranching enzyme, glycogen storage disease type III)::amylo-1, 6-glucosidase, 4-alphaglucanotransferase Hs AA IMAGE: AGL Hs Stanniocalcin 1::stanniocalcin 1 Hs AA085319::AA IMAGE: STC Hs CD52 molecule::cd52 molecule Hs AI IMAGE: CD Hs Actin binding LIM protein 1::actin binding LIM protein 1 Hs T50244::AI IMAGE:77325 ABLIM Hs Family with sequence similarity 13, member A1::family with sequence similarity 13, member A1 Hs AA024827::AA IMAGE: FAM13A Hs Endothelin receptor type B::endothelin receptor type B Hs H28710::H28840 IMAGE:49665 EDNRB Hs Solute carrier family 1 (glial high affinity glutamate transporter), member 3::solute carrier family 1 (glial high affinity glutamate transporter), member 3 Hs AA453742::AA IMAGE: SLC1A Hs Nonmetastatic cells 1, protein (NM23A) expressed in::nonmetastatic cells 1, protein (NM23A) expressed in Hs AA IMAGE: NME Hs Endothelial PAS domain protein 1::endothelial PAS domain protein 1 Hs AA IMAGE: EPAS Hs GNAS complex locus::gnas complex locus Hs AA035620::AA IMAGE: GNAS 6533 Hs Growth arrest-specific 2 like 3::growth arrest-specific 2 like 3 Hs AI IMAGE: GAS2 L Hs SUB1 homolog (S. cerevisiae)::sub1 homolog (S. cerevisiae) Hs AA456973::AA IMAGE: SUB Hs Dimethylarginine dimethylaminohydrolase 1::dimethylarginine dimethylaminohydrolase 1 Hs N24042::N35863 IMAGE: DDAH Page 13 of 22
14 Hs Zinc finger CCCH-type containing 6::zinc finger CCCH-type containing 6 Hs AA948719::AI733399::AI IMAGE: ZC3H Hs Major histocompatibility complex, class II, DR beta 3::major histocompatibility complex, class II, DR beta 1 Hs AA IMAGE: HLA-DRB Hs SLIT-ROBO Rho GTPase activating protein 2::SLIT-ROBO Rho GTPase activating protein 2 Hs N31484 IMAGE: SRGAP Hs SH3 domain binding glutamic acid-rich protein like 2::SH3 domain binding glutamic acid-rich protein like 2 Hs H19327::H19036 IMAGE:50926 SH3BGRL Hs Phosphoprotein associated with glycosphingolipid microdomains 1::phosphoprotein associated with glycosphingolipid microdomains 1 Hs H09567::H08999 IMAGE:45934 PAG Hs Transforming, acidic coiled-coil containing protein 1::transforming, acidic coiled-coil containing protein 1 Hs AA456316::AA IMAGE: TACC Hs N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)::n-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) Hs W78156::W79930 IMAGE: NPL Hs Proprotein convertase subtilisin/kexin type 6::proprotein convertase subtilisin/kexin type 6::Proprotein convertase subtilisin/kexin type 6 Hs ::Hs W85807::W85806 IMAGE: PCSK Hs Sortilin-related receptor, L (DLR class) A repeats-containing::sortilin-related receptor, L (DLR class) A repeats-containing Hs AA IMAGE: SORL Hs Actin binding LIM protein 1::actin binding LIM protein 1 Hs AI IMAGE: ABLIM Hs Small G protein signaling modulator 3::small G protein signaling modulator 3 Hs AA IMAGE: SGSM Hs Transcribed locus Hs T61428 IMAGE: Hs Egl nine homolog 3 (C. elegans)::egl nine homolog 3 (C. elegans) Hs R00226::R00332 IMAGE: EGLN Page 14 of 22
15 Hs Transmembrane protein 27::transmembrane protein 27 Hs AA999850::AI IMAGE: TMEM Hs Integrin, alpha 6::integrin, alpha 6 Hs T54663::T54750 IMAGE:73784 ITGA Hs Transmembrane protein 27::transmembrane protein 27 Hs AI253234::AI793193::AI IMAGE: TMEM Hs KIAA0999 protein::kiaa0999 protein Hs AA446193::AA IMAGE: KIAA Hs EH domain binding protein 1::EH domain binding protein 1 Hs AA456284::AA IMAGE: EHBP Hs GNAS complex locus::gnas complex locus Hs AI IMAGE: GNAS 7441 Hs Ral guanine nucleotide dissociation stimulator-like 1::ral guanine nucleotide dissociation stimulator-like 1 Hs T98762::T98761 IMAGE: RGL Hs Cyclin-dependent kinase inhibitor 1B (p27, Kip1)::cyclin-dependent kinase inhibitor 1B (p27, Kip1) Hs AA192725::AA IMAGE: CDKN1B Hs Hepatic leukemia factor::hepatic leukemia factor Hs N70235::W00959 IMAGE: HLF 7753 Hs Sortilin-related receptor, L (DLR class) A repeats-containing::sortilin-related receptor, L (DLR class) A repeats-containing Hs N50656::N50751 IMAGE: SORL Hs Solute carrier family 36 (proton/amino acid symporter), member 1::solute carrier family 36 (proton/amino acid symporter), member 1 Hs R00480::R00479 IMAGE: SLC36A Hs Stanniocalcin 1::stanniocalcin 1 Hs AA126561::AA IMAGE: STC Hs Vav 3 guanine nucleotide exchange factor::vav 3 guanine nucleotide exchange factor Hs H10045::H10098 IMAGE:46827 VAV Hs Vascular cell adhesion molecule 1::vascular cell adhesion molecule 1 Hs H07072::H07071 IMAGE:44477 VCAM Hs Iroquois homeobox 3::iroquois homeobox 3 Hs R55185::R55184 IMAGE: IRX Page 15 of 22
16 Hs Tumor necrosis factor, alpha-induced protein 6::tumor necrosis factor, alpha-induced protein 6 Hs W92764::W93163 IMAGE: TNFAIP Hs Angiogenin, ribonuclease, RNase A family, 5::angiogenin, ribonuclease, RNase A family, 5 Hs T60163::T60223 IMAGE:81417 ANG Hs Cytochrome b5 type A (microsomal)::cytochrome b5 type A (microsomal) Hs R91950::R92281 IMAGE: CYB5A Hs Lysyl oxidase::lysyl oxidase Hs W60414::W60413 IMAGE: LOX Hs CDNA clone IMAGE: Hs AA IMAGE: Hs myosin VB::Acetyl-Coenzyme A acyltransferase 2 Hs H07926::H08029 IMAGE:45376 MYO5B Hs Cadherin 1, type 1, E-cadherin (epithelial)::cadherin 1, type 1, E-cadherin (epithelial) Hs H97778 IMAGE: CDH Hs Growth factor receptor-bound protein 10::growth factor receptor-bound protein 10 Hs AA IMAGE: GRB Hs N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)::n-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) Hs AA233620::AA IMAGE: NPL 8293 Hs insulin receptor::insulin receptor Hs AA001614::AA IMAGE: INSR Hs Ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin)::ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin) Hs AA476508::AA IMAGE: ENPP Hs AT rich interactive domain 5B (MRF1-like)::AT rich interactive domain 5B (MRF1-like) Hs AA135616::AA IMAGE: ARID5B Hs podocalyxin-like::podocalyxin-like::transcribed locus Hs.16426::Hs N64508::N80294 IMAGE: PODXL Hs vesicle-associated membrane protein 5 (myobrevin)::vesicle-associated membrane protein 5 (myobrevin) Hs AA IMAGE: VAMP Page 16 of 22
17 Hs Transcribed locus Hs AA IMAGE: Hs.8944 Procollagen C-endopeptidase enhancer 2::procollagen C-endopeptidase enhancer 2 Hs AA115742::AA IMAGE: PCOLCE Hs Growth arrest-specific 2 like 3::growth arrest-specific 2 like 3 Hs R84407 IMAGE: GAS2 L3 885 Hs Carboxymethylenebutenolidase homolog (Pseudomonas)::carboxymethylenebutenolidase homolog (Pseudomonas) Hs AA111975::AA IMAGE: CMBL Hs Peroxisome proliferator-activated receptor gamma, coactivator 1 alpha::peroxisome proliferator-activated receptor gamma, coactivator 1 alpha Hs N89673::W21597 IMAGE: PPARGC1A 8967 Hs CDNA FLJ26512 fis, clone KDN07513 Hs N76019::W04370 IMAGE: Hs Caldesmon 1::caldesmon 1 Hs H48508::H48677 IMAGE: CALD Hs CD34 molecule::cd34 molecule Hs H72113::H72215 IMAGE: CD Hs Chromosome 10 open reading frame 58::chromosome 10 open reading frame 58 Hs AI IMAGE: C10orf Hs CD36 molecule (thrombospondin receptor)::cd36 molecule (thrombospondin receptor) Hs N39161::N45238 IMAGE: CD Hs Phosphoprotein associated with glycosphingolipid microdomains 1::phosphoprotein associated with glycosphingolipid microdomains 1 Hs AA IMAGE: PAG Hs POU class 5 homeobox 1::POU class 5 homeobox 1 Hs AI IMAGE: POU5F Hs DEAD (Asp-Glu-Ala-Asp) box polypeptide 47::DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 Hs AA432292::AA IMAGE: DDX Hs GNAS complex locus::gnas complex locus Hs H72932::H72533 IMAGE: GNAS Page 17 of 22
18 Hs Solute carrier family 47, member 1::solute carrier family 47, member 1 Hs W85883::W85967 IMAGE: SLC47A Hs ST8 alpha-n-acetyl-neuraminide alpha-2,8-sialyltransferase 4::ST8 alpha-n-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Hs AA IMAGE: ST8SIA Hs.8364 Pyruvate dehydrogenase kinase, isozyme 4::pyruvate dehydrogenase kinase, isozyme 4 Hs T61792 IMAGE:78946 PDK4 943 Hs Integrin, alpha 6::integrin, alpha 6 Hs R43483::R17993 IMAGE:32493 ITGA Hs Transforming growth factor, beta receptor III::transforming growth factor, beta receptor III Hs N26658::N39809 IMAGE: TGFBR Hs Myelin protein zero-like 2::myelin protein zero-like 2 Hs AA IMAGE: MPZL Hs Endothelial PAS domain protein 1::endothelial PAS domain protein 1 Hs R32440::R24882 IMAGE: EPAS Hs Major histocompatibility complex, class II, DM alpha::major histocompatibility complex, class II, DM alpha Hs H42728::H42679 IMAGE: HLA-DMA Hs AT rich interactive domain 5B (MRF1-like)::AT rich interactive domain 5B (MRF1-like) Hs AA173611::AA IMAGE: ARID5B Hs Lectin, galactoside-binding, soluble, 2::lectin, galactoside-binding, soluble, 2 Hs AA IMAGE: LGALS Hs Ral guanine nucleotide dissociation stimulator-like 1::ral guanine nucleotide dissociation stimulator-like 1 Hs AA IMAGE: RGL Hs IQ motif containing K::IQ motif containing K::Transcribed locus Hs ::Hs R43873::R19521 IMAGE:33603 IQCK Hs Poliovirus receptor-related 3::poliovirus receptor-related 3::Transcribed locus Hs ::Hs T40950::T40020 IMAGE:61502 PVRL Page 18 of 22
19 Hs KIAA1147::KIAA1147::Transcribed locus, strongly similar to NP_ synaptoporin [Mus musculus] Hs ::Hs H98619::N25140 IMAGE: KIAA Hs Cytochrome P450, family 4, subfamily V, polypeptide 2::kallikrein B, plasma (Fletcher factor) 1 Hs W90457::W90456 IMAGE: KLKB Table E2. Definitions of Imaging Traits Trait No. Trait Name Trait Description Stage Dependency Trait Values 1 Tumor size Maximal cross sectional diameter of the tumor (cm) Dependent Quantitative* 2 Renal capsule involvement Renal capsule involvement: does the tumor involve the renal capsule (yes/no) Dependent Binary 3 Gerota s fascia involvement Gerota fascia involvement: does the tumor invade or involve Gerota s fascia (yes or no) Dependent Binary 4 Infiltration of peritumoral fat Tumoral Infiltration of peritumoral fat (present or absent) Dependent Binary 5 Local Invasion Invasion of the tumor into the surrounding organs (present or absent) Dependent Binary 6 Renal vein thrombosis Renal vein thrombosis (present or absent) Dependent Binary 7 Enlarged lymph nodes Enlarged perirenal lymph nodes > 1 cm in long axis, present or absent, if present, Quantitative number of involved nodes. 8 Intratumoral Hemorrhage Areas of intratumoral hemorrhage on the precontrast scan (present/absent) Binary 9 Calcifications Intratumoral calcifications (present or absent) Binary 10 Pattern of enhancement Pattern of tumor enhancement involving > 50% of tumor area (homogeneous or heterogeneous) Binary Page 19 of 22
20 11 Low attenuation, precontrast Attenuation on precontrast image (least attenuating area) measured with 1-cm circle Quantitative* phase ROI 12 High attenuation, precontrast Attenuation on precontrast image (most attenuating area) measured with 1-cm circle Quantitative* phase ROI 13 Low attenuation, postcontrast Attenuation on postcontrast image (least attenuating area) measured with 1-cm Quantitative* phase circle ROI 14 High attenuation postcontrast Attenuation on postcontrast image (most attenuating area) measured with 1-cm Quantitative* phase circle ROI 15 Attenuation change, low Attenuation on postcontrast image corresponding to same ROI measured on 11 above Quantitative* 16 Attenaution change, high Attenuation on postcontrast image corresponding to same ROI measured on 12 above measured with 1 cm circle ROI Quantitative* 17 Pattern of tumor necrosis Pattern of tumor necrosis: percentage tumor necrosis: (0% 25%, 26% 50%, 51% 75%, 76% 100%) Ordinal 18 Tumor margins Tumor margins (sharply defined or ill defined) Binary 19 Tumor contour Tumor confined within the renal contour or exophytic Binary 20 Tumor shape Circumscribed versus infiltrative Binary 21 Location Tumor Location: upper, mid, or lower pole Ordinal 22 Involvement of renal pelvis Involvement or invasion of the tumor into the renal pelvis: present or absent Binary 23 Tumor number Number of discrete, noncontiguous tumors in the target kidney Quantitative 24 Presence of distant metastasis Distant mets: presence or absence of visible lesions suspicious for metastasis with in the visualized chest or abdomen Dependent Binary Page 20 of 22
21 25 Nonintrinsic RCC features Presence of absence of findings in target kidney not directly related to the target lesion such as renal cysts or renal stones Binary 26 Tumor transition zone Tumor transition zone: An assessment of the transition zone from tumor tissue to renal parenchyma tissue, scored as either the presence or absence of a clearly demarcated tumor, in its entirety, with a sharply defined transition between tumor and renal parenchyma. Binary 27 Ratio of contrast to necrosis Ratio of contrast to necrosis where mild has a ratio 1: Contrast enhancing volume is equal to or greater than necrosis volume, where moderate, the ratio is approximately 1, and severe where the ratio is less than 1: contrast enhancing volume is significantly less than the necrosis volume Ordinal 28 Tumor heterogeneity, Tumor heterogeneity on the precontrast image is mild, moderate, or severe Ordinal precontrast phase 29 Tumor heterogeneity, Tumor heterogeneity on the postcontrast image is mild, moderate, or severe Ordinal postcontrast phase 30 Tumor-parenchyma interaction Tumor-parenchyma interaction: A discrete rim of enhancement partially or completely circumscribing the tumor on equilibrium phase imaging in the absence of a hypoattenuating rim Binary 31 Tumor-parenchyma interface Tumor-parenchyma interface: A hypoattenuating rim completely or partially circumscribing the tumor on equilibrium phase imaging. Binary 32 Internal vascularity Internal arteries: The presence or absence of discrete enhancing arteries within the tumor Binary 33 Internal architecture Internal septations: the presence or absence of fibrous septations within the tumor Binary Page 21 of 22
22 34 Tumor hypoxia1 Internal arteries in areas of necrosis: The presence or absence of internal arteries in regions of tumor necrosis Binary 35 Tumor hypoxia2 Internal arteries at the edge of regions of necrosis: The presence or absence of internal arteries extending up to the edge of a region of necrosis Binary Note. ROI = region of interest. * Real numbers. Integer. Page 22 of 22
Supplemental Data. Hu et al. (2012). Plant Cell /tpc
1 ATGGCGCGCCGCGCCGCTTCCCGCGCTGTTGGCGCCCTTCGCTCGGACGGCTCGATCCAA M A R R A A S R A V G A L R S D G S I Q 61 GGGCGAGGAGGCCGCGCGGGGGGCAGTGGCGCCGAGGACGCACGCCACGTGTTCGACGAA G R G G R A G G S G A E D A R H V
Más detallesCarcinoma of the cervix uteri
FIGO 2008 Carcinoma of the cervix uteri Stage I The carcinoma is strictly confined to the cervix (extension to the corpus would be disregarded) IA Invasive carcinoma which can be diagnosed only by microscopy,
Más detallesTable S1. Gene expression levels from Affymetrix microarray data
Table S1. Gene expression levels from Affymetrix microarray data Gene UniGene GeneBank hesc hesc-mec FH-Ep-P3 FH-Ep-PP OCT4 Hs.249184 NM_002701 10.8 6.8 5.4 5.5 NANOG Hs.661360 NM_024865 9.0 5.8 5.2 5.4
Más detallesSupplemental Table 1. Significant genes and their values necessary for computing multi-factorial L value in the prediction model.
Supplemental Table 1. Significant genes and their values necessary for computing multi-factorial L value in the prediction model. UG cluster Symbol Description t-value Midpoint p-value Unique id Hs.36566
Más detallesGene Symbol Assay ID Gene Name. ACTB l Hs _m1 actin, beta. AKT1 b Hs _m1 v-akt murine thymoma viral oncogene homolog 1
Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 2015 Gene Symbol Assay ID Gene Name ACTB l Hs99999903_m1 actin, beta AKT1 b Hs00178289_m1 v-akt murine
Más detallesFACULTAD DE ODONTOLOGÍA
UNIVERSIDAD AUTÓNOMA DE CHIHUAHUA FACULTAD DE ODONTOLOGÍA ANÁLISIS DEL COMPONENTE MESENQUIMAL Y PROTEÍNAS DE ADHESIÓN CELULAR EN LESIONES PERIAPICALES ODONTOGÉNICAS INFLAMATORIAS PARA OBTENER EL TÍTULO
Más detallesSupplementary Table 1: List of the 316 genes regulated during hyperglycemic euinsulinemic clamp in skeletal muscle.
Supplementary Table 1: List of the 316 genes regulated during hyperglycemic euinsulinemic clamp in skeletal muscle. UGCluster Name Symbol Fold Change Cytoband Response to stress Hs.517581 Heme oxygenase
Más detallesImpacto de la Hiperestimulación Ovárica Controlada sobre el la Expresión Génica del Endometrio durante la Ventana de Implantación
Impacto de la Hiperestimulación Ovárica Controlada sobre el la Expresión Génica del Endometrio durante la Ventana de Implantación J.A. Horcajadas, A. Riesewijk, A. Cervero, A. Pellicer, S. Mosselman and
Más detallesInmunoterapia activa para el cáncer de mama
Inmunoterapia activa para el cáncer de mama Revisión sistemática Informe de síntesis de tecnología emergente Active immunotherapy for breast cancer. Systematic review Executive summary INFORMES DE EVALUACIÓN
Más detallesCortex-specific genes ESTs, Weakly similar to A46010 X-linked retinopathy protein [H.sapiens] Hs AA Unknown sc_id
Cortex-specific genes 184016 ESTs, Weakly similar to A46010 X-linked retinopathy protein [H.sapiens] Hs.291676 AA767401 Unknown sc_id6474 187003 KIAA0007 KIAA0007 protein Hs.90315 AA251235 Similar to KIAA0007
Más detallesNo usa una envolvente constante, con cambios de amplitud al cambiar la fase para pasar de un estado a otro.
Generalidades Modulación QPSK No usa una envolvente constante, con cambios de amplitud al cambiar la fase para pasar de un estado a otro. Acceso múltiple Todos los usuarios pueden transmitir al mismo tiempo.
Más detallesBF GBP1 Hs AU INDO Hs.840 dioxygenase down
Supplementary Table 2. Post- RASP SEB specific genes which passed the four different comparative tests and 1.5 #Fold- Change (FC) cut- off : 1.5 #Pairing option : Pairs of conditions S- 2: post- RASP-
Más detallessimilar to ADAM DEC1 precursor (A disintegrin and metalloproteinase domain-like protein decysin 1) (ADAM-like LOC ADAMDEC
Table 2. Top list of the genes (n = 100) displaying the highest differential expression in the AI vs. SCNT profiles in bovine endometrial caruncles and intercaruncular areas Gene accession n Unigene ID
Más detallesCONTROLADORA PARA PIXELS CONPIX
The LedEdit Software Instructions 1, Install the software to PC and open English version: When we installed The LedEdit Software, on the desktop we can see following icon: Please Double-click it, then
Más detallesExpresión de la información genética en eucariotas. metodologías de estudio 1. Qué se transcribe?
Expresión de la información genética en eucariotas similitudes y diferencias con procariotas metodologías de estudio 1 Víctor Romanowski, 2013 Qué se transcribe? Los genes son segmentos del genoma que
Más detallesUSO DE NUEVAS HERRAMIENTAS DE SECUENCIACIÓN ( RNA-SEQ ) APLICADAS EN SALMÓN DEL ATLÁNTICO
USO DE NUEVAS HERRAMIENTAS DE SECUENCIACIÓN ( RNA-SEQ ) APLICADAS EN SALMÓN DEL ATLÁNTICO Ingeniero en Acuicultura Mg. Sc. Dra. Natalia Lam P. Licenciado en Biología Mg. Sc. Dr. Cristian Araneda T. Licenciada
Más detallesLas Citocinas (II) PATRON DE TIPO TH1
Las Citocinas (II) Dr. Juan Rodríguez-Tafur D. Profesor Asociado de Farmacología e Inmunología Laboratorio de Farmacología de la Respuesta Inmune Coordinador del Comité de Residentado Médico de Inmunología
Más detallesSíntesis de ácidos grasos
Síntesis de ácidos grasos Las vías de síntesis y degradación son distintas Es similar a lo que ocurre entre glicolisis y gluneogénesis, síntesis y degradación de glicógeno Existen 4 diferencias esenciales
Más detallesBenemérita Universidad Autónoma de Puebla. AlinaSantillánGuzmán
Benemérita Universidad Autónoma de Puebla Taller: Análisis y Procesamiento de Señales EEG 3er WORKSHOP CEMMAC AlinaSantillánGuzmán alina_santillan@yahoo.com.mx Benemérita Universidad Autónoma de Puebla
Más detallesMejora en la Composición de los Alimentos. Guillermo Reglero Director IMDEA Alimentación
Mejora en la Composición de los Alimentos Guillermo Reglero Director IMDEA Alimentación 1 2 3 Enfermos hospitalizados por ECV 4 Alimentación para la salud 5 6 7 8 13 de marzo de 2014 9 10 11 12 13 8,00%
Más detallesLa EPOC como factor de riesgo para Cáncer de Pulmón. Dr. Juan Pablo de Torres Tajes Servicio de Neumología Clínica Universidad de Navarra
La EPOC como factor de riesgo para Cáncer de Pulmón Dr. Juan Pablo de Torres Tajes Servicio de Neumología Clínica Universidad de Navarra Resumen Una asociación letal Nuestros datos Posibles mecanismos
Más detallesUn viaje histórico por la biología molecular. que nos permitirá conocer algunos conceptos
Biología Molecular Un viaje histórico por la biología molecular que nos permitirá conocer algunos conceptos La herencia de fenotipos sigue reglas predecibles El inicio de la genética (G. Mendel) Cruces
Más detallesComparación de secuencias de ADN y proteínas Matriz de puntos Alineamiento global
Comparación de secuencias de ADN y proteínas Matriz de puntos Alineamiento global a) Las dos secuencias son idénticas en la parte alineada. b) Las dos secuencias muestran un desemparejamiento debido a
Más detallesIDENTIFICANDO GENES QUE FAVORECEN LA ADAPTACIÓN LOCAL EN Apis mellifera iberiensis
IDENTIFICANDO GENES QUE FAVORECEN LA ADAPTACIÓN LOCAL EN Apis mellifera iberiensis Julio Chávez-Galarza, Dora Henriques, J. Spencer Johnston, J. Rufino, M. Alice Pinto School of Sciences University of
Más detallesSecuenciación*Genómica*y*Medicina*Personalizada*del*Cáncer
Secuenciación*Genómica*y*Medicina*Personalizada*del*Cáncer Ricardo Armisén Y. Centro de Investigación y Tratamiento del Cáncer U-CANCER: Red de Medicina Traslacional en Cáncer Programa de Fisiopatología!Instituto
Más detallesCáncer. Dr. Monterrubio. Capitulo 14
Cáncer Capitulo 14 Cáncer 1. Caracterizado por la división celular sin control 2. ~1.5 millón/año de americanos diagnosticados (0.5 millón/año mueren por la enfermedad) 3. 10% de canceres con predisposición
Más detallesTELEVISOR A COLORES MANUAL DE SERVICIO MODELO : CP-29C40P. ATENCIÓN Antes de dar servicio al chasis, lea las PRECAUCIONES DE SEGURIDAD en este manual.
LG TELEVISOR A COLORES MANUAL DE SERVICIO CHASIS : MC-53A MODELO : CP-29C40P ATENCIÓN Antes de dar servicio al chasis, lea las PRECAUCIONES DE SEGURIDAD en este manual. - 1 - - 2 - - 3 - - 4 - - 1 - -
Más detallesDerechos reservados AVL, JADD, AJBG, queda prohibida su reproducción total y/o parcial.
FAILURE THEORIES (From Shigley s Mechanical Engineering Design) MSS theory is an acceptable but conservative predictor of failure; and since engineers are conservative by nature, it is quite often used.
Más detallesA limit theorem for random games
A limit theorem for random games María José González joint work with: F. Durango, J.L. Fernández, P. Fernández Warsaw 2017 Game Game with 2 players: α and β. Each of them alternately move R (right) or
Más detallesOPTIMIZACIÓN TRATAMIENTO ANTI-EGFR. Ruth Vera Oncología Médica
OPTIMIZACIÓN TRATAMIENTO ANTI-EGFR Ruth Vera Oncología Médica OPTIMIZACIÓN TRATAMIENTO anti-egfr OPTIMIZAR quiere decir: Buscar los mejores resultados Planificar una actividad para obtener los mejores
Más detallesTEMARIO DEL CURSO DE FUNDAMENTOS DE DISPOSITIVOS ELECTRONICOS 1. Introducción a Física Electrónica. 2. Uniones
TEMARIO DEL CURSO DE FUNDAMENTOS DE DISPOSITIVOS ELECTRONICOS 1. Introducción a Física Electrónica 1.1 Propiedades de cristales y crecimiento de semiconductores 1.2 Átomos y electrones 1.3 Bandas de energía
Más detallesDesarrollo de recursos para estudios genómicos en cítricos: creación de una colección de ESTs y una micromatriz de cdna
Desarrollo de recursos para estudios genómicos en cítricos: creación de una colección de ETs y una micromatriz de cdna Proyecto de Genómica Funcional de Cítricos Instituto de Agroquímica y Tecnología de
Más detallesBystander effect. Amy Lozano White Radiology and physical medicine Year 4 of Medicine Studies
Bystander effect Amy Lozano White Radiology and physical medicine Year 4 of Medicine Studies Key points Concept Historical evolution Paradigm change Mechanisms Its implications in radiological protection
Más detallesSelecting Books for Children Up To Age - : In Response to Psychological vs. Morphological Development
Selecting Books for Children Up To Age - : In Response to Psychological vs. Morphological Development Yasuko Shirasu Many guidebooks and booklists are available in Japan for those who are interested in
Más detallesGRADE 3 MCCSC VOCABULARY. Marking Period 3
Identity Property: In addition, any number added to zero equals that number. Example: 8 + 0 = 8 In multiplication, any number multiplied by one equals that number. Example: 8 x 1 = 8 Propiedad de Identidad:
Más detallesEXERCISES. product of one of them by the square of the other takes a maximum value.
EXERCISES EXERCISE 1 If f : R R is defined by f(x) = e x (x 2), a) Find the asymptotes of f. b) Find where f is increasing or decreasing and the local maxima or minima. c) Find the inflection points of
Más detallesPráctica 4 vgaribay PRÁCTICA 4. CONTRASTE DE HIPOTESIS. 1 ESTUDIO DE NORMALIDAD Plot de normalidad. Camino 1
PRÁCTICA 4. CONTRASTE DE HIPOTESIS OBJETIVOS: Estudiar el plot de normalidad Manejar los módulos de contrastes de hipótesis. Obtener las probabilidades de error de tipo I y II, la función de potencia y
Más detallesMarcadores. útiles en el diagnóstico/ pronóstico del cancer prostático. Biopsia de aguja en próstata. Curso corto. Congreso Nacional de la S.E.A.P.
Marcadores Inmunohistoquímicos / Moleculares útiles en el diagnóstico/ pronóstico del cancer prostático Biopsia de aguja en próstata. Curso corto. Congreso Nacional de la S.E.A.P. Madrid, 31 de Mayo 2003
Más detallesSOCIEDAD DE MASTOLOGIA 6 DE MAYO 2010 ONCOTYPE DX. Dr. Francisco Domínguez
SOCIEDAD DE MASTOLOGIA 6 DE MAYO 2010 ONCOTYPE DX Dr. Francisco Domínguez Departamento de Cirugía Oncológica Facultad de Medicina Pontificia Universidad Católica de Chile Conceptos generales Diagnóstico
Más detallesEl Instituto Nacional de Bioinformatica: una plataforma tecnológica al servicio de la comunidad científica. Joaquín Dopazo
El Instituto Nacional de Bioinformatica: una plataforma tecnológica al servicio de la comunidad científica Joaquín Dopazo Department of Bioinformatics, Centro de Investigación Príncipe Felipe, and Functional
Más detallesInvestigación traslacional en vías de transducción. Miguel Quintela-Fandino, MD, PhD, M.Sc. 26 de octubre de 2012 Simposio SEOM
Investigación traslacional en vías de transducción Miguel Quintela-Fandino, MD, PhD, M.Sc. 26 de octubre de 2012 Simposio SEOM Guión Porqué éinvestigar en señalización ñli ió en clínica Retos de muestreo
Más detallesJornada Actualización Cáncer de Mama y Trabajo. Donostia, 3 junio 2016 Palacio Miramar. Anatomía Patológica. Ricardo Rezola Solaun Sº Patología
Jornada Actualización Cáncer de Mama y Trabajo Donostia, 3 junio 2016 Palacio Miramar Anatomía Patológica Ricardo Rezola Solaun Sº Patología Década 80-2000 Década 00-2010 Década actual Diagnóstico Citología
Más detallesWeb appendix 2: Additional results
Web appendix 2: Additional results Web appendix 2: Additional results Content External adjudication of events per outcome... 2 Model fit... 3 Between trial heterogeneity τ 2... 3 Inconsistency... 4 Association
Más detallesGRADE 3 MCCSC VOCABULARY. Marking Period 1 & 2
product: the result when two numbers are multiplied. Example: 5 x 4 = 20 and 20 is the product. Producto: Es el resultado cuando dos números se multiplican. Ejemplo: 5 x 4 = 20 y 20 es el producto Partitioning:
Más detallesDispositivo totalmente implantable Esteem en el tratamiento de la hipoacusia neurosensorial
Dispositivo totalmente implantable Esteem en el tratamiento de la hipoacusia neurosensorial Revisión sistemática Esteem totally implantable hearing device for treatment of sensorineural hearing loss. Systematic
Más detallesCarcinomas renales híbridos
Carcinomas renales híbridos La próxima frontera Dr. José I. López Servicio de Anatomía Patológica Hospital de Cruces-Osakidetza Universidad del País Vasco (UPV/EHU) Conferencia pronunciada en el Hospital
Más detallesESTUDIO DE GMI. ESTUDIO PROTEÓMICO COMPARATIVO ENTRE LOS IMPLANTES DENTALES DE GMI Y DE STRAUMANN
ESTUDIO DE GMI. ESTUDIO PROTEÓMICO COMPARATIVO ENTRE LOS IMPLANTES DENTALES DE GMI Y DE STRAUMANN 2 Hipótesis. Estudio proteómico de la primera capa de proteínas depositada Después de la implantación:
Más detallesIn December, the number of property transfers registered is 124,616 properties, that is, 9.2% more than in the same month of 2013
10 February 2015 Statistics on Transfer of Property Rights (STPR) December 2014 and Year 2014. Provisional data In December, the number of property transfers registered is 124,616 properties, that is,
Más detallesPROYECTO FAMILIAR: SUDODDKU PROYECTO FAMILIAR. UCI Math CEO Meeting 4 (FEBRUARY 8, 2017) Estimado estudiante,
Family project PROYECTO FAMILIAR PROYECTO FAMILIAR: S O 9 4 5 SUOKU U 3 Estimado estudiante, por favor completa esta actividad y tra tu respuesta el miércoles 15 de febrero. Podrás participar en rifas!
Más detallesPreguntas Capítulo Entero. 3. Crear un ejemplo debiendo dinero para comparar dos números negativos.
Preguntas Capítulo Entero 1. Qué es un número entero? 2. Explique lo que representa el valor absoluto. 3. Crear un ejemplo debiendo dinero para comparar dos números negativos. 4. Explicar cómo se puede
Más detallesColor, Shape, and Number Patterns
Unit 7 Color, Shape, and Number Patterns Common Core Mathematical Practices (MP) Domains Operations and Algebraic Thinking (OA) Number and Operations in Base Ten (NBT) Measurement and Data (MD) INVESTIG
Más detallesGrado 3 Vocabulario/ Representación Vocabulario Descripción Representación
Grado 3 Vocabulario/ Representación Vocabulario Descripción Representación Valor posicional El valor numérico de un dígito en virtud de su posición en un número. Miles Centenas Decenas Unidades 0000 0000
Más detallesIE12_ CONSOLIDACIÓN Y DESARROLLO DE NUEVAS TÉCNICAS DE EVALUACIÓN INTENSIVAS ON-LINE YA IMPLEMENTADAS POR EL GIE E4
IE12_13-03001 - CONSOLIDACIÓN Y DESARROLLO DE NUEVAS TÉCNICAS DE EVALUACIÓN Departamento de Estructuras de la Edificación Escuela Técnica Superior de Arquitectura de Madrid Universidad Politécnica de Madrid
Más detallesBIOLOGIA TUMORAL CURSO DE ONCOLOGIA MOLECULAR. Dr. José Mordoh. Oncología Molecular, 2011
BIOLOGIA TUMORAL CURSO DE ONCOLOGIA MOLECULAR Dr. José Mordoh. Oncología Molecular, 2011 Orquesta. Bruno Brudovic EL TUMOR SE COMPORTA COMO UN ORGANISMO AUTONOMO LOCURA, de Francis Hammond Proliferación
Más detallesRELACIÓN ENTRE LOS NIVELES DE CREATINA CINASA MB Y TROPONINA I CON EL ESTADIO DE ENFERMEDAD RENAL CRÓNICA, CIUDAD HOSPITALARIA DR. ENRIQUE TEJERA.
RELACIÓN ENTRE LOS NIVELES DE CREATINA CINASA MB Y TROPONINA I CON EL ESTADIO DE ENFERMEDAD RENAL CRÓNICA, CIUDAD HOSPITALARIA DR. ENRIQUE TEJERA. ENERO-MAYO 2015 ii UNIVERSIDAD DE CARABOBO FACULTAD DE
Más detallesMECANISMOS MOLECULARES DE LA RECONSOLIDACIÓN Y LA EXTINCIÓN
MECANISMOS MOLECULARES DE LA RECONSOLIDACIÓN Y LA EXTINCIÓN Consolidación celular / molecular y consolidación sistémica Activación y reactivación de la memoria Reconsolidación Extinción en memorias asociativas
Más detallesDra. Dolores Corella Catedrática de Medicina Preventiva Universidad de València
Diseño de estudios epidemiológicos, bioinformática, análisis ómicos e integración de ómicas para su aplicación en proyectos relacionados con la alimentación y la salud en general o sobre patologías específicas.
Más detallesUNIT 9.- INTRODUCTION TO HYPOTHESIS TESTING.
STATISTICAL METHODS FOR BUSINESS UNIT 9.- INTRODUCTION TO HYPOTHESIS TESTING. 9.1.- Basics of statistical hypothesis testing. 9.2.- Types of errors in hypothesis testing. 9.3.- Methodology and implementation
Más detalles[RHSA-2018: ] Important: libvirt security update
[RHSA-2018:3407-01] Important: libvirt security update Article URL www.securityhome.eu/mailings/mailing.php?mid=14754 Author SecurityHome.eu Published: 30 October 2018 -----BEGIN PGP SIGNED MESSAGE-----
Más detallesDwelling Unit Commencements
Dwelling Units Commencements - Australia Key Points: Total seasonally adjusted dwelling unit commencements Australia-wide decreased by 5 per cent during the December 2017 quarter to be 8.3 per cent lower
Más detallesFloridablanca, Colombia.
22 Floridablanca, Colombia. El síndrome metabólico afecta alrededor de 25% a 45% de la población colombiana de acuerdo con los criterios diagnósticos propuestos por la Federación Internacional de Diabetes,
Más detallesEstudio en vivo de la invasión de células vivas de arroz por el hongo Magnaporthe oryzae, el tizón del arroz
Estudio en vivo de la invasión de células vivas de arroz por el hongo Magnaporthe oryzae, el tizón del arroz Martha C. Giraldo Z Barbara Valent Laboratorio Kansas State University CIAT Febrero 18, 2011
Más detallesUNIT 2 DIVISIBILITY 1.- MULTIPLES AND FACTORS Concept of multiple Concept of factor
UNIT 2 DIVISIBILITY 1.- MULTIPLES AND FACTORS 1.1.- Concept of multiple We say that a number a is a multiple of another number b if the division a : b is an exact division, that is, if b contains a a whole
Más detallesANGELA CAMILA YÁÑEZ SALGADO CIRUJANO DENTISTA
RELACIÓN ENTRE CONSUMO DE CARBOHIDRATOS SIMPLES Y POTENCIAL CARIOGÉNICO DIETÉTICO EN PACIENTES DE 7 A 10 AÑOS, CENTRO DE CLÍNICAS ODONTÓLOGICAS, UNIVERSIDAD DE TALCA ANGELA CAMILA YÁÑEZ SALGADO CIRUJANO
Más detallesSuperlative Adjectives/Adjetivos Superlativos
Superlative Adjectives/Adjetivos Superlativos Área Lectura y Escritura, Inglés Resultados de aprendizaje Conocer el uso de los adjetivos superlativos en contextos de escritura formal. Contenidos Debo saber
Más detallesMortgage Statistics (M) December 2017 and Year Provisional data
28 February 2018 Mortgage Statistics (M) December 2017 and Year 2017. Provisional data The total number of mortgages constituted on dwellings recorded in the land registries stands at 20,681 in December,
Más detallesRadionecrosis vs recidiva Tumoral: que hacer?
Radionecrosis vs recidiva Tumoral: que hacer? Jorge A. Villanúa, Esther Fernández, Jose A. Larrea, Edurne Pardo, Javier Masso Grupo Neuroradiológico-Unidad Donostia-Osatek SA-Unidad Neuro Rx-H. Donostia
Más detallesToday's Agenda: 1. Review atoms. 2. Learn about types of matter. 3. Learn about properties of matter.
Today's Agenda: 1. Review atoms. 2. Learn about types of matter. 3. Learn about properties of matter. Agenda de hoy: 1. Revise los átomos. 2. Aprender sobre los tipos de materia. 3. Conozca las propiedades
Más detallesSegunda Parte: El camino de vuelta
Segunda Parte: El camino de vuelta Del núcleo a la sinapsis Cómo llegan las macromoléculas a las sinapsis específicas? Hipótesis para explicar la especificidad sináptica Synaptic Tagging New gene products
Más detallesSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Martín M, Seguí MA, Antón A, et al. Adjuvant docetaxel for
Más detallesDr. CARLOS RENCORET DEL VALLE Oncología Mamaria Ginecología y Obstetricia ONCOISA - Centro Oncológico Integral de Santiago Clínica PLUSMEDICA
Dr. CARLOS RENCORET DEL VALLE Oncología Mamaria Ginecología y Obstetricia ONCOISA - Centro Oncológico Integral de Santiago Clínica PLUSMEDICA Sociedad Chilena de Mastología ases del análisis por microarrays
Más detallesBiología General: Macromoléculas biológicas. Prof. Bernal Gerardo Garro Mora
Biología General: Macromoléculas biológicas Prof. Bernal Gerardo Garro Mora Objetivos: Al finalizar la clase el estudiante será capaz de: Definir a las moléculas orgánicas y los principales grupos funcionales
Más detallesMortgage Statistics (M) March Provisional data
30 May 2017 Mortgage Statistics (M) March 2017. Provisional data The total number of mortgages constituted on dwellings recorded in the land registries stands at 27,720 in March, 20.2% higher than in the
Más detallesCONSEJERÍA DE SALUD Y BIENESTAR SOCIAL
CONSEJERÍA DE SALUD Y BIENESTAR SOCIAL AGENCIA DE EVALUACIÓN DE TECNOLOGÍAS SANITARIAS DE ANDALUCÍA (AETSA) Terapias biológicas en el tratamiento de la anemia asociada a insuficiencia renal crónica: eficacia
Más detalles74 Prime Time. conjetura Suposición acerca de un patrón o relación, basada en observaciones.
A abundant number A number for which the sum of all its proper factors is greater than the number itself. For example, 24 is an abundant number because its proper factors, 1, 2, 3, 4, 6, 8, and 12, add
Más detallesAppendix B. State and County Alzheimer s Disease Prevalence Estimates. california alzheimer s disease data report
Appendix B State and County Alzheimer s Disease Prevalence Estimates 45 Table B1: Estimated Number and Percent Change in People 55+ with Alzheimer s Disease: 2008, 2015 and 2030, California and Counties
Más detallesComputer Science. Support Guide First Term Fourth Grade. Agustiniano Ciudad Salitre School. Designed by Mary Luz Roa M.
2018 Computer Science Support Guide First Term Fourth Grade Designed by Mary Luz Roa M. Agustiniano Ciudad Salitre School PLANEACION PRIMER PERIODO UNIDAD TEMATICA: GENERALIDADES DE POWER POINT Y USO RESPONSABLE
Más detallesCurso de actualización en biología celular y molecular Drogas con múltiples sitios de acción molecular Dr Carlos Garcia Gerardi
Curso de actualización en biología celular y molecular Drogas con múltiples sitios de acción molecular Dr Carlos Garcia Gerardi Drogas con múltiples sitios de acción molecular Esta presentación no presenta
Más detallesPreview Teacher Packet. Provide one copy per student of Student Pages 1 thru 3. Print Edusoft Teacher Score Sheet to scan results.
Preview Teacher Packet. Provide one copy per student of Student Pages 1 thru 3. Print Edusoft Teacher Score Sheet to scan results. Administered May 2007 Objective The student is able to describe, predict,
Más detallesFactores predictivos. José Palacios. Anatomía Patológica Hospital Universitario Ramón y Cajal Madrid.
Factores predictivos en cáncer c de mama José Palacios. Anatomía Patológica Hospital Universitario Ramón y Cajal Madrid. CELLULAR TYPES IN MAMMARY GLAND Luminal epithelial CK8, 18, 19 Cadherina-E Myoepithelial
Más detallesSECTION SD. HEALTH SERVICES
SECTION SD. HEALTH SERVICES Note: Only Next-of-Kin Interviews (n=1,209). Some questions may have missing values if the section was not completed. Only n=7 observations were included in the final data sets
Más detallesEL CARCINOMA RENAL EN REVISIÓN Nuevas directrices y propuestas de la ISUP Comentario crítico
XXVI EL CARCINOMA RENAL EN REVISIÓN Nuevas directrices y propuestas de la ISUP Comentario crítico F. Algaba Unidad de Patología Universitat Autónoma de Barcelona Am J Surg Pathol Volume 29, Number 9,
Más detallesCáncer de mama metastásico ER-/HER2+ y resistencia precoz a la terapia con trastuzumab
Cáncer de mama metastásico ER-/HER2+ y resistencia precoz a la terapia con trastuzumab Eva M Ciruelos Gil Hospital Universitario 12 de Octubre, Madrid Caso clínico Paciente con cáncer de mama HER2+ y recidiva
Más detallesEstudio de la función de la variante de histona macroh2a2 en el desarrollo de la retina del pez cebra
UNIVERSIDAD ANDRÉS BELLO FACULTAD DE CIENCIAS BIOLOGICAS DOCTORADO DE BIOCIENCIAS MOLECULARES Estudio de la función de la variante de histona macroh2a2 en el desarrollo de la retina del pez cebra Tesis
Más detallesMASTER. Zootecnia y Gestión Sostenible: Ganadería Ecológica e Integrada. Inmunogenética.
Dr. Diego Llanes Dra. Ángela Moreno Dr. José Pérez de la Lastra Inmunogenética. VARIABILIDAD DE LAS MOLÉCULAS RELACIONADAS CON EL SISTEMA INMUNE. PARTE DE LA GENÉTICA EN LA QUE SE USAN ANTICUERPOS PARA
Más detallesUniversidad Científica del Sur
Universidad Científica del Sur F acuitad de Medicina Veterinaria y Zootecnia "DISTRIBUCIÓN ESPACIO TEMPORAL PARA DETERMINAR CONGLOMERADOS DE RABIA SILVESTRE EN EL PERÚ EN EL PERIODO DEL 2003-2012". Tesis
Más detallesDiscrete and Computational Geometry Jorge Urrutia Instituto de Matemáticas UNAM
Discrete and Computational Geometry Jorge Urrutia Instituto de Matemáticas UNAM Discrete and Computational Geometry Jorge Urrutia Instituto de Matemáticas UNAM Voronoi Diagrams Discrete and Computational
Más detallesHUMBERTO ARBOLEDA GRANADOS
HUMBERTO ARBOLEDA GRANADOS Nombre: HUMBERTO ARBOLEDA GRANADOS E-mail: harboledag@unal.edu.co Teléfono: 3165000 Ext. Oficina: Instituto de Genética oficina 2 Grupo de Inv.: Grupo de Neurociencias Universidad
Más detallesUNIVERSIDAD INCA GARCILASO DE LA VEGA
UNIVERSIDAD INCA GARCILASO DE LA VEGA ESCUELA DE POSGRADO MAESTRIA EN GESTION Y CONTROL GUBERNAMENTAL TRABAJO DE INVESTIGACION LA GESTION DEL TALENTO HUMANO Y EL DESEMPEÑO DE LOS TRABAJADORES DE LAS MEDIANAS
Más detallesDONOR SELECTION QUESTIONS. Corneal Transplantations from Donors with Cancer
DONOR SELECTION QUESTIONS Corneal Transplantations from Donors with Cancer Antonio LópezNavidad Department of Organ & Tissue Procurement for Transplantation & Tissue Bank Hospital de la Santa Creu i Sant
Más detallesPrevención de cáncer de mama y su relación con las actitudes y prácticas del autoexamen de mama en las usuarias de planificación familiar, Lima 2017
UNIVERSIDAD NACIONAL MAYOR DE SAN MARCOS FACULTAD DE MEDICINA ESCUELA PROFESIONAL DE OBSTETRICIA Prevención de cáncer de mama y su relación con las actitudes y prácticas del autoexamen de mama en las usuarias
Más detallesTaller de Hidrostática
Taller de Hidrostática MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Is the mass of iron greater than, less than, or equal to the mass of aluminum?
Más detallesIntroducción al test molecular DecisionDx-MELANOMA
i Introducción al test molecular DecisionDx-MELANOMA El primer test genético de pronóstico validado para pacientes con melanoma cutáneo en estadios iniciales I y II 1. Datos clínicos 2. Nuestra solución:
Más detallesSupplement of Methane and carbon dioxide emissions from 40 lakes along a north south latitudinal transect in Alaska
Supplement of Biogeosciences,, 9, http://www.biogeosciences.net//9// doi:9/bg--9--supplement Author(s). CC Attribution. License. Supplement of Methane and carbon dioxide emissions from lakes along a north
Más detallesIn September, the number of property transfers registered is 123,642 properties, that is, 1.5% less than in the same month of the previous year
11 November 2014 Statistics on Transfer of Property Rights (STPR) September 2014. Provisional data In September, the number of property transfers registered is 123,642 properties, that is, 1.5% less than
Más detallesCROSSBREEDING STUDIES IN SEVEN Artemia franciscana STRAINS FROM MÉXICO.
CROSSBREEDING STUDIES IN SEVEN Artemia franciscana STRAINS FROM MÉXICO. Castro, M.J., Castro, B.T., Castro, M.G., Malpica, S.A. & De Lara, A.R. INCO Partner 12: UAM-Xochimilco División de Ciencias Biológicas
Más detallesPatología Molecular del Cancer de Riñón. Antonio López-Beltran Córdoba
Patología Molecular del Cancer de Riñón Antonio López-Beltran Córdoba AP Clinical Services Integrated View Histopathology Cytopathology Patient Molecular Pathology Digital Microscopy Molecular Pathology
Más detallesPerfiles de expresión génica y diagnóstico/pronóstico en cáncer. Introducción 6/1/2010. Meritxell Pelicano Esqueta. Genómica y proteómica
Perfiles de expresión génica y diagnóstico/pronóstico en cáncer Meritxell Pelicano Esqueta Genómica y proteómica Curso 2009/2010 Introducción Expresión génica: Proceso por el cual los organismos transforman
Más detallesAnálisis de la coestimulación vía CD28 en células linfoides de pacientes infectados. con el virus de la Hepatitis C RESUMEN
Análisis de la coestimulación vía CD28 en células linfoides de pacientes infectados con el virus de la Hepatitis C RESUMEN La infección por el virus de la hepatitis C (VHC) afecta a más de 170 millones
Más detalles