Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download ""

Transcripción

1 Gregor Mendel ( ) fue un monje católico y naturalista, nacido en Heinzendorf, Austria (actualmente pertenece a la República Checa). Se le reconoce como el padre de la genética, ya que estableció los fundamentos de la genética actual. Lo hizo llevando a cabo estudios sobre la transmisión de distintos caracteres con diferentes variedades de la planta del guisante (Pisum sativum). Algunos de los caracteres que estudió fueron el color de la semilla, su textura, el color de los pétalos florales, la disposición de las flores, el color y la forma de la vaina o la longitud del tallo. La planta del guisante le resultó muy útil para sus estudios por las siguientes razones: Es una planta fácil de cultivar, que da lugar a un gran número de descendientes. Presenta autopolinización como forma de reproducción habitual. Sólo hay polinización cruzada en condiciones experimentales. Ya se conocían las razas puras, que son aquellas que producen su mismo carácter en todos sus descendientes. Las variedades que estudió (color, textura ) se diferenciaban fácilmente a simple vista. Su trabajo no fue valorado cuando lo publicó en el año Hugo de Vries, botánico holandés, junto a Carl Correns y Erich von Tschermak, redescubrieron las leyes de Mendel por separado en el año 1900.

2 Gen: fragmento de ADN que lleva información para un determinado carácter. Se encuentran alineados en los cromosomas. Carácter: información heredable sobre un aspecto concreto de un ser vivo. Dominante: carácter manifestado siempre que esté presente. Recesivo: carácter que se manifiesta en ausencia del dominante. Homocigoto: cuando los dos alelos para un carácter contienen la misma información. Heterocigoto (híbrido): cuando los dos alelos contienen distinta información. Genotipo: conjunto de genes heredados por un organismo y que se encuentran en todas sus células. Fenotipo: Genotipo + Factores ambientales. Lo que se manifiesta. Cruzamiento prueba: para determinar si un fenotipo dominante es puro o híbrido para un carácter. Cruzar con puro recesivo. Genoma: conjunto de todos los genes característicos de una especie. Locus: lugar dónde se encuentra localizado un gen. Loci: conjunto de todos los locus de un individuo Alelos: distintas alternativas para un determinado carácter. Están localizados en los cromosomas homólogos en los mismos loci. Presentan información sobre el mismo carácter. Cruzó experimentalmente la generación parental (P) de dos razas puras para un determinado carácter, que presentaban alternativas opuestas (semilla verde o amarilla). Uno de los parentales es dominante y el otro recesivo para ese carácter. Observó el fenotipo de la descendencia, llamada 1ª generación filial (F1), comparándolos con los fenotipos parentales. Sembró las semillas obtenidas en la F1 y permitió que las plantas se autopolinizasen. Obtuvo la 2ª generación filial (F2), en la que estudió el número de individuos que presentaban cada uno de los caracteres parentales.

3 Cuando se cruzan dos razas puras para un determinado carácter (ejemplo, color de la semilla), todos los descendientes de la F1 son idénticos entre sí, y además, son iguales a uno de los parentales (aquel que presente el alelo dominante para el carácter estudiado). Al autopolinizar las plantas obtenidas en la F1, se obtiene una F2 donde aparecen los caracteres del parental recesivo que habían quedado ocultos en la F1. Aparecen en una proporción 3:1

4 caracteres): Amarillo liso Mendel cruzó dos razas puras para dos caracteres determinados (color y textura de la semilla). Obtuvo una F1 en la que todos los individuos eran iguales entre sí e idénticos a uno de los padres (concretamente al dominante para ambos Obtuvo los resultados esperados, aquellos que había obtenido en sus estudios con un solo carácter. Pensó que los individuos de la F1 debían portar los alelos recesivos que habían quedado ocultos (verde y rugoso). Sembró las semillas de las plantas obtenidas en la F1 y se autopolinizaron. Obtuvo una F2 en la que aparecía cuatro razas diferente para las semillas: Amarillo-liso, amarillo rugoso, verde liso y verde rugoso, con una proporción 9:3:3:1

5 Al estudiar el dondiego de noche (Mirabilis jalapa), se obtuvieron resultados que contradecían las leyes de Mendel: Se cruzaron plantas de raza pura de flores rojas con plantas de raza pura de flores blancas. Se obtiene una F1 donde todos los descendientes presentan flores rosas. Ninguna de las dos razas domina sobre la otra, y el resultado es un carácter híbrido entre los caracteres parentales. Este tipo de herencia permite distinguir a simple vista las razas puras (flor roja o blanca) de las híbridas (rosas).

TEMA 5. MENDEL Y LOS GUISANTES

TEMA 5. MENDEL Y LOS GUISANTES TEMA 5. MENDEL Y LOS GUISANTES Gregor Mendel (1822-1884) fue un monje católico y naturalista, nacido en Heinzendorf, Austria (actualmente pertenece a la República Checa). Se le reconoce como el padre de

Más detalles

TEMA 14. LAS LEYES DE LA HERENCIA

TEMA 14. LAS LEYES DE LA HERENCIA TEMA 14. LAS LEYES DE LA HERENCIA MENDEL Y LOS GUISANTES Gregor Mendel (1822-1884) fue un monje católico y naturalista, nacido en Heinzendorf, Austria (actualmente pertenece a la República Checa). Se le

Más detalles

Conceptos de Genética

Conceptos de Genética Conceptos de Genética a) Genética: Es la ciencia que estudia la herencia biológica, tanto sus mecanismos como las leyes que la rigen. b) Genética mendeliana o mendelismo: Es una parte de la genética que

Más detalles

GENÉTICA. La Genética (del griego genno γεννώ= dar a luz) es la ciencia de los genes, la herencia y la variación de los organismos.

GENÉTICA. La Genética (del griego genno γεννώ= dar a luz) es la ciencia de los genes, la herencia y la variación de los organismos. GENÉTICA La Genética (del griego genno γεννώ= dar a luz) es la ciencia de los genes, la herencia y la variación de los organismos. La genética se subdivide en tres ramos: Clásica o mendeliana: Se preocupa

Más detalles

TEMA 3. GENÉTICA. Fenotipo = Genotipo + Influencia del Medio Ambiente

TEMA 3. GENÉTICA. Fenotipo = Genotipo + Influencia del Medio Ambiente TEMA 3. GENÉTICA 1. CONCEPTOS BÁSICOS DE GENÉTICA. Genética. Ciencia que estudia la herencia biológica, es decir, las leyes que gobiernan la transmisión de los caracteres de padres a hijos. Gen. Fragmento

Más detalles

WVNM

WVNM GENETICA MENDELIANA http://www.youtube.com/watch?v=2uxbyb- WVNM GREGORIO MENDEL Se considera el Padre de la genética. Las bases de la genética moderna las sentó un monje austríaco, Gregor Mendel (822-884),

Más detalles

LA HERENCIA BIOLÓGICA!

LA HERENCIA BIOLÓGICA! LA HERENCIA BIOLÓGICA! Atecedentes históricos! S. XVIII-XIX! " Kolreuter (1760) y Gaertner (1820)! - Experimentos de hibridación animal y vegetal; los híbridos presentan características de un progenitor

Más detalles

Tema 3 HERENCIA DE LOS CARACTERES

Tema 3 HERENCIA DE LOS CARACTERES Tema 3 HERENCIA DE LOS CARACTERES GENÉTICA Ciencia que estudia la herencia y la variación de los seres vivos William Bateson, 1906 G. MENDEL Un poco de historia Nace en 1822 en Heinzendorf (R. Checa).

Más detalles

Herencia y transmisión de caracteres

Herencia y transmisión de caracteres Herencia y transmisión de caracteres Herencia, trasmisión de caracteres, reproducción y leyes de Mendel La herencia y la trasmisión de caracteres es una característica bien marcada entre los seres vivos.

Más detalles

La herencia de los caracteres

La herencia de los caracteres Genética La herencia de los caracteres Se denomina genética a la ciencia que se encarga de estudiar la herencia de los caracteres entre padres e hijos Las leyes que rigen ese traspaso de información entre

Más detalles

GREGOR JOHANN MENDEL

GREGOR JOHANN MENDEL GREGOR JOHANN MENDEL 1822-1884. Austria. Niñez marcada por la pobreza y las penurias. Monje agustino del Siglo XIX doctorado en matemáticas y ciencias. PADRE DE LA GENÉTICA porque fue el primer investigador

Más detalles

Qué es la genética? Hoy en día, la genética es una de las áreas más activas de la investigación científica.

Qué es la genética? Hoy en día, la genética es una de las áreas más activas de la investigación científica. La Genética Básica Qué es la genética? Una característica que un ser viviente puede transmitir a su progenie es una característica hereditaria. La transmisión de las características de padres a hijos es

Más detalles

1. CONCEPTOS FUNDAMENTALES

1. CONCEPTOS FUNDAMENTALES GENÉTICA MENDELIANA Genética mendeliana 1. Conceptos fundamentales 2. Leyes de Mendel 3. Casos Genéticos especiales 4. Teoría cromosómica 5. Pruebas para descubrir si un individuo con carácter dominante

Más detalles

PRINCIPIOS BÁSICOS DE LA HERENCIA

PRINCIPIOS BÁSICOS DE LA HERENCIA PRINCIPIOS BÁSICOS DE LA HERENCIA HERENCIA Transmisión de información genética de progenitor a descendientes CIENCIA GENÉTICA Estudia las similitudes y variaciones genéticas, entre progenitores y descendientes

Más detalles

Gen. Locus. El lugar donde se localiza el gen en el cromosoma.

Gen. Locus. El lugar donde se localiza el gen en el cromosoma. GENÉTICA MENDELIANA Griffiths A., Wessler S., Lewontin R., Gelbart W., Suzuki D., Miller J. (2005) Introduction to Genetic Analysis (8 th ed). W.H. Freeman and Company, New York. (también ediciones recientes)

Más detalles

GENÉTICA I. Conceptos básicos Gen: conjunto de bases nitrogenadas, que codifican para unacaracterística.

GENÉTICA I. Conceptos básicos Gen: conjunto de bases nitrogenadas, que codifican para unacaracterística. GENÉTICA I Conceptos básicos Gen: conjunto de bases nitrogenadas, que codifican para unacaracterística. Alelos: posibilidades de expresión de un gen, que puede ser dominante al enmascarar a otro, o recesivo

Más detalles

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R.

República Bolivariana de Venezuela U. E. Colegio Cruz Vitale. Prof. Francisco Herrera R. República Bolivariana de Venezuela U. E. Colegio Cruz Vitale É Prof. Francisco Herrera R. LA GENÉTICA es la ciencia que estudia los genes, la herencia, la variación de los organismos. El término Genética

Más detalles

Genética. Qué entendemos por genética?

Genética. Qué entendemos por genética? GCCGGGTAGGGAGGCCGGTCCCGCGGGCGGGGGCGGGGCCGGCTCCGCGGCTTCTCCCGCCGCCGCCGCCGCCAAGGGGAGTTTCCAGGAAGTGGCCA TATTGGATCCATTCAGCCGCAGCCGCCCGGGCGGAGCGCGTCCCGCAGCCGGCTCATCCCCGCCGCGGCCCCGGCGTTCCCCGCAACCCGCCCGCCCG GTGCGCAGCTCGCCATGGCGGCCACCGACTTGGAACGCGTCTCGAACGCAGAGCCTGAGCCCCGGAGCCTGTCCCTGGGCGGCCATGTTGGGTTTGAC

Más detalles

FUNDACIÓNEDUCACIONAL COLEGIO DE LOS SSCC MANQUEHUE

FUNDACIÓNEDUCACIONAL COLEGIO DE LOS SSCC MANQUEHUE FUNDACIÓNEDUCACIONAL COLEGIO DE LOS SSCC MANQUEHUE Genética Clásica-Leyes de Mendel En la segunda mitad del siglo XIX un monje austríaco llamado Gregorio Mendel (1822-1884)- concibió la idea de que las

Más detalles

Saint Gaspar College MISIONEROS DE LA PRECIOSA SANGRE

Saint Gaspar College MISIONEROS DE LA PRECIOSA SANGRE Departamento de Ciencias y Tecnología Profesor: RCD- CCG Saint Gaspar College MISIONEROS DE LA PRECIOSA SANGRE Formando Personas Integras Guía de repaso Biología III medios: Genética Mendeliana Nombre

Más detalles

Pregunta PSU, Demre Modelo de admisión 2018

Pregunta PSU, Demre Modelo de admisión 2018 Pregunta PSU, Demre Modelo de admisión 2018 La ley de la segregación de los caracteres de Mendel es una ley porque A) debe ser sometida a prueba cada vez que se hagan cruzamientos entre individuos que

Más detalles

La herencia en los seres vivos

La herencia en los seres vivos La herencia en los seres vivos Texto: Marrero, C. (203). Biología 0º y º. Teórico Práctico. San José, Costa Rica: Universo. GENÉTICA Rama de las ciencias biológicas que estudia cómo los genes son transmitidos

Más detalles

DESVELANDO LOS SECRETOS DE LA VIDA

DESVELANDO LOS SECRETOS DE LA VIDA DESVELANDO LOS SECRETOS DE LA VIDA LA REVOLUCIÓN GENÉTICA PARTE I. IES LAS VIÑAS. Manilva. Susana Serradilla ÍNDICE MENDEL: la diferencia está en los genes Los guisantes y Mendel Los factores hereditarios

Más detalles

Intensivo. Técnico Profesional BIOLOGÍA. Estrategias. Programa. Genética mendeliana. Pregunta PSU. Tip. Tip. Tip. Tip. Tip

Intensivo. Técnico Profesional BIOLOGÍA. Estrategias. Programa. Genética mendeliana. Pregunta PSU. Tip. Tip. Tip. Tip. Tip Programa Técnico Profesional Intensivo Cuaderno Estrategias y Ejercitación Genética mendeliana Estrategias? PSU Pregunta PSU BIOLOGÍA 1. Para un carácter con herencia mendeliana, si se cruza un macho homocigoto

Más detalles

7.1.-CONCEPTOS DE GENÉTICA

7.1.-CONCEPTOS DE GENÉTICA 7.1.-CONCEPTOS DE GENÉTICA 1. GENÉTICA: Ciencia que estudia los genes o la transmisión de los caracteres hereditarios. 2. GEN: Segmento de ADN o ARN (Virus) con información para un polipéptido o para un

Más detalles

Genética y Herencia. Experimentos de Gregor Mendel. Experimentos de Gregor Mendel cont. Experimentos de Gregor Mendel cont.

Genética y Herencia. Experimentos de Gregor Mendel. Experimentos de Gregor Mendel cont. Experimentos de Gregor Mendel cont. Genética y Herencia La herencia genética es la transmisión de las características de los padres a sus hijos. Este proceso mantiene generalmente unos patrones de funcionamiento que hacen posible el hacer

Más detalles

Características físicas: como color y grosor del pelo, forma y color de los ojos, talla, peso, etc.

Características físicas: como color y grosor del pelo, forma y color de los ojos, talla, peso, etc. Eje temático: Variabilidad y herencia Contenido: Herencia Nivel: Segundo medio Herencia Un individuo pertenece a una especie determinada porque presenta rasgos que son comunes a los de esa especie y puede

Más detalles

GENÉTICA genética herencia biológica

GENÉTICA genética herencia biológica GENÉTICA La genética es la parte de la biología que estudia la herencia biológica, es decir, cómo se transmiten los caracteres de generación en generación. Principales conceptos de genética mendeliana

Más detalles

1. CONCEPTOS FUNDAMENTALES

1. CONCEPTOS FUNDAMENTALES GENÉTICA MENDELIANA Genética mendeliana 1. Conceptos fundamentales 2. Leyes de Mendel 3. Casos Genéticos especiales 4. Teoría cromosómica de la herencia 5. Pruebas para descubrir si un individuo con carácter

Más detalles

Genética Mendeliana. Las leyes de la herencia

Genética Mendeliana. Las leyes de la herencia Genética Mendeliana. Las leyes de la herencia Gregor Mendel, 1860 Monasterio de Sto. Tomás, Rep. Checa Los Experimentos de Gregor Mendel (1865) Material experimental: Semillas de plantas de chícharo (Pisum

Más detalles

UNIDAD 3 : LA TRANSMISIÓN DE LOS CARACTERES

UNIDAD 3 : LA TRANSMISIÓN DE LOS CARACTERES UNIDAD 3 : LA TRANSMISIÓN DE LOS CARACTERES 1. Los caracteres y los genes 1.1 Caracteres, genes y alelos Carácter: característica de un organismo que es heredable por sus descendientes Gen: fragmento de

Más detalles

LOS EXPERIMENTOS DE MENDEL

LOS EXPERIMENTOS DE MENDEL LOS EXPERIMENTOS DE MENDEL Gregor J. Mendel nació en 1822 en Austria, en 1843 entró en la orden de los Agustinos donde interesado en la genética estudió los resultados de los cruzamientos entre dos variedades

Más detalles

Gregor Mendel inició sus experimentos eligiendo dos plantas de guisantes que diferían en un carácter

Gregor Mendel inició sus experimentos eligiendo dos plantas de guisantes que diferían en un carácter Preguntas: Preguntas: GENÉTICA BÁSICA PRESENTADO POR J. MARTÍNEZ 1 1. Qué es una característica hereditaria? 2. A qué se le llama herencia? 3. Qué estudia la genética? 4. Quién fue Gregor Mendel? 5. Con

Más detalles

Herencia de Caracteres

Herencia de Caracteres INSTITUCIÓN EDUCATIVA FEDERICO SIERRA ARANGO Área: Ciencias Naturales y Educación ambiental Docente: Grado: John Jairo Pérez M Guía informativa Genética Mendeliana Fecha: Asignatura Biología INTRODUCCIÓN

Más detalles

Gregor Johann Mendel. Redescubrimiento de Mendel

Gregor Johann Mendel. Redescubrimiento de Mendel Gregor Johann Mendel austrìaco Experimentó jardìn Siguió Cont abilizó generación Anali zó Utilizó matemáticas Biologí a Manejó presentó Redescubrimiento de Mendel Entre 1866 y 1900 Se descubren los cromosomas.

Más detalles

MEDICINA Primer Cuatrimestre

MEDICINA Primer Cuatrimestre U.N.P.S.J. B. BIOLOGÍA MEDICINA Primer Cuatrimestre 2017 REPASAMOS 1. En el siguiente esquema aparecen desordenadas las fases de la meiosis. Indica qué imagen corresponde a: a. Anafase I. b. Anafase II.

Más detalles

9.- Qué significa un par de genes rr? El rasgo que no se expresa cuando está la alternativa dominante es:..

9.- Qué significa un par de genes rr? El rasgo que no se expresa cuando está la alternativa dominante es:.. Prof: Sandra Cisternas A GUIA DE GENETICA Unidad: Genética Mendeliana Curso:2ºMedio Contenidos: Monohibridismo.Trabajos de Mendel.Ejercicios. Nombre Alumno (a):.. Fecha: 10-6- 2016 1.- En drosophila Melanogaster

Más detalles

ManuelGVS Problemas de Genética

ManuelGVS Problemas de Genética ManuelGVS 2007 Problemas de Genética PROBLEMAS DE GENÉTICA Problema 1 Problema 2 Problema 3 Problema 4 Problema 5 Problema 6 Problema 7 Problema 8 Problema 9 Problema 10 Problema 11 Problema 12 Problema

Más detalles

Región codificante. eucarionte

Región codificante. eucarionte Gen La unidad hereditaria básica. Por definición molecular, una secuencia de DNA necesaria para brindar un producto funcional a la célula: proteína o RNA. Región codificante eucarionte Alelo La forma alternativa

Más detalles

LA GENETICA BASICA. Experimentos de Mendel Principios de segregación independiente y dominancia La probabilidad

LA GENETICA BASICA. Experimentos de Mendel Principios de segregación independiente y dominancia La probabilidad LA GENETICA BASICA Experimentos de Mendel Principios de segregación independiente y dominancia La probabilidad Qué es la genética? Es la rama de la biología que estudia la herencia Herencia: transmisión

Más detalles

SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE

SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE La obra de Mendel SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE Antiguamente se creía que descendencia surgía de unión arbitraria de factores; otros postuban que descendencia era una mezc de los caracteres

Más detalles

LA OBRA DE MENDEL SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE

LA OBRA DE MENDEL SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE LA OBRA DE MENDEL SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE Mendel era un monje austríaco que empezó en 1857 a seleccionar material para ver cómo se transmitían los caracteres, y en 1865 publicó sus experiencias

Más detalles

4. Genética Mendeliana

4. Genética Mendeliana 4. Genética Mendeliana 4. Genética mendeliana 4.1 Leyes de Mendel 4.2 Interacciones génicas 4.4 Método mendeliano 4.4 Genealogías 4.5 Cálculo de probabilidad 4.6 Método CHI Cuadrado Introducción La información

Más detalles

Genética Básica RODOLFO RUIZ POSADA ZOOTECNISTA

Genética Básica RODOLFO RUIZ POSADA ZOOTECNISTA Genética Básica RODOLFO RUIZ POSADA ZOOTECNISTA FENOTIPO= GENOTIPO + AMBIENTE GENETICA Y AMBIENTE AMBIENTE Importancia de la mejora Productiva Producción Animal = herencia + ambiente = + COMPORTAMIENTO

Más detalles

Genética I. 2ª Parte: Cruces dihíbridos y ligamiento de genes. Tema 6 de Biología NS Diploma BI Curso

Genética I. 2ª Parte: Cruces dihíbridos y ligamiento de genes. Tema 6 de Biología NS Diploma BI Curso Genética I 2ª Parte: Cruces dihíbridos y ligamiento de genes Tema 6 de Biología NS Diploma BI Curso 2012-2014 Antes de comenzar Pregunta guía Por qué no se cumple siempre la proporción 9:3:3:1 en un cruce

Más detalles

Cátedra de Genética de la Facultad de Agronomía y Zootecnia UNT. SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE

Cátedra de Genética de la Facultad de Agronomía y Zootecnia UNT. SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE La obra de Mendel SEGREGACIÓN Y DISTRIBUCIÓN INDEPENDIENTE Antiguamente se creía que descendencia surgía de unión arbitraria de factores; otros postuban que descendencia era una mezc de los caracteres

Más detalles

18.- Genética clásica: mendelismo y teoría cromosómica de la herencia

18.- Genética clásica: mendelismo y teoría cromosómica de la herencia Resumen de Mendel: mendelismo y teoría Cromosómica de la herencia. 1 Mendel cruzó plantas de flor violeta con plantas de flor blanca. Esta es la generación parental y son razas puras. 18.- Genética clásica:

Más detalles

GENÉTICA MENDELIANA Y DE POBLACIONES

GENÉTICA MENDELIANA Y DE POBLACIONES GENÉTICA MENDELIANA Y DE POBLACIONES John Gregory Mendel (1822-1884) Monje Austriaco que empezó a experimentar a mediados del siglo antepasado con el chícharo (Pisum sativum) y reunió sus resultados durante

Más detalles

Unidad 2: Genética y herencia

Unidad 2: Genética y herencia Unidad 2: Genética y herencia HERENCIA GENETICA VARIABILIDAD GENETICA CARACTERES ADQUIRIDOS CARACTERES HERADADOS EL NACIMIENTO DE LA GENÉTICA Los siete caracteres de Pisum sativum estudiados por Mendel

Más detalles

PRÁCTICA DE LABORATORIO Nº1. 1era LEY DE MENDEL: CRUCES MONOHIBRIDOS PROF. (A): RHAMNYELI FIGUEROA Y MARVI FRANCO

PRÁCTICA DE LABORATORIO Nº1. 1era LEY DE MENDEL: CRUCES MONOHIBRIDOS PROF. (A): RHAMNYELI FIGUEROA Y MARVI FRANCO REPÚBLICA BOLIVARIANA DE VENEZUELA MINISTERIO DEL PODER POPULAR PARA LA DEFENSA AVIACIÓN MILITAR BOLIVARIANA UNIDAD EDUCATIVA AUTONOMA MILITAR LIBERTADOR COORDINACIÓN DE BIOLOGIA Y QUIMICA PRÁCTICA DE

Más detalles

Estándar Intensivo. Ciencias Básicas Biología. Estrategias. Pregunta PSU. Tip. Tip. Tip. Tip. Tip. Programa

Estándar Intensivo. Ciencias Básicas Biología. Estrategias. Pregunta PSU. Tip. Tip. Tip. Tip. Tip. Programa 1 Ciencias Básicas Biología Programa Estándar Intensivo Cuaderno Estrategias y Ejercitación Genética mendeliana CUACES025CB81-A16V1 Estrategias? PSU Pregunta PSU 1. Para un carácter con herencia mendeliana,

Más detalles

Gregor Johan Mendel Leyes de la herencia (1865)

Gregor Johan Mendel Leyes de la herencia (1865) Gregor Johan Mendel Leyes de la herencia (1865) Modelo de estudio de Mendel Las 7 características que Mendel estudió en sus experimentos de genética Cruzas monohíbridas: Cruza recíproca Es una cruza entre

Más detalles

Si consideramos los siguientes genotipos, cuántos y cuáles gametos se pueden obtener? Cada gen está en un cromosoma diferente. AABBCcDdee.

Si consideramos los siguientes genotipos, cuántos y cuáles gametos se pueden obtener? Cada gen está en un cromosoma diferente. AABBCcDdee. Si consideramos los siguientes genotipos, cuántos y cuáles gametos se pueden obtener? Cada gen está en un cromosoma diferente AABBCcDdee AaBbccDdEE aabbccddee Diagrama Ramificado Análisis de dos características

Más detalles

LA GENÉTICA Y GREGOR MENDEL

LA GENÉTICA Y GREGOR MENDEL LA GENÉTICA Y GREGOR MENDEL Sumario Mitosis y meiosis: Código genético y síntesis de proteínas La genética y Gregor Mendel 1. Qué es la genética? 2. Los primeros experimentos de Mendel 3. La explicación

Más detalles

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL

UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL UNIDAD 5: LA REPRODUCCIÓN CELULAR. GENÉTICA TRADICIONAL Los seres vivos se reproducen, es decir, hacen copias de sí mismos. A partir de una sola célula similar en todas las especies, se pueden formar organismos

Más detalles

Genética mendeliana. I. Leyes de Mendel

Genética mendeliana. I. Leyes de Mendel Genética mendeliana Gregor Mendel fue un monje y naturalista austriaco que vivió en el siglo XIX (1822-1884). Se le considera el padre de la herencia genética, debido a que descubrió los llamados factores

Más detalles

Tercera ley de Mendel o ley de la independencia de los caracteres

Tercera ley de Mendel o ley de la independencia de los caracteres Tercera ley de Mendel o ley de la independencia de los caracteres En los dos primeros experimentos, Mendel se fijó sólo en un carácter. Posteriormente, repitió los experimentos pero fijándose en la herencia

Más detalles

Herencia Mendeliana I. LECTURA DE COMPRENSION

Herencia Mendeliana I. LECTURA DE COMPRENSION Herencia Mendeliana I. LECTURA DE COMPRENSION La presente lectura contiene solo los conceptos más importantes de la unidad de Herencia Mendeliana, los cuales se resaltan en un tipo de letra distinta al

Más detalles

Por: Wilfredo Santiago

Por: Wilfredo Santiago Por: Wilfredo Santiago Los organismos que se reproducen sexualmente, solamente dos células están envueltas en la reproducción. Una es el espermatozoide del macho y la otra es el óvulo de la hembra. Es

Más detalles

GENETICA Y PATRONES DE LA HERENCIA

GENETICA Y PATRONES DE LA HERENCIA GENETICA Y PATRONES DE LA HERENCIA Genética: Es la rama de la biología que estudia la estructura, transmisión y expresión de los genes. Herencia: Se refiere a la transmisión genética de los rasgos y caracteres

Más detalles

Problemas de genética PAU Murcia

Problemas de genética PAU Murcia Problemas de genética PAU Murcia 2004-2011 1.- En los humanos la fibrosis quística se produce por el alelo recesivo de un gen autosómico con dos alelos (A: individuos sanos; a: individuos enfermos). En

Más detalles

63.1 Introducción. No son fenómenos aleatorios Leyes basadas en el análisis de principios estadísticos.

63.1 Introducción. No son fenómenos aleatorios Leyes basadas en el análisis de principios estadísticos. 63.1 INTRODUCCIÓN 63.1 Introducción Genética Griego gen=llegar a ser, convertirse. Ciencia que estudia la herencia de caracteres biológicos. Explicar la herencia de: La unidad = semejanza entre descendientes

Más detalles

1/2 A 1/2 a 1/2 A. 1/2 a. Razón genotípica. 1/4 AA 1/2 Aa. 1/4 aa. Razón fenotípica 3/4 A- 1/4 aa

1/2 A 1/2 a 1/2 A. 1/2 a. Razón genotípica. 1/4 AA 1/2 Aa. 1/4 aa. Razón fenotípica 3/4 A- 1/4 aa 1/2 A 1/2 a 1/2 A AA Aa 1/2 a Aa aa Razón genotípica 1/4 AA 1/2 Aa 1/4 aa Razón fenotípica 3/4 A- 1/4 aa 1 Objetivos tema 2: Principios mendelianos Deberán quedar bien claros los siguientes puntos El método

Más detalles

Técnico Profesional BIOLOGÍA

Técnico Profesional BIOLOGÍA Programa Técnico Profesional BIOLOGÍA Genética mendeliana Nº Ejercicios PSU 1. Según los resultados de sus eperimentos, Mendel logró determinar los alelos dominantes y MTP recesivos para cada rasgo a través

Más detalles

LA GENÉTICA FORMAL O MENDELIANA

LA GENÉTICA FORMAL O MENDELIANA LA GENÉTICA FORMAL O MENDELIANA MATURITA DE BIOLOGÍA 1. INTRODUCCIÓN. 2. PRIMERA LEY DE MENDEL 3. SEGUNDA LEY DE MENDEL. 4. TERCERA LEY DE MENDEL. 5. GENÉTICA HUMANA. 6. ACTIVIDADES. 1. INTRODUCCIÓN. Hablar

Más detalles

UNIVERSIDAD NACIONAL DE GRAL. SAN MARTÍN ECyT BIOLOGÍA CPU. Biología. Genética Leyes de Mendel

UNIVERSIDAD NACIONAL DE GRAL. SAN MARTÍN ECyT BIOLOGÍA CPU. Biología. Genética Leyes de Mendel UNIVERSIDAD NACIONAL DE GRAL. SAN MARTÍN ECyT BIOLOGÍA CPU Biología Genética Leyes de Mendel Los primeros esbozos de la teoría genética pueden trazarse hasta una experiencia humana común: el reconocimiento

Más detalles

PROBLEMAS DE GENÉTICA Árboles genealógicos (2011) A. CUESTIONES GENERALES

PROBLEMAS DE GENÉTICA Árboles genealógicos (2011) A. CUESTIONES GENERALES PROBLEMAS DE GENÉTICA Árboles genealógicos (2011) A. CUESTIONES GENERALES Se estudia la herencia de un determinado carácter a lo largo de varias generaciones de una misma familia. Del análisis del árbol

Más detalles

PROBLEMAS DE GENÉTICA

PROBLEMAS DE GENÉTICA Colegio La Inmaculada Misioneras Seculares de Jesús Obrero Nueva del Carmen, 35. 47011 Valladolid. Tel: 983 29 63 91 Fax: 983 21 89 96 e-mail: lainmaculadava@planalfa.es PROBLEMAS DE GENÉTICA 1.- El carácter

Más detalles

Consolidación. G N n n F 1. 1º). Los individuos que manifiestan un carácter recesivo, Son homocigóticos o heterocigóticos para el carácter? Por qué?

Consolidación. G N n n F 1. 1º). Los individuos que manifiestan un carácter recesivo, Son homocigóticos o heterocigóticos para el carácter? Por qué? Consolidación 1º). Los individuos que manifiestan un carácter recesivo, Son homocigóticos o heterocigóticos para el carácter? or qué? Los individuos que manifiestan un carácter recesivo son necesariamente

Más detalles

CUESTIONES DE GENÉTICA

CUESTIONES DE GENÉTICA CUESTIONES DE GENÉTICA DEFINE. GENÉTICA 1. Defina los siguientes conceptos: genoma, gen, heterocigótico y herencia intermedia [2]. Total 2 puntos Genoma: conjunto de genes de una célula, de un individuo

Más detalles

1- Cómo se denomina la segunda ley de Mendel? Enúnciala.

1- Cómo se denomina la segunda ley de Mendel? Enúnciala. BIOLOGÍA Y GEOLOGÍA UNIDAD: GENÉTICA 4ºESO Nombre: Curso: Apellidos: Grupo: 1- Cómo se denomina la segunda ley de Mendel? Enúnciala. 2- Del cruce de un progenitor humano de pelo negro y rizado (NNRr) y

Más detalles

TP: Herencia Mendeliana

TP: Herencia Mendeliana TP: Herencia Mendeliana Introducción a la biología (FHYCS - UNPSJB) Por Lic. Damián G. Gil (2009) Objetivos del TP Aplicar los mecanismos de transmisión de los caracteres hereditarios, según la leyes de

Más detalles

Genetica. Estudio de la Herencia

Genetica. Estudio de la Herencia Genetica Estudio de la Herencia Introduccion Herencia: la transmision de los rasgos y caracteres de los padres a sus hijos. Genetica: rama de la biologia que estudia las leyes de la herencia. Genetica

Más detalles

La UNESCO ha declarado el genoma humano Patrimonio de la Humanidad (1997)

La UNESCO ha declarado el genoma humano Patrimonio de la Humanidad (1997) Valoración y significado del conocimiento del ADN El conocimiento completo del ADN ha abierto una nueva ciencia, la Biotecnología con un alcance aún insospechado; cómo: La tecnología del ADN recombinante

Más detalles

Estudio de la relación genotipofenotipo. Bases moleculares de la percepción de sabor de la difeniltiocarbamida

Estudio de la relación genotipofenotipo. Bases moleculares de la percepción de sabor de la difeniltiocarbamida Estudio de la relación genotipofenotipo Bases moleculares de la percepción de sabor de la difeniltiocarbamida Problemas de fenotipo? Mendel y las reglas de la herencia Gregor Mendel Nació el 22 de julio

Más detalles

PROBLEMAS DE GENÉTICA 2013

PROBLEMAS DE GENÉTICA 2013 PROBLEMAS DE GENÉTICA 2013 A. Primera y segunda ley de Mendel. Retrocruzamiento 1. Cobayas negras heterocigotas (Bb) se aparearon con cobayas blancas recesivas homocigotas (bb).indicar las proporciones

Más detalles

Tema: La Revolucion Genetica

Tema: La Revolucion Genetica Tema: La Revolucion Genetica La Genética es la rama de la Biología que estudia la herencia de los caracteres, la herencia biologica A principio del siglo XX se propuso el nombre de gen en lugar de factor

Más detalles

SOLUCIONARIO GUÍA TÉCNICO PROFESIONAL. Genética mendeliana SGUICTC036TC31-A16V1

SOLUCIONARIO GUÍA TÉCNICO PROFESIONAL. Genética mendeliana SGUICTC036TC31-A16V1 SOLUCIONARIO GUÍA TÉCNICO PROFESIONAL Genética mendeliana SGUICTC036TC31-A16V1 SOLUCIONARIO GUÍA Solucionario Genética mendeliana Ítem Alternativa Habilidad 1. C Comprensión 2. B Reconocimiento 3. B Comprensión

Más detalles

Leyes de Mendel y sus aplicaciones

Leyes de Mendel y sus aplicaciones Leyes de Mendel y sus aplicaciones Genética Mendeliana. Las leyes de la herencia Gregorio Mendel, 1860 Monasterio de Sto. Tomás, Rep. Checa Mendel estudió varias características fenotípicas de la planta

Más detalles

Alelo. Locus. La forma alternativa de un gen. El lugar donde se localiza el gen en el cromosoma.

Alelo. Locus. La forma alternativa de un gen. El lugar donde se localiza el gen en el cromosoma. GENÉTICA MENDELIANA Griffiths A., Wessler S., Lewontin R., Gelbart W., Suzuki D., Miller J. (2005) Introduction to Genetic Analysis (8 th ed). W.H. Freeman and Company, New York. QH430/I59/2005 Strachan

Más detalles

GENÉTICA MENDELIANA. C. Morgan. Drosophila melanogaster. Mutación. Alelos. Fenotipogenotipo.

GENÉTICA MENDELIANA. C. Morgan. Drosophila melanogaster. Mutación. Alelos. Fenotipogenotipo. GENÉTICA MENDELIANA Mendel utilizando guisantes desveló los principios de la transmisión genética. Otros demostraron que los genes están en los cromosomas y que las cepas mutantes se pueden utilizar para

Más detalles

TEMA 3 HERENCIA Y TRANSMISIÓN DE CARACTERES COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15

TEMA 3 HERENCIA Y TRANSMISIÓN DE CARACTERES COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 TEMA 3 HERENCIA Y TRANSMISIÓN DE CARACTERES COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 OBJETIVOS DEL TEMA * Tipos de reproducción. Ventajas. Inconvenientes. * Leyes de Mendel *

Más detalles

TALLER (Evaluación 20 de abril). C E R T A A P R I N C I P I O D E S E G R E G A C I O N I

TALLER (Evaluación 20 de abril). C E R T A A P R I N C I P I O D E S E G R E G A C I O N I I. SOPA DE LETRAS TALLER (Evaluación 20 de abril). C E R T A A P R I N C I P I O D E S E G R E G A C I O N I A R D C Z F J Ñ V H I R A J V U B W L G B A C O R P I X P C D G N Z Q E H U L M F A F J A C

Más detalles

EJERCICIOS DE GENÉTICA

EJERCICIOS DE GENÉTICA EJERCICIOS DE GENÉTICA 1.- Los individuos que manifiestan un carácter recesivo, son homocigóticos o heterocigóticos para el carácter? Por qué? 2.- La acondroplasia es una forma de enanismo debida a un

Más detalles

Genética Mendeliana. Universidad Nacional de Colombia Sede Medellín. Autor: Dario Alvarez Marin Docente. Profesor: Ing. A. Alejandro Piedrahita

Genética Mendeliana. Universidad Nacional de Colombia Sede Medellín. Autor: Dario Alvarez Marin Docente. Profesor: Ing. A. Alejandro Piedrahita Universidad Nacional de Colombia Sede Medellín Trabajo Final de Látex Genética Mendeliana Autor: Dario Alvarez Marin Docente Profesor: Ing. A. Alejandro Piedrahita 15 de abril de 2011 Índice 1. Introducción

Más detalles

LA HERENCIA BIOLÓGICA

LA HERENCIA BIOLÓGICA LA HERENCIA BIOLÓGICA LOS CROMOSOMAS Todas las células tienen el material genético en forma de ADN.(Acido desoxirribonucleico) El ADN es la molécula química donde se localiza la información de la célula.

Más detalles

Genética. Mónica María Saldarriaga

Genética. Mónica María Saldarriaga Genética Mónica María Saldarriaga GENETICA MENDELIANA La genética solo comenzó en la década de 1860 Gregor Mendel (1822 1884) Monje agustino católico y naturalista, nacido en Austria Diseñó experimentos

Más detalles

31. Dar los genotipos más probables de los padres en los siguientes cruzamientos entre conejos: (UV)

31. Dar los genotipos más probables de los padres en los siguientes cruzamientos entre conejos: (UV) Problemas sesión06-1 - Sesión 6 31. Dar los genotipos más probables de los padres en los siguientes cruzamientos entre conejos: (UV) CRUCES N Him. Gris Alb. Ch. 1 N x N 3/4 1/4 - - - 2 N x N 3/4-1/4 -

Más detalles

Resumen de la clase anterior

Resumen de la clase anterior Resumen de la clase anterior Factores heredables Genética mendeliana Homocigoto Heterocigoto Genotipo Fenotipo Monohibridismo. Ley de la segregación Dihibridismo. Ley de la segregación independiente Los

Más detalles

MONOHIBRIDOS Y DIHIBRIDOS. Cátedra de Genética FAZ UNT

MONOHIBRIDOS Y DIHIBRIDOS. Cátedra de Genética FAZ UNT MONOHIBRIDOS Y DIHIBRIDOS Mendel era un monje austríaco que empezó en 1857 a seleccionar material para ver cómo se transmitían los caracteres, y en 1865 publicó sus experiencias pero no tuvieron mayor

Más detalles

TEMA 34 Genética Mendeliana

TEMA 34 Genética Mendeliana TEMA 34 Genética Mendeliana 34.1.- Introducción. Genoma: conjunto de la información genética contenida en las células de una especie. Ej.: genoma humano, genoma de drosophila Genotipo: es la constitución

Más detalles

INICIACIÓN A LA GENÉTICA.

INICIACIÓN A LA GENÉTICA. INICIACIÓN A LA GENÉTICA. INTRODUCCIÓN. Evaluación previa: 1. Por qué un hijo tiene parecido con el padre y la madre?. 2. Subraya los conceptos que creas relacionados con la herencia biológica: gen, cloroplasto,

Más detalles

LA EXPLICACIÓN DE LOS RESULTADOS DE MENDEL

LA EXPLICACIÓN DE LOS RESULTADOS DE MENDEL LA EXPLICACIÓN DE LOS RESULTADOS DE MENDEL Mendel desarrolló varias hipótesis para explicar sus resultados Cada característica hereditaria está bajo el control de dos factores separados, uno de cada padre.

Más detalles

Qué estudia la genética? Qué importancia tiene la Genética Molecular para la arqueología?

Qué estudia la genética? Qué importancia tiene la Genética Molecular para la arqueología? Qué estudia la genética? Qué importancia tiene la Genética Molecular para la arqueología? Todos los seres vivos somos herederos de un bien fundamental, el material genético, que se transmite de generación

Más detalles

1. Genes y caracteres hereditarios.

1. Genes y caracteres hereditarios. 1. Genes y caracteres hereditarios. 1.1. Dos genes para un carácter. Los individuos diploides tienen dos genes alelomórficos (alelos) para un único carácter. Por ejemplo para el color de la piel existen

Más detalles

GENÉTICA DE LA TRANSMISIÓN

GENÉTICA DE LA TRANSMISIÓN GENÉTICA DE LA TRANSMISIÓN TEMA 5. MENDELISMO. Principios mendelianos aplicados a los animales domésticos. Polihibridismo. Teoría cromosómica de la herencia. Herencia mendeliana en los animales domésticos.

Más detalles

1. Genes y caracteres hereditarios.

1. Genes y caracteres hereditarios. 1. Genes y caracteres hereditarios. 1.1. Dos genes para un carácter. Los individuos diploides tienen dos genes alelomórficos (alelos) para un único carácter. Por ejemplo para el color de la piel existen

Más detalles

BIOLOGIA COMÚN BC-21. Generación Parental. Flores fucsias. Flores blancas. Generación F 1. Todas las plantas fucsias.

BIOLOGIA COMÚN BC-21. Generación Parental. Flores fucsias. Flores blancas. Generación F 1. Todas las plantas fucsias. BIOLOGIA COMÚN BC-21 U N I D A D III : G E N É T I C A D I V GI SEI ÓN N É TC IE CL UA L AI R II Generación Parental Flores fucsias Flores blancas Generación F 1 Todas las plantas fucsias Generación F

Más detalles

Unidad II. Variabilidad y Herencia. Genética Mendeliana.

Unidad II. Variabilidad y Herencia. Genética Mendeliana. CURSO: BIOLOGÍA COMÚN MATERIAL BC-Nº 13 INTRODUCCIÓN Unidad II. Variabilidad y Herencia Genética Mendeliana. La genética es considerada como una disciplina relativamente nueva en el campo de la Biología.

Más detalles