LA HERENCIA BIOLÓGICA!

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "LA HERENCIA BIOLÓGICA!"

Transcripción

1 LA HERENCIA BIOLÓGICA!

2 Atecedentes históricos! S. XVIII-XIX! " Kolreuter (1760) y Gaertner (1820)! - Experimentos de hibridación animal y vegetal; los híbridos presentan características de un progenitor o intermedias entre ambos.! - Se creía que la herencia estaba determinada por unos líquidos paternos y maternos presentes en los gametos y que se mezclaban en el zigoto. Se tenía la idea que si los hijos se parecían más a un progenitor que al otro era porque el líquido de este era más fuerte.! " Gregor Mendel (1860) descubre los principios de la herencia.!

3 Atecedentes históricos! " 1900: Hugo de Vries (Holanda); Carl Correns (Alemania) y Eirch von Tschermack (Austria), estudiando la reproducción en las plantas redescubren los trabajos de Mendel y les dan prioridad! S. XX! " Se demuestra de diversas maneras que los principios de la herencia se cumplen también en animales " 1926: Thomas Hunt Morgan ( ), biólogo y genetista estadounidense descubrió cómo los genes se transmiten a través de los cromosomas, y confirmó así las leyes de la herencia de Gregor Mendel y sentó las bases de la genética experimental moderna.

4 CONCEPTOS BÁSICOS! " Gen: Unidad hereditaria básica que controla cada carácter en los seres vivos.! " Alelo: Cada una de las alternativas que puede tener un gen de un carácter.! " Alelo salvaje: alelo más extendido en la población.! " Alelo mutado: alelo más escaso.! " Autosoma: Cromosoma no sexual, cuando en la dotación cromosómica hay cromosomas sexuales.! " Carácter cualitativo: Es aquel que presenta dos alternativas claras.! " Carácter cuantitativo: El que tiene diferentes graduaciones entre dos valores extremos.!

5 CONCEPTOS BÁSICOS! " Genotipo: Es el conjunto de genes que contiene un organismo heredados de sus progenitores.! " Fenotipo: Es la manifestación externa del genotipo, es decir la suma de los caracteres observables en un ser vivo. Es el resultado de la interacción entre el genotipo y el medio ambiente.! " Locus: Es el lugar que ocupa cada gen a lo largo de un cromosoma.! " Homocigoto o Raza Pura: Individuo que para un gen dado tiene en cada cromosoma homólogo el mismo tipo de alelo, por ejemplo, AA o aa.! " Heterocigoto o Híbrido: Individuo que para un gen dado tiene en cada cromosoma homólogo un alelo distinto, por ejemplo, Aa.! " Herencia dominante: Herencia donde el fenotipo de los híbridos (Aa) es igual al de uno de los progenitores. Decimos entonces que el carácter (alelo) que se manifiesta es el dominante y el que no se manifiesta es el recesivo.!

6 CONCEPTOS BÁSICOS! " Herencia intermedia: Herencia donde el fenotipo de los híbridos (Aa) es intermedio entre los dos progenitores. " Codominancia: Herencia donde los híbridos (Aa) manifiestan el fenotipo de los dos progenitores. Por ejemplo, el sistema sanguíneo ABO, los alelos I A y I B originan el grupo AB.! " Herencia ligada al sexo: Herencia de los genes que se encuentran en los cromosomas sexuales. Por lo tanto, su herencia estará ligada a la determinación del sexo por los cromosomas sexuales Por ejemplo, en humanos la hemofilia y el daltonismo! " Retrocruzamiento: Llamado también cruzamiento retrógrado (backcross). Se utiliza en los casos de herencia dominante para averiguar si un individuo es híbrido o de raza pura. Consiste en cruzar al individuo problema con un individuo homocigoto recesivo.!

7 LEYES DE MENDEL!

8 LEYES DE MENDEL! Pisum sativum! " Método de cruzamiento utilizado por Mendel!

9 LEYES DE MENDEL! " 1ª LEY DE MENDEL O LEY DE LA UNIFORMIDAD DE LA 1ª GENERACIÓN FILIAL! " La descendencia de 2 variedades de raza pura (homocigota) origina una F1 híbrida que presenta uniformidad tanto fenotípica como genotípica

10 LEYES DE MENDEL! " 2ª LEY DE MENDEL O PRINCIPIO DE SEGREGACIÓN DE LOS ALELOS.! " Cada uno de los alelos se separa y distribuye en los gametos de manera independiente Amarillo! Amarillo! P! F1! 3 Amarillos : 1 Verde!

11 LEYES DE MENDEL! EXPLICACIÓN 2ª LEY DE MENDEL!

12 LEYES DE MENDEL! " 3ª ley de Mendel o principio de combinación independiente! " Los diferentes caracteres mendelianos se heredan independientemente unos de otros, combinándose entre sí al azar!

13 LEYES DE MENDEL!

14

TEMA 5. MENDEL Y LOS GUISANTES

TEMA 5. MENDEL Y LOS GUISANTES TEMA 5. MENDEL Y LOS GUISANTES Gregor Mendel (1822-1884) fue un monje católico y naturalista, nacido en Heinzendorf, Austria (actualmente pertenece a la República Checa). Se le reconoce como el padre de

Más detalles

7.1.-CONCEPTOS DE GENÉTICA

7.1.-CONCEPTOS DE GENÉTICA 7.1.-CONCEPTOS DE GENÉTICA 1. GENÉTICA: Ciencia que estudia los genes o la transmisión de los caracteres hereditarios. 2. GEN: Segmento de ADN o ARN (Virus) con información para un polipéptido o para un

Más detalles

PRINCIPIOS BÁSICOS DE LA HERENCIA

PRINCIPIOS BÁSICOS DE LA HERENCIA PRINCIPIOS BÁSICOS DE LA HERENCIA HERENCIA Transmisión de información genética de progenitor a descendientes CIENCIA GENÉTICA Estudia las similitudes y variaciones genéticas, entre progenitores y descendientes

Más detalles

TEMA 3 HERENCIA Y TRANSMISIÓN DE CARACTERES COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15

TEMA 3 HERENCIA Y TRANSMISIÓN DE CARACTERES COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 TEMA 3 HERENCIA Y TRANSMISIÓN DE CARACTERES COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 OBJETIVOS DEL TEMA * Tipos de reproducción. Ventajas. Inconvenientes. * Leyes de Mendel *

Más detalles

La genética mendeliana

La genética mendeliana BIOLOGÍA 2º BACHILLERATO TEMA 12: La genética mendeliana Actividades: 1º DÍA: Conceptos generales de genética mendeliana Los trabajos de Mendel Pg 216-217 1. Define los siguientes conceptos: a) Genética

Más detalles

GENÉTICA. La Genética (del griego genno γεννώ= dar a luz) es la ciencia de los genes, la herencia y la variación de los organismos.

GENÉTICA. La Genética (del griego genno γεννώ= dar a luz) es la ciencia de los genes, la herencia y la variación de los organismos. GENÉTICA La Genética (del griego genno γεννώ= dar a luz) es la ciencia de los genes, la herencia y la variación de los organismos. La genética se subdivide en tres ramos: Clásica o mendeliana: Se preocupa

Más detalles

WVNM

WVNM GENETICA MENDELIANA http://www.youtube.com/watch?v=2uxbyb- WVNM GREGORIO MENDEL Se considera el Padre de la genética. Las bases de la genética moderna las sentó un monje austríaco, Gregor Mendel (822-884),

Más detalles

Herencia y transmisión de caracteres

Herencia y transmisión de caracteres Herencia y transmisión de caracteres Herencia, trasmisión de caracteres, reproducción y leyes de Mendel La herencia y la trasmisión de caracteres es una característica bien marcada entre los seres vivos.

Más detalles

Resumen de la clase anterior

Resumen de la clase anterior Resumen de la clase anterior Factores heredables Genética mendeliana Homocigoto Heterocigoto Genotipo Fenotipo Monohibridismo. Ley de la segregación Dihibridismo. Ley de la segregación independiente Los

Más detalles

TP: Herencia Mendeliana

TP: Herencia Mendeliana TP: Herencia Mendeliana Introducción a la biología (FHYCS - UNPSJB) Por Lic. Damián G. Gil (2009) Objetivos del TP Aplicar los mecanismos de transmisión de los caracteres hereditarios, según la leyes de

Más detalles

Conceptos de Genética

Conceptos de Genética Conceptos de Genética a) Genética: Es la ciencia que estudia la herencia biológica, tanto sus mecanismos como las leyes que la rigen. b) Genética mendeliana o mendelismo: Es una parte de la genética que

Más detalles

Herencia Mendeliana I. LECTURA DE COMPRENSION

Herencia Mendeliana I. LECTURA DE COMPRENSION Herencia Mendeliana I. LECTURA DE COMPRENSION La presente lectura contiene solo los conceptos más importantes de la unidad de Herencia Mendeliana, los cuales se resaltan en un tipo de letra distinta al

Más detalles

TEMA 3. GENÉTICA. Fenotipo = Genotipo + Influencia del Medio Ambiente

TEMA 3. GENÉTICA. Fenotipo = Genotipo + Influencia del Medio Ambiente TEMA 3. GENÉTICA 1. CONCEPTOS BÁSICOS DE GENÉTICA. Genética. Ciencia que estudia la herencia biológica, es decir, las leyes que gobiernan la transmisión de los caracteres de padres a hijos. Gen. Fragmento

Más detalles

http://history.nih.gov/exhibits/nirenberg/images/photos/01_mendel_pu.jpg Gregor Mendel (1822-1884) fue un monje católico y naturalista, nacido en Heinzendorf, Austria (actualmente pertenece a la República

Más detalles

1. CONCEPTOS FUNDAMENTALES

1. CONCEPTOS FUNDAMENTALES GENÉTICA MENDELIANA Genética mendeliana 1. Conceptos fundamentales 2. Leyes de Mendel 3. Casos Genéticos especiales 4. Teoría cromosómica 5. Pruebas para descubrir si un individuo con carácter dominante

Más detalles

Tema 3 HERENCIA DE LOS CARACTERES

Tema 3 HERENCIA DE LOS CARACTERES Tema 3 HERENCIA DE LOS CARACTERES GENÉTICA Ciencia que estudia la herencia y la variación de los seres vivos William Bateson, 1906 G. MENDEL Un poco de historia Nace en 1822 en Heinzendorf (R. Checa).

Más detalles

La herencia de los caracteres

La herencia de los caracteres Genética La herencia de los caracteres Se denomina genética a la ciencia que se encarga de estudiar la herencia de los caracteres entre padres e hijos Las leyes que rigen ese traspaso de información entre

Más detalles

UNIDAD 3 : LA TRANSMISIÓN DE LOS CARACTERES

UNIDAD 3 : LA TRANSMISIÓN DE LOS CARACTERES UNIDAD 3 : LA TRANSMISIÓN DE LOS CARACTERES 1. Los caracteres y los genes 1.1 Caracteres, genes y alelos Carácter: característica de un organismo que es heredable por sus descendientes Gen: fragmento de

Más detalles

Niveles de Organización de la Materia Genética Mendeliana

Niveles de Organización de la Materia Genética Mendeliana Niveles de Organización de la Materia Genética Mendeliana Cátedra de Biología Facultad de Ciencias Médicas UNR Los niveles de organización y el comienzo de la vida Características de los seres vivos: Están

Más detalles

LOS EXPERIMENTOS DE MENDEL

LOS EXPERIMENTOS DE MENDEL LOS EXPERIMENTOS DE MENDEL Gregor J. Mendel nació en 1822 en Austria, en 1843 entró en la orden de los Agustinos donde interesado en la genética estudió los resultados de los cruzamientos entre dos variedades

Más detalles

Tema 14: LAS LEYES DE LA HERENCIA

Tema 14: LAS LEYES DE LA HERENCIA 1.- Planteamiento experimental del Mendel 2.- Estudio de la herencia de los caracteres 3.- Las leyes de Mendel 4.- Teoría cromosómica de la herencia 5.- Genes ligados 6.- Herencia poligénica y alelismo

Más detalles

GENÉTICA genética herencia biológica

GENÉTICA genética herencia biológica GENÉTICA La genética es la parte de la biología que estudia la herencia biológica, es decir, cómo se transmiten los caracteres de generación en generación. Principales conceptos de genética mendeliana

Más detalles

1. CONCEPTOS FUNDAMENTALES

1. CONCEPTOS FUNDAMENTALES GENÉTICA MENDELIANA Genética mendeliana 1. Conceptos fundamentales 2. Leyes de Mendel 3. Casos Genéticos especiales 4. Teoría cromosómica de la herencia 5. Pruebas para descubrir si un individuo con carácter

Más detalles

GENÉTICA I. Conceptos básicos Gen: conjunto de bases nitrogenadas, que codifican para unacaracterística.

GENÉTICA I. Conceptos básicos Gen: conjunto de bases nitrogenadas, que codifican para unacaracterística. GENÉTICA I Conceptos básicos Gen: conjunto de bases nitrogenadas, que codifican para unacaracterística. Alelos: posibilidades de expresión de un gen, que puede ser dominante al enmascarar a otro, o recesivo

Más detalles

Niveles de Organización de la Materia Genética Mendeliana

Niveles de Organización de la Materia Genética Mendeliana Niveles de Organización de la Materia Genética Mendeliana Cátedra de Biología Facultad de Ciencias Médicas UNR Los niveles de organización y el comienzo de la vida Los seres vivos: Están formados por una

Más detalles

La herencia en los seres vivos

La herencia en los seres vivos La herencia en los seres vivos Texto: Marrero, C. (203). Biología 0º y º. Teórico Práctico. San José, Costa Rica: Universo. GENÉTICA Rama de las ciencias biológicas que estudia cómo los genes son transmitidos

Más detalles

Saint Gaspar College MISIONEROS DE LA PRECIOSA SANGRE

Saint Gaspar College MISIONEROS DE LA PRECIOSA SANGRE Departamento de Ciencias y Tecnología Profesor: RCD- CCG Saint Gaspar College MISIONEROS DE LA PRECIOSA SANGRE Formando Personas Integras Guía de repaso Biología III medios: Genética Mendeliana Nombre

Más detalles

LA GENETICA BASICA. Experimentos de Mendel Principios de segregación independiente y dominancia La probabilidad

LA GENETICA BASICA. Experimentos de Mendel Principios de segregación independiente y dominancia La probabilidad LA GENETICA BASICA Experimentos de Mendel Principios de segregación independiente y dominancia La probabilidad Qué es la genética? Es la rama de la biología que estudia la herencia Herencia: transmisión

Más detalles

Por qué no nacemos con cuatro ojos, por ejemplo?

Por qué no nacemos con cuatro ojos, por ejemplo? GENÉTICA Por qué no nacemos con cuatro ojos, por ejemplo? EL CANGREJO DE HEIKE Eligiendo a los descendientes por los caracteres deseados, el hombre ha modificado muchas especies, e incluso ha creado razas

Más detalles

UNIVERSIDAD NACIONAL DE LA PATAGONIA SAN JUAN BOSCO FACULTAD DE HUMANIDADES Y CIENCIAS SOCIALES

UNIVERSIDAD NACIONAL DE LA PATAGONIA SAN JUAN BOSCO FACULTAD DE HUMANIDADES Y CIENCIAS SOCIALES UNIVERSIDAD NACIONAL DE LA PATAGONIA SAN JUAN BOSCO FACULTAD DE HUMANIDADES Y CIENCIAS SOCIALES CATEDRA: INTRODUCCIÓN A LA BIOLOGÍA (L.I.G.A.) TRABAJO PRÁCTICO Nº 3: GENETICA MENDELIANA ALUMNO: FECHA:

Más detalles

Genética Básica RODOLFO RUIZ POSADA ZOOTECNISTA

Genética Básica RODOLFO RUIZ POSADA ZOOTECNISTA Genética Básica RODOLFO RUIZ POSADA ZOOTECNISTA FENOTIPO= GENOTIPO + AMBIENTE GENETICA Y AMBIENTE AMBIENTE Importancia de la mejora Productiva Producción Animal = herencia + ambiente = + COMPORTAMIENTO

Más detalles

LA HERENCIA CUALITATIVA ó MENDELIANA

LA HERENCIA CUALITATIVA ó MENDELIANA LA HERENCIA CUALITATIVA ó MENDELIANA COMO ACTÚAN LOS GENES Algunos genes están asociados a una sola característica Hay característica que están asociadas a varios genes Pero también genes que están asociados

Más detalles

Genética I. 2ª Parte: Cruces dihíbridos y ligamiento de genes. Tema 6 de Biología NS Diploma BI Curso

Genética I. 2ª Parte: Cruces dihíbridos y ligamiento de genes. Tema 6 de Biología NS Diploma BI Curso Genética I 2ª Parte: Cruces dihíbridos y ligamiento de genes Tema 6 de Biología NS Diploma BI Curso 2012-2014 Antes de comenzar Pregunta guía Por qué no se cumple siempre la proporción 9:3:3:1 en un cruce

Más detalles

LA OBRA DE MENDEL SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE

LA OBRA DE MENDEL SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE LA OBRA DE MENDEL SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE Mendel era un monje austríaco que empezó en 1857 a seleccionar material para ver cómo se transmitían los caracteres, y en 1865 publicó sus experiencias

Más detalles

TERMINOLOGÍA EN GENÉTICA MENDELIANA. Carácter hereditario- característica transmisible a la descedencia (morfológica fisiológica, estructural ).

TERMINOLOGÍA EN GENÉTICA MENDELIANA. Carácter hereditario- característica transmisible a la descedencia (morfológica fisiológica, estructural ). TERMINOLOGÍA EN GENÉTICA MENDELIANA Carácter hereditario- característica transmisible a la descedencia (morfológica fisiológica, estructural ). Gen- fragmento de ADN con información para la síntesis de

Más detalles

GENÉTICA II. Cómo transmitimos características a nuestra descendencia?

GENÉTICA II. Cómo transmitimos características a nuestra descendencia? Cómo transmitimos características a nuestra descendencia? GENÉTICA II PRUEBA DE SELECCIÓN UNIVERSITARIA CIENCIAS: BIOLOGÍA Profesora: Daniela del Pilar Marchant Cantillana dmarchantcan@veterinaria.uchile.cl

Más detalles

63.1 Introducción. No son fenómenos aleatorios Leyes basadas en el análisis de principios estadísticos.

63.1 Introducción. No son fenómenos aleatorios Leyes basadas en el análisis de principios estadísticos. 63.1 INTRODUCCIÓN 63.1 Introducción Genética Griego gen=llegar a ser, convertirse. Ciencia que estudia la herencia de caracteres biológicos. Explicar la herencia de: La unidad = semejanza entre descendientes

Más detalles

GREGOR JOHANN MENDEL

GREGOR JOHANN MENDEL GREGOR JOHANN MENDEL 1822-1884. Austria. Niñez marcada por la pobreza y las penurias. Monje agustino del Siglo XIX doctorado en matemáticas y ciencias. PADRE DE LA GENÉTICA porque fue el primer investigador

Más detalles

GENÉTICA Mendel Hugo de Vries identificación de los cromosomas como los portadores de la herencia.

GENÉTICA Mendel Hugo de Vries identificación de los cromosomas como los portadores de la herencia. GENÉTICA Los trabajos de Mendel fueron redescubiertos en Europa en 1900 por Hugo de Vries y otros científicos y atrajeron una gran atención en todo el mundo, estimulando muchos estudios de investigadores

Más detalles

SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE

SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE La obra de Mendel SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE Antiguamente se creía que descendencia surgía de unión arbitraria de factores; otros postuban que descendencia era una mezc de los caracteres

Más detalles

MODULO 3 Tema 13: Genética

MODULO 3 Tema 13: Genética MODULO 3 Tema 13: Genética Genética y herencia. Los experimentos y las leyes de Mendel. Concepto de genotipo, fenotipo, dominancia y recesividad.. Teoría a cromosómica mica de la herencia. Concepto de

Más detalles

4. Genética Mendeliana

4. Genética Mendeliana 4. Genética Mendeliana 4. Genética mendeliana 4.1 Leyes de Mendel 4.2 Interacciones génicas 4.4 Método mendeliano 4.4 Genealogías 4.5 Cálculo de probabilidad 4.6 Método CHI Cuadrado Introducción La información

Más detalles

Cátedra de Genética de la Facultad de Agronomía y Zootecnia UNT. SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE

Cátedra de Genética de la Facultad de Agronomía y Zootecnia UNT. SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE La obra de Mendel SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE Antiguamente se creía que descendencia surgía de unión arbitraria de factores; otros postuban que descendencia era una mezc de los caracteres

Más detalles

Cátedra de Biología Facultad de Ciencias Médicas - UNRosario Genética Mendeliana. Autor: Silva, Patricia

Cátedra de Biología Facultad de Ciencias Médicas - UNRosario Genética Mendeliana. Autor: Silva, Patricia Cátedra de Biología Facultad de Ciencias Médicas - UNRosario Genética Mendeliana Autor: Silva, Patricia Genética Mendeliana Antecedentes Históricos s. XVIII - XIX: Durante este tiempo se hacen numerosos

Más detalles

Pregunta PSU, Demre Modelo de admisión 2018

Pregunta PSU, Demre Modelo de admisión 2018 Pregunta PSU, Demre Modelo de admisión 2018 La ley de la segregación de los caracteres de Mendel es una ley porque A) debe ser sometida a prueba cada vez que se hagan cruzamientos entre individuos que

Más detalles

Gregor Johann Mendel. Redescubrimiento de Mendel

Gregor Johann Mendel. Redescubrimiento de Mendel Gregor Johann Mendel austrìaco Experimentó jardìn Siguió Cont abilizó generación Anali zó Utilizó matemáticas Biologí a Manejó presentó Redescubrimiento de Mendel Entre 1866 y 1900 Se descubren los cromosomas.

Más detalles

Genética Mendeliana. Las leyes de la herencia

Genética Mendeliana. Las leyes de la herencia Genética Mendeliana. Las leyes de la herencia Gregor Mendel, 1860 Monasterio de Sto. Tomás, Rep. Checa Los Experimentos de Gregor Mendel (1865) Material experimental: Semillas de plantas de chícharo (Pisum

Más detalles

SELECCIÓN ARTIFICIAL DE RAZAS DE PERROS Y DE TRIGO

SELECCIÓN ARTIFICIAL DE RAZAS DE PERROS Y DE TRIGO SELECCIÓN ARTIFICIAL DE RAZAS DE PERROS Y DE TRIGO SELECCIÓN ARTIFICIAL A PARTIR DE LA MOSTAZA SILVESTRE Mostaza silvestre Berza Col rábano Repollo Col rizada EL CANGREJO DE HEIKE Eligiendo a los descendientes

Más detalles

TEMA 14. LAS LEYES DE LA HERENCIA

TEMA 14. LAS LEYES DE LA HERENCIA TEMA 14. LAS LEYES DE LA HERENCIA MENDEL Y LOS GUISANTES Gregor Mendel (1822-1884) fue un monje católico y naturalista, nacido en Heinzendorf, Austria (actualmente pertenece a la República Checa). Se le

Más detalles

LA GENÉTICA FORMAL O MENDELIANA

LA GENÉTICA FORMAL O MENDELIANA LA GENÉTICA FORMAL O MENDELIANA MATURITA DE BIOLOGÍA 1. INTRODUCCIÓN. 2. PRIMERA LEY DE MENDEL 3. SEGUNDA LEY DE MENDEL. 4. TERCERA LEY DE MENDEL. 5. GENÉTICA HUMANA. 6. ACTIVIDADES. 1. INTRODUCCIÓN. Hablar

Más detalles

La herencia de los caracteres

La herencia de los caracteres Genética La herencia de los caracteres Se denomina genética a la ciencia que se encarga de estudiar la herencia de los caracteres entre padres e hijos Las leyes que rigen ese traspaso de información entre

Más detalles

Guía para el docente

Guía para el docente Guía para el docente Descripción curricular: - Nivel: 2.º Medio - Subsector: Ciencias biológicas - Unidad temática: - Palabras claves: recesivo, dominante, experimentos de Mendel, variación, herencia,

Más detalles

Genética y Herencia. Experimentos de Gregor Mendel. Experimentos de Gregor Mendel cont. Experimentos de Gregor Mendel cont.

Genética y Herencia. Experimentos de Gregor Mendel. Experimentos de Gregor Mendel cont. Experimentos de Gregor Mendel cont. Genética y Herencia La herencia genética es la transmisión de las características de los padres a sus hijos. Este proceso mantiene generalmente unos patrones de funcionamiento que hacen posible el hacer

Más detalles

GENÉTICA DE LA TRANSMISIÓN

GENÉTICA DE LA TRANSMISIÓN GENÉTICA DE LA TRANSMISIÓN TEMA 5. MENDELISMO. Principios mendelianos aplicados a los animales domésticos. Polihibridismo. Teoría cromosómica de la herencia. Herencia mendeliana en los animales domésticos.

Más detalles

BASES CROMOSÓMICAS DE LA HERENCIA SESIÓN 9

BASES CROMOSÓMICAS DE LA HERENCIA SESIÓN 9 Biología BASES CROMOSÓMICAS DE LA HERENCIA SESIÓN 9 Si observamos cualquier tipo de población biológica, observaremos que a pesar de las apreciables similitudes entre un individuo y otro, no hay dos que

Más detalles

Tema 8. Genética Mendeliana

Tema 8. Genética Mendeliana Tema 8. Genética Mendeliana Jorge Muñoz Aranda Profesor de Biología Aula de Milagro Experimentos de Mendel -Monje Austriaco -Experimentos de hibridación en guisantes (Pisum sativum), publicados en 1866

Más detalles

Leyes de Mendel y sus aplicaciones

Leyes de Mendel y sus aplicaciones Leyes de Mendel y sus aplicaciones Genética Mendeliana. Las leyes de la herencia Gregorio Mendel, 1860 Monasterio de Sto. Tomás, Rep. Checa Mendel estudió varias características fenotípicas de la planta

Más detalles

Gen. Locus. El lugar donde se localiza el gen en el cromosoma.

Gen. Locus. El lugar donde se localiza el gen en el cromosoma. GENÉTICA MENDELIANA Griffiths A., Wessler S., Lewontin R., Gelbart W., Suzuki D., Miller J. (2005) Introduction to Genetic Analysis (8 th ed). W.H. Freeman and Company, New York. (también ediciones recientes)

Más detalles

Qué es la genética? Hoy en día, la genética es una de las áreas más activas de la investigación científica.

Qué es la genética? Hoy en día, la genética es una de las áreas más activas de la investigación científica. La Genética Básica Qué es la genética? Una característica que un ser viviente puede transmitir a su progenie es una característica hereditaria. La transmisión de las características de padres a hijos es

Más detalles

Herencia. Br. Angel E. Hernandez C.

Herencia. Br. Angel E. Hernandez C. Herencia Br. Angel E. Hernandez C. Genética Ciencia que estudia la herencia y la variabilidad. Estudia: - Los caracteres hereditarios y la forma en que se transmiten de generación a generación. - Las semejanzas

Más detalles

Tema 4. La transmisión de los caracteres hereditarios

Tema 4. La transmisión de los caracteres hereditarios Tema 4. La transmisión de los caracteres hereditarios Si consideramos cualquier especie, por ejemplo la especie humana, nuestros hijos no son exactamente iguales a nosotros, pero se nos parecen. Este fenómeno

Más detalles

Genética mendeliana. Año Año Sin preguntas. Año Sin preguntas. Año Año 2005

Genética mendeliana. Año Año Sin preguntas. Año Sin preguntas. Año Año 2005 Año 2001 En Drosophila (la mosca del vinagre) los genes que determinan el color del cuerpo y el tamaño de las alas van en el mismo cromosoma. Consideremos una hembra heterocigótica para ambas características,

Más detalles

Genetica. Estudio de la Herencia

Genetica. Estudio de la Herencia Genetica Estudio de la Herencia Introduccion Herencia: la transmision de los rasgos y caracteres de los padres a sus hijos. Genetica: rama de la biologia que estudia las leyes de la herencia. Genetica

Más detalles

Áreas principales de la genética

Áreas principales de la genética El genoma 3 Áreas principales de la genética Genética clásica: transmisión y localización de los genes en los cromosomas Genética molecular: la estructura y el control de la expresión del material genético

Más detalles

Capítulo 12. En el jardín de un monasterio: el comienzo de la

Capítulo 12. En el jardín de un monasterio: el comienzo de la 1 de 8 04/07/2010 01:44 p.m. Capítulo 12. En el jardín de un monasterio: el comienzo de la genética Las nociones más tempranas acerca de la herencia biológica giraban alrededor de la inquietud de conocer

Más detalles

GENÉTICA DE POBLAC A IONE N S

GENÉTICA DE POBLAC A IONE N S GENÉTICA DE POBLACIONES Genética de Poblaciones Es el estudio de los GENES en las poblaciones Estudia la constitución genética de los individuos que la componen y la transmisión de los genes de una generación

Más detalles

Unidad: Genética GUÍA: Conceptos de genética y ejercicios de monohibridismo Curso: Segundo Medio

Unidad: Genética GUÍA: Conceptos de genética y ejercicios de monohibridismo Curso: Segundo Medio Unidad: Genética GUÍA: Conceptos de genética y ejercicios de monohibridismo Curso: Segundo Medio Nombre: Existen unos conceptos fundamentales en Genética que permiten la adecuada comprensión de los mecanismos

Más detalles

LA HERENCIA BIOLÓGICA

LA HERENCIA BIOLÓGICA LA HERENCIA BIOLÓGICA LOS CROMOSOMAS Todas las células tienen el material genético en forma de ADN.(Acido desoxirribonucleico) El ADN es la molécula química donde se localiza la información de la célula.

Más detalles

2.GENÉTICA MENDELIANA CONTENIDOS

2.GENÉTICA MENDELIANA CONTENIDOS 2.GENÉTICA MENDELIANA CONTENIDOS 2. 2.1. Conceptos básicos de la herencia biológica. 2.1.1. Genotipo y fenotipo. 2.2. Aportaciones de Mendel al estudio de la herencia. 2.2.1. Leyes de Mendel. Cruzamiento

Más detalles

IES JOAQUÍN TURINA. PROBLEMAS GENÉTICA DE SELECTIVIDAD RESUELTOS

IES JOAQUÍN TURINA. PROBLEMAS GENÉTICA DE SELECTIVIDAD RESUELTOS IES JOAQUÍN TURINA. PROBLEMAS GENÉTICA DE SELECTIVIDAD RESUELTOS 1. El cabello oscuro (O) en el hombre es dominante sobre el cabello rojo (o) y el color pardo de los ojos (P) domina sobre el azul (p).

Más detalles

Tema: La Revolucion Genetica

Tema: La Revolucion Genetica Tema: La Revolucion Genetica La Genética es la rama de la Biología que estudia la herencia de los caracteres, la herencia biologica A principio del siglo XX se propuso el nombre de gen en lugar de factor

Más detalles

UNIDAD 3. LA HERENCIA BIOLÓGICA

UNIDAD 3. LA HERENCIA BIOLÓGICA UNIDAD 3. LA HERENCIA BIOLÓGICA LOS CROMOSOMAS Todas las células tienen el material genético en forma de ADN.(Acido desoxirribonucleico) El ADN es la molécula química donde se localiza la información de

Más detalles

Estudio de la relación genotipofenotipo. Bases moleculares de la percepción de sabor de la difeniltiocarbamida

Estudio de la relación genotipofenotipo. Bases moleculares de la percepción de sabor de la difeniltiocarbamida Estudio de la relación genotipofenotipo Bases moleculares de la percepción de sabor de la difeniltiocarbamida Problemas de fenotipo? Mendel y las reglas de la herencia Gregor Mendel Nació el 22 de julio

Más detalles

Tema 14: LAS LEYES DE LA HERENCIA

Tema 14: LAS LEYES DE LA HERENCIA Tema 14: LAS LEYES DE LA HERENCIA 1.- Planteamiento experimental del Mendel 2.- Estudio de la herencia de los caracteres 3.- Las leyes de Mendel 4.- Teoría cromosómica de la herencia 5.- Genes ligados

Más detalles

Genética. Qué entendemos por genética?

Genética. Qué entendemos por genética? GCCGGGTAGGGAGGCCGGTCCCGCGGGCGGGGGCGGGGCCGGCTCCGCGGCTTCTCCCGCCGCCGCCGCCGCCAAGGGGAGTTTCCAGGAAGTGGCCA TATTGGATCCATTCAGCCGCAGCCGCCCGGGCGGAGCGCGTCCCGCAGCCGGCTCATCCCCGCCGCGGCCCCGGCGTTCCCCGCAACCCGCCCGCCCG GTGCGCAGCTCGCCATGGCGGCCACCGACTTGGAACGCGTCTCGAACGCAGAGCCTGAGCCCCGGAGCCTGTCCCTGGGCGGCCATGTTGGGTTTGAC

Más detalles

Si consideramos los siguientes genotipos, cuántos y cuáles gametos se pueden obtener? Cada gen está en un cromosoma diferente. AABBCcDdee.

Si consideramos los siguientes genotipos, cuántos y cuáles gametos se pueden obtener? Cada gen está en un cromosoma diferente. AABBCcDdee. Si consideramos los siguientes genotipos, cuántos y cuáles gametos se pueden obtener? Cada gen está en un cromosoma diferente AABBCcDdee AaBbccDdEE aabbccddee Diagrama Ramificado Análisis de dos características

Más detalles

18.- Genética clásica: mendelismo y teoría cromosómica de la herencia

18.- Genética clásica: mendelismo y teoría cromosómica de la herencia Resumen de Mendel: mendelismo y teoría Cromosómica de la herencia. 1 Mendel cruzó plantas de flor violeta con plantas de flor blanca. Esta es la generación parental y son razas puras. 18.- Genética clásica:

Más detalles

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL Los seres vivos se reproducen, es decir, hacen copias de sí mismos. A partir de una sola célula similar en todas las especies, se pueden formar organismos

Más detalles

3. GENÉTICA MENDELIANA CONTENIDOS

3. GENÉTICA MENDELIANA CONTENIDOS 3. GENÉTICA MENDELIANA CONTENIDOS 3.1. Conceptos básicos de herencia biológica. 3.1.1. Genotipo y fenotipo. 3.2. Las leyes de Mendel. 3.2.1. Primera ley de Mendel. 3.2.2. Segunda ley de Mendel. 3.2.3.

Más detalles

CUESTIONES DE GENÉTICA

CUESTIONES DE GENÉTICA CUESTIONES DE GENÉTICA DEFINE. GENÉTICA 1. Defina los siguientes conceptos: genoma, gen, heterocigótico y herencia intermedia [2]. Total 2 puntos Genoma: conjunto de genes de una célula, de un individuo

Más detalles

Si dos o más genes se heredan independientemente, y cada gen controla un fenotipo diferente, cada fenotipo también se hereda independientemente.

Si dos o más genes se heredan independientemente, y cada gen controla un fenotipo diferente, cada fenotipo también se hereda independientemente. Genética de caracteres cualitativos Herencia dihíbrida Si dos o más genes se heredan independientemente, y cada gen controla un fenotipo diferente, cada fenotipo también se hereda independientemente. En

Más detalles

Qué estudia la genética? Qué importancia tiene la Genética Molecular para la arqueología?

Qué estudia la genética? Qué importancia tiene la Genética Molecular para la arqueología? Qué estudia la genética? Qué importancia tiene la Genética Molecular para la arqueología? Todos los seres vivos somos herederos de un bien fundamental, el material genético, que se transmite de generación

Más detalles

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R.

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R. República Bolivariana de Venezuela U. E. Colegio Cruz Vitale É Prof. Francisco Herrera R. LA GENÉTICA es la ciencia que estudia los genes, la herencia, la variación de los organismos. El término Genética

Más detalles

Genética mendeliana. Año Año Año Año Año 2005

Genética mendeliana. Año Año Año Año Año 2005 Año 2001 En Drosophila (la mosca del vinagre) los genes que determinan el color del cuerpo y el tamaño de las alas van en el mismo cromosoma. Consideremos una hembra heterocigótica para ambas características,

Más detalles

CUADERNO DE TAREAS TAREA # 10 DE BIOLOGÍA PROFESOR CRISTIAN MARRERO SOLANO VALOR 5% Regular (1) PORCENTAJE OBTENIDO

CUADERNO DE TAREAS TAREA # 10 DE BIOLOGÍA PROFESOR CRISTIAN MARRERO SOLANO VALOR 5% Regular (1) PORCENTAJE OBTENIDO CUADERNO DE TAREAS TAREA # 10 DE BIOLOGÍA CENTRO EDUCATIVO NOMBRE COMPLETO SECCIÓN FECHA DE ENTREGA PROFESOR CRISTIAN MARRERO SOLANO VALOR 5% GENÉTICA RUBROS A CALIFICAR 1. Reconocer términos básicos que

Más detalles

BIOLOGÍA DIVISIÓN CELULAR

BIOLOGÍA DIVISIÓN CELULAR BIOLOGÍA DIVISIÓN CELULAR Comparación de las características generales de la división celular y la formación de gametos: mitosis y meiosis El núcleo es una de las estructuras más importantes de la célula,

Más detalles

Tema 4 Ampliaciones de la Genética Mendeliana I: T ma m a 5 5 Ampliaciones de la Genética Mendeliana II: Ampliaciones de la Genética

Tema 4 Ampliaciones de la Genética Mendeliana I: T ma m a 5 5 Ampliaciones de la Genética Mendeliana II: Ampliaciones de la Genética Tema 4: Ampliaciones de la Genética Mendeliana I: Árboles genealógicos. Rasgos autosómicos recesivos. Rasgos autosómicos dominantes. Dominancia incompleta. Alelos codominantes. Alelos múltiples. Tema 5:

Más detalles

G E N É T I C A I BIOLOGIA MENCIÓN

G E N É T I C A I BIOLOGIA MENCIÓN G E N É T I C A I BIOLOGIA MENCIÓN BM-34 INTRODUCCIÓN La genética es considerada como una disciplina relativamente nueva en el campo de la Biología. Si se quisiera establecer una edad para esta ciencia

Más detalles

Resumen de la clase anterior

Resumen de la clase anterior Resumen de la clase anterior Diferencias con la herencia mendeliana LIGAMIENTO HERENCIA INTERMEDIA Y CODOMINANCIA ALELOS MULTIPLES Cuando dos o más pares de genes no alelos se encuentran en el mismo par

Más detalles

1- Cómo se denomina la segunda ley de Mendel? Enúnciala.

1- Cómo se denomina la segunda ley de Mendel? Enúnciala. BIOLOGÍA Y GEOLOGÍA UNIDAD: GENÉTICA 4ºESO Nombre: Curso: Apellidos: Grupo: 1- Cómo se denomina la segunda ley de Mendel? Enúnciala. 2- Del cruce de un progenitor humano de pelo negro y rizado (NNRr) y

Más detalles

MENDELISMO I: PRINCIPIOS DE UNIFORMIDAD Y DE SEGREGACIÓN

MENDELISMO I: PRINCIPIOS DE UNIFORMIDAD Y DE SEGREGACIÓN Capítulo 4 MENDELISMO I: PRINCIPIOS DE UNIFORMIDAD Y DE SEGREGACIÓN INTRODUCCIÓN El conocimiento del mecanismo de división celular y de la estructura del ADN ha sido de una importancia extraordinaria para

Más detalles

TEMA 13: GENÉTICA MENDELIANA

TEMA 13: GENÉTICA MENDELIANA TEMA 13: GENÉTICA MENDELIANA INDICE 1. CONCEPTOS BÁSICOS DE HERENCIA BIOLÓGICA 2. LAS LEYES DE MENDEL 2.1. Primera ley de Mendel. 2.2. Segunda ley de Mendel. 2.3. Cruzamiento prueba y retrocruzamiento.

Más detalles

Por qué tenemos parejas de cromosomas homólogos? Por qué tenemos cromátidas hermanas? Qué son los genes?

Por qué tenemos parejas de cromosomas homólogos? Por qué tenemos cromátidas hermanas? Qué son los genes? Paula Val Andreu Paula Val Andreu Por qué tenemos parejas de cromosomas homólogos? Por qué tenemos cromátidas hermanas? Cuántos genes tenemos en nuestras células que codifiquen para un mismo carácter?

Más detalles

Características físicas: como color y grosor del pelo, forma y color de los ojos, talla, peso, etc.

Características físicas: como color y grosor del pelo, forma y color de los ojos, talla, peso, etc. Eje temático: Variabilidad y herencia Contenido: Herencia Nivel: Segundo medio Herencia Un individuo pertenece a una especie determinada porque presenta rasgos que son comunes a los de esa especie y puede

Más detalles

Capítulo 12. En el jardín de un monasterio: el comienzo de la genética

Capítulo 12. En el jardín de un monasterio: el comienzo de la genética Capítulo 12. En el jardín de un monasterio: el comienzo de la genética Las nociones más tempranas acerca de la herencia biológica giraban alrededor de la inquietud de conocer cómo se transmiten las características

Más detalles

Politécnico Los Alpes GENÉTICA MENDELIANA

Politécnico Los Alpes GENÉTICA MENDELIANA Politécnico Los Alpes Guía De Estudio GENÉTICA MENDELIANA Preparado por la profesora Nathaly Devia, docente del área de Biología. Antes de iniciar el estudio de la genética Mendeliana, es necesario aclarar

Más detalles

Unidad 2: Genética y herencia

Unidad 2: Genética y herencia Unidad 2: Genética y herencia HERENCIA GENETICA VARIABILIDAD GENETICA CARACTERES ADQUIRIDOS CARACTERES HERADADOS EL NACIMIENTO DE LA GENÉTICA Los siete caracteres de Pisum sativum estudiados por Mendel

Más detalles

MONOHIBRIDOS Y DIHIBRIDOS. Cátedra de Genética FAZ UNT

MONOHIBRIDOS Y DIHIBRIDOS. Cátedra de Genética FAZ UNT MONOHIBRIDOS Y DIHIBRIDOS Mendel era un monje austríaco que empezó en 1857 a seleccionar material para ver cómo se transmitían los caracteres, y en 1865 publicó sus experiencias pero no tuvieron mayor

Más detalles

2. GENÉTICA MENDELIANA

2. GENÉTICA MENDELIANA 2. GENÉTICA MENDELIANA 2.1. Conceptos básicos de herencia biológica. 2.1.1. Genotipo y fenotipo. 2.2. Aportaciones de Mendel al estudio de la herencia Las leyes de Mendel. 2.2.1. Las leyes de Mendel 2.2.2.

Más detalles

LA EXPLICACIÓN DE LOS RESULTADOS DE MENDEL

LA EXPLICACIÓN DE LOS RESULTADOS DE MENDEL LA EXPLICACIÓN DE LOS RESULTADOS DE MENDEL Mendel desarrolló varias hipótesis para explicar sus resultados Cada característica hereditaria está bajo el control de dos factores separados, uno de cada padre.

Más detalles