Cursos de Formación de la UCTS (2011) Tecnologías de alto rendimiento en genómica

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Cursos de Formación de la UCTS (2011) Tecnologías de alto rendimiento en genómica"

Transcripción

1 Cursos de Formación de la UCTS (2011) Plataforma de Genómica / Plataforma de Diagnóstico Molecular Tecnologías de alto rendimiento en genómica 2ª Parte: Tecnologías de ultrasecuenciación y de enriquecimiento de secuencia.

2 Programa del curso De Sanger hacia NGS 454 de Roche Desarrollo de la tecnología Cómo funciona Aplicaciones Comparación con otros Sistemas NGS Sistema Nimblegen Cómo funciona Formatos Aplicaciones Análisis de datos de alta densidad (UEB)

3 Cualquier DNA puede ser secuenciado

4 Nature Reviews Genetics 9, , 2008 Genomas Secuenciados

5 Cronología de la Secuenciación 1953 Francis Crick and James Watson describen el modelo de la doble hélice del DNA Método secuenciación Wandering spot, Maxam y Gilbert 1975 Método secuenciación plus and minus, Sanger y Coulson 1ª GENERACIÓN 1996 Pal Nyrén & Mostafa Ronagh i publican método de la pirosecuenciación en el Royal Institute of Technology (Stockholm) Se publica la primera versión del genoma humano. Science 291 (5507): ; Nature 409 (6822): Proyecto Genoma Humano (13 años). U.S. Department of Energy and the NIH 1ª GENERACIÓN DNA sequencing by chemical degradation by Maxam y Gilbert. 2. Chain-terminator method by Sanger et al. Método usado durante los proximos 30 años phi X 174 Primer genoma de DNA completo secuenciado 11 genes en 5386 bases (cadena sencilla) Applied Biosystems comercializa el primer secuenciador automático, El modelo ABI 370. NGS:2ª GENERACIÓN Life Science comercializa el 1er ultrasecuenciador GS20 (20Mpb) 2006 Lanzamiento de SOLEXA (Illumina) Genoma de Venter mediante sec. Sanger automática (4 años) Lanzamiento de GS FLX de Roche (100Mbp) SOLID de Applied Biosystem Serie de reactivos Titanium de Roche (500Mbp). Genoma Watson mediante 454/ROCHE Nature 452, (17 April 2008) El Instituto Naiconal de Salud (NIH) empieza secuenciación a gran escala de diversos microorganismos, ej. E.coli NGS:3ª GENERACIÓN Genomes Project Método de secuenciaciación SingleMolecularRealTime

6 1ª Generación Secuenciación Método Sanger Fragmentación de DNA Clonaje en Vectores; Transformación Bacterias; crecimiento y aislamiento vector DNA Ciclo Secuenciación Sanger sequencing: - Long reads ( bp) - Low throughput (192 reactions/run) Secuencia: 3 GACTAGATACGACGAGCGTGA 5 Primer: 5 CTGAT Electroforesis ( 1 Secuencia/Capilar) CTATGCTCG Polimerasa dntps ddntps marcados

7 2ª Generación Secuenciación Los Instrumentos de secuenciación de 2ª generación pueden generar tantos datos en un día como los generados por varios cientos de secuenciadores con capilares tipo Sanger, obtenidos por una sola persona.

8 Sanger vs 2ª Generación Secuenciación Fragmentación de DNA Fragmentación de DNA Clonaje en Vectores; Transformación Bacterias; crecimiento y aislamiento vector DNA Ligación de adaptadores in vitro y amplificación clonal Ciclo Secuenciación Secuenciación masiva en paralelo Secuencia: Primer: Polimerasa dntps ddntps marcados Electroforesis ( 1 Secuencia/Capilar) CTATGCTCG Procesamiento imagen

9 2ª Generación Secuenciación ROCHE GS FLX 454 GS FLX+ 454 GS Junior 454 illumina Solexa Life Technology SOLiD 3System SOLiD 4 System 5500 System 5500xl System Ion Torrent System

10 Servicio Ultrasecuenciación UCTS GS 454 de ROCHE GS FLX GS Junior

11 Cúantas muestras se pueden secuenciar por run? 1ª Generación 3100 ABI Metal coated PTP reduces crosstalk 29 µm well diameter (20/bead) 3,400,000 wells per PTP 2ª Generación GS ROCHE 96p-Plates 384p-Plates PicoTiterPlate_FLX 70x70mm PicoTiterPlate_Junior

12 GS FLX/Junior 454 Troughput PTP Gaskets 35 -Tamaño de lo que quiero secuenciar -Coverage -Multiplexar (MIDS) N= (GxC)/Mbp por región PTP Donde: N= num de muestras que puedo secuenciar en un run G= tamaño de lo que quiero secuenciar C=Coverage (C= N * L / G)

13 GS FLX/Junior 454 Workflow gdna, Amplicones, cdna 1.Calidad & Cantidad Material de partida 2. Construcción Librería 3. Amplificación mediante empcr 4. Secuenciación Datos Obtenidos

14 1. Calidad & Cantidad Material de partida 1.1 Calidad mediante Chips Bioanalyzer; gel agarosa gdna, RNA 1.2 Cuantificación mediante Picogreen (gdna) o Ribogreen (RNA) y = 34,577x - 61,596 R 2 = 0,9994 Fluorescence Lam bda DNA (ng/m L) Fluorímetro FLx800

15 GS FLX/Junior 454 Workflow gdna, Amplicones, RNA 1.Calidad & Cantidad Material de partida 2. Construcción Librería 3. Amplificación mediante empcr 4. Secuenciación Datos Obtenidos

16 2. Construcción Librería Fragmentación Selección Tamaño Ligación Adaptadores Librería Shotgun Librería Pair-End Librería cdna gdna, RNA PCR con Fusion Primers Librería Amplicones Adaptador A (44 bases): Adaptador B (44 bases) Fusion Primers Primer Amplificación Primer 4 nucleótidos Secuenciación Key Biotina Primer Amplificación Primer 4 nucleótidos Secuenciación Key Adaptador A Target Adaptador B Target

17 2. Construcción Librería: Fragmentación gdna Librerías Shotgun NEBULIZACIÓN Rotura utilizando nitrógeno a alta presión DNA genómico Fragmentos de DNA de doble cadena 2.1 bar (30psi) Librerías Pair-End HYDROSHEAR gdna Fuerzas de rotura hidrodinámicas Orificio gdna fragmentado

18 2. Construcción Librería: Fragmentación RNA Librerías cdna RNA Random Primers First Strand Synthesis Solución de Fragmentación de RNA Second Strand Synthesis Fragmentos de cdna de doble cadena

19 2. Construcción Librería: Selección fragmentos gdna Nebulizado: DNA 7500 Lab Chip AMPure beads SPRI (Solid Phase Reversible Immobilization) DNA 7500 LabChip 50pb-1000pb 300pb-1000pb gdna fragmentado con Hydroshear: RNA Pico 6000 LabChip Electroelución 500pb-600 nt Tamaño medio de nt (dep. del contenido en GC) Menos del 10% 300 nt, no adaptor dimers Conc >0.2 ng/µl (Ribogreen )

20 2. Construcción Librería Inmobilización Fragmentos y aislamiento de la Librería: AB AB Melt Solution BB AA 4 tipos de productos resultan de la ligación Los productos con Biotina (AB, BA, BB) se unen a bolas magnéticas que llevan estreptavidina. Los products AA son lavados y eliminados. Mediante Melt Solution (NaOH0.1N) las cadenas no biotiniladas de cada fragmento de dsdna son aisladas. Ambas cadenas de los fragmentos BB quedarán unidas a las bolas. Sólo se aislan cadenas de DNA sencilla AB constituyendo la librería.

21 2. Construcción Librería: Q&Q Librería Molecules/µl = - Num de Avogadro es 6.022x1023 (moléculas/mole) x10 9 (gramos/mole) es peso molecular medio de nts. -Perfil típico de una librería ssdna (Agilent 2100 RNA Pico 6000 LabChip): Tamaño medio de bp -Cuantificación mediante Ribogreen -Dilución de trabajo para empcr

22 GS FLX/Junior 454 Workflow gdna, Amplicones, cdna 1.Calidad & Cantidad Material de partida 2. Construcción Librería 3. Amplificación mediante empcr 4. Secuenciación Datos Obtenidos

23 3. Amplificación mediante empcr Antes de la empcr: high-speed shaker -1 starting effective fragment per microreactor - ~10 6 microreactors per ml - All processed in parallel (Amplificación clonal)

24 3. Amplificación mediante empcr Después de la PCR: Rotura y Recuperación Contaje 65%, 85% óptimo % Recuperación= DNA-beads/ml Input beads x100 Enrequecimiento de beads con DNA: Melt 5-20% óptimo dsdna Unión de Primer marcado con Biotina a bolas de captura con ssdna Adición de bolas magnéticas con estreptavidina Melt % Enrequecimiento= DNA-beads/ml Input beads x100

25 empcr Titulación sólo para GS FLX Antes de la empcr: Cuántas copias de librería por Beads de captura son óptimas? 1. Procesar 4 tubos emulsiones Tubo Moléculas de Librería por Bead de Captura (cpb) Vol Librería Diluida µl µl µl µl 2. Recuperación y enrequecimiento de cada tubo 3. Contaje de las beads enriquecidas 4. Escoger el ratio copia/bead con aproximadamente un 8% de enrequecimiento

26 GS FLX/Junior 454 Workflow gdna, Amplicones, cdna 1.Calidad & Cantidad Material de partida 2. Construcción Librería 3. Amplificación mediante empcr 4. Secuenciación Datos Obtenidos

27 4. Secuenciación Metal coated PTP reduces crosstalk 29 µm well diameter (20/bead) 3,400,000 wells per PTP Gaskets

28 4. Secuenciación Secuenciación mediante síntesis Química basada en la pirosecuenciación Sulfurylase Luciferase Luciferina Polimerasa añade nucleótidos (datp) Se libera pirofosfato (PPi) Sulfurilasa crea ATP a partir del PPi Luciferasa hidroliza ATP y usa luciferina para producir luz. Light + oxyluciferin

29 4. Secuenciación Flujo de Reactivos Nucleotides are flowed sequentially across the PTPone at a time (200 cycles à4 bases) Pyrophosphate signal generation upon complimentary nucleotide incorporation dark otherwise The CCDcamera is generating a image after every flow The signal strength is proportional to the number of nucleotides incorporated

30 Flowgama y Base calling: 4. Secuenciación

31 4. Secuenciación:Ejemplo

32 MULTIPLEXACIÓN DE MUESTRAS MIDS: -Los MIDs son secuencias cortas que se añaden a los fragmentos a secuenciar durante la generación de librería y permiten identificar cada muestra de manera individual. Primer Amplificación Primer 4 nucleótidos Secuenciación Key Biotina Primer Amplificación Primer 4 nucleótidos Secuenciación Key Adaptador A Target MIDS Adaptador B Target MIDS MIDS MIDS -Permite aumentar el número de muestras por PTP: -separación física: gaskets pérdida física de espacio en la placa -separación por código de barras -Utilizando las dos posibilidades anteriores, aumenta el número de muestras a secuenciar por placa: -Kit comercial de 12 MIDs (diseñados por Roche) 12 muestras/reg. -División de la PTP en 16 reg. con gaskets TOTAL: 12 MIDs/reg. * 16 reg. = 192 muestras por PTP (máx) (INCLUSO MÁS)

33 Multiplexado de Muestras Multiplexado de amplicones MID2-Amplicón 2 MID4-Amplicón 4 MID1-Amplicón 1 MID3-Amplicón 3 MID5-Amplicón 5 MID6-Amplicón 6 Amplicón 11 Amplicón 7 Amplicón 8 Amplicón 9 Amplicón 10 Amplicón 12

34 SISTEMA GS FLX 454-APLICACIONES -Secuenciación de DNA a partir de muestras de especies extinguidas (shot-gun, paired-end) -Estudios de epigenética: amplicones -ChIP y secuenciación de los fragmentos de DNA presentes en los IPs -Metilación: conversión con bisulfito, amplificación de las regiones conteniendo islas CpG y secuenciación. -Ensamblaje de genomas eucariotas y procariotas completos, tanto de novo como resecuenciación (shot-gun +paired-end) -SAGE (Serial Analysis of Gene Expression Ditags): análisis cuantitativo y cualitativo del transcriptoma (shot-gun) -Caracterización y cuantificación de poblaciones virales a través de la secuenciación de genes diana (ej: transcriptasa reversa en VIH). Detección de quasiespecies (amplicones). -Metagenómica: estudio del contenido genómico en una mezcla compleja de microorganismos (microbiota, muestras medioambientales). Determinación tanto cuantitativa como cualitativa (shot-gun, retrotranscripción de RNA total o de mrna, amplicones de 16S rrna)

35 SISTEMA GS FLX 454-APLICACIONES -Secuenciación de genomas de pequeño tamaño (virales, mitocondriales) o de plásmidos (shot-gun) -Secuenciación de RNAs de pequeño tamaño (micrornas, sirnas): generación del cdna de doble cadena como material de partida (shot-gun) -Detección de SNPs, InDels, CNV (shot-gun) -Análisis del transcriptoma (partiendo de RNA total o mrna), cuantitativo o cualitativo (comparación de niveles de expresión) (retrotranscripción y shot-gun) -Enriquecimiento de regiones del genoma/captura del exoma utilizando arrays de captura de Nimblegen. Secuenciación de las regiones capturadas (shot-gun). En función de la aplicación, puede ser necesario completar los datos de 454 utilizando otras tecnologías, p.ej. Resolución de homopolímeros utilizando Sanger o lecturas cortas de Illumina. En general, se recomienda validar siempre los resultados utilizando otro tipo de aproximaciones: arrays, secuenciación Sanger, PCR a tiempo real, otras tecnologías de ultrasecuenciación...

36 Especificaciones Sistemas GS FLX & GS Junior

37 El futuro de la secuenciación 454

38 Programa del curso De Sanger hacia NGS 454 de Roche Desarrollo de la tecnología Cómo funciona Aplicaciones Comparación con otros Sistemas NGS Sistema Nimblegen Cómo funciona Formatos Aplicaciones Análisis de datos de alta densidad (UEB)ç

39 Comparación Plataformas secuenciación GS FLX 454 Chemistry based on pirosequencing Sample amplified by emulsion PCR Read length bp >1 million reads per run Mb of sequence ~10 hours run HiSeq 2000-Illumina Chemistry based on reversible terminators Sample amplified by solidphase amplification Read length 2x100 bp 3 billions reads per run 600 Gb of sequence 2-11 days run ABI SOLID 5500xl Chemistry based on sequencing by ligation Sample amplified by emulsion PCR Read length bp million reads per run Gb of sequence 4-8 days run

40 Comparación Plataformas secuenciación

41 Comparación Plataformas secuenciación

42 Comparación Plataformas secuenciación

43 Ejemplos de Genomas humanos secuenciados Nature Reviews Genetics 11, (January 2010)

44 Comparación Plataformas secuenciación 1ª Generación 2ª Generación

45 3ª Generación Secuenciación SCIENCE Vol JANUARY 2009 Real-Time DNA Sequencing from Single Polymerase Molecules John Eid, * Adrian Fehr, * Jeremy Gray, * Khai Luong, * John Lyle, * Geoff Otto, * Paul Peluso, * David Rank, * Primo Baybayan, Brad Bettman, Arkadiusz Bibillo, Keith Bjornson, Bidhan Chaudhuri, Frederick Christians, Ronald Cicero, Sonya Clark, Ravindra Dalal,, Alex dewinter, John Dixon, Mathieu Foquet, Alfred Gaertner, Paul Hardenbol, Cheryl Heiner, Kevin Hester,, David Holden, Gregory Kearns, Xiangxu Kong, Ronald Kuse, Yves Lacroix, Steven Lin, Paul Lundquist, Congcong Ma, Patrick Marks,, Mark Maxham,, Devon Murphy, Insil Park, Thang Pham,, Michael Phillips, Joy Roy,, Robert Sebra, Gene Shen, Jon Sorenson, Austin Tomaney, Kevin Travers,, Mark Trulson, John Vieceli, Jeffrey Wegener, Dawn Wu,, Alicia Yang, Denis Zaccarin,, Peter Zhao, Frank Zhong, Jonas Korlach, Stephen Turner. Press Release Pacific Biosciences Announces Early Access Customers for Its Single Molecule Real Time System Eleven Leading Companies Support Launch of Third-generation DNA Sequencing MENLO PARK, Calif., Feb 23, 2010 Pacific Biosciences, a private company developing a disruptive technology platform for real-time detection of biological events at single molecule resolution, today announced the 10 institutions that have purchased its Single Molecule Real Time (SMRT(TM)) DNA sequencing system as part of the company's early access program in North America.

46 Programa del curso De Sanger hacia NGS 454 de Roche Desarrollo de la tecnología Cómo funciona Aplicaciones Comparación con otros Sistemas NGS Sistema Nimblegen Cómo funciona Formatos Aplicaciones Análisis de datos de alta densidad (UEB)

47 NIMBLEGEN: Arrays de Captura Los arrays de captura de secuencia de Nimblegen permiten capturar y enriquecer regiones génicas de interés, contiguas o no, con una elevada sensibilidad y especificidad, que luego pueden amplificarse y secuenciarse mediante tecnologías de alto rendimiento (454/Illumina). -Este sistema permite secuenciar regiones de interés en vez de genomas completos, con lo cual el coste de la secuenciación se reduce considerablemente. Técnicamente, el proceso también es menos costoso. -Sistema flexible: las regiones de interés pueden ser contiguas o no en el genoma. -Nimblegen diseña los arrays a la carta, solamente es necesario facilitarles las coordenadas de los genes diana. 1) Formato sólido -Arrays a la carta, con dos posibles tamaños de captura: 5 Mb ó 30 Mb por array. -Arrays de captura del exoma: prediseñados, contienen exones humanos codificantes y 551 exones para mirna (34 Mb), utilizando 2,1 millones de sondas. El listado de genes que contienen estos arrays puede consultarse en la web de Nimblegen (www.nimblegen.com). -2) Formato en solución -Arrays de captura del exoma: prediseñados, contienen exones humanos codificantes y 551 exones para mirna (34 Mb). Existe una versión LR (long-read) optimizada para secuenciación con 454. Disponible en dos formatos, para 4 reacciones y para 48 reacciones. Próximamente existirá este formato para arrays de 5 Mb.

48 NIMBLEGEN: Arrays de Captura

49 PROTOCOLO DE ARRAYS DE CAPTURA EN SÓLIDO 3. Pre-capture amplification 4. Hybridization a) Ensamblaje del array b) Carga del array c) Hibridación: 42º C, h

50 PROTOCOLO DE ARRAYS DE CAPTURA EN SOLUCIÓN Streptavidin beads Pre-capture amplification Primers biotinilados 3. Hybridization 47 ºC, horas

51 CONTROL DE CALIDAD DE LA CAPTURA MEDIANTE qpcr La eficiencia teórica de una qpcr es del 100% y significa que las secuencias diana se doblan en cada ciclo, es decir, que E=2. Sin embargo, la eficiencia real nunca es del 100% y por eso el valor de E debe calcularse empíricamente para cada sonda. Los locus control NSC permiten determinar el enriquecimiento de un pequeño set de locus control estandarizados que se encuentran dentro de un rango de eficiencias de captura conocidas. Estos ensayos permiten hacer una estimación aproximada del enriquecimiento de poblaciones mayores de genes diana sin necesidad de secuenciarlos. Si la qpcr de estos locus control indica una captura correcta, es muy problable que los locus experimentales de interés también hayan sido capturados satisfactoriamente.

52 TECNOLOGÍA DE NIMBLEGEN -Arrays de enriquecimiento de secuencia -CGH arrays CGX / CNV / Whole genome / Whole genome-exon focused / Custom -ChIP-chip arrays Whole genome / Promoter / Custom -Arrays de metilación Whole genome / Promoter / Custom -Arrays de expresión génica Whole genome / Promoter / Custom

53 OTRAS TECNOLOGÍAS DE ENRIQUECIMIENTO DE SECUENCIA -Sistema SureSelect (Agilent): arrays de captura en solución. Optimizada para la secuenciación con Illumina, SOLiD y 454. Existen versiones prediseñadas para capturar el exoma y el noma humanos, o bien pueden diseñarse ensayos a la carta (captura de 3.3 ó 6.6 Mb). Las muestras pueden indexarse después de la captura para optimizar el rendimiento de la ultrasecuenciación (=MIDs de Roche). Existe también un formato sólido que permite capturar hasta 1 Mb. -Sistema Febit (ABI). Para ver una descripción de cómo funciona el sistema:

54 PAUTAS PARA EL DISEÑO EXPERIMENTAL DE UN ESTUDIO DE ULTRASECUENCIACIÓN

55 UCTS WORKFLOW Researcher Statistics and Bioinformatics (UEB) UCTS EXPERIMENTAL DESIGN QUALITY SAMPLES COLLECTION RESULTS CHECKING EXPERIMENTS SAMPLE PROCESSING DATA ANALYSIS SEQUENCING UEB UCTS Others

56 Programa del curso De Sanger hacia NGS 454 de Roche Desarrollo de la tecnología Cómo funciona Aplicaciones Comparación con otros Sistemas NGS Sistema Nimblegen Cómo funciona Formatos Aplicaciones Análisis de datos de alta densidad (UEB)

57 Introduction to NGS (Now Generation Sequencing) Data Analysis Alex Sánchez Statistics and Bioinformatics Research Group Statistics department, Universitat de Barelona Statistics and Bioinformatics Unit Vall d Hebron Institut de Recerca Picture 5... NGS Data analysis

58 Introduction to NGS (Now Generation Sequencing) Data Analysis Alex Sánchez Statistics and Bioinformatics Research Group Statistics department, Universitat de Barelona Statistics and Bioinformatics Unit Vall d Hebron Institut de Recerca NGS Data analysis

59 Outline Introduction Bioinformatics Challenges NGS data analysis: Some examples and workflows Metagenomics, De novo sequencing, Variant detection, RNAseq Software Galaxy, Genome viewers Data formats and quality control NGS Data analysis

60 Introduction NGS Data analysis

61 Why is NGS revolutionary? NGS has brought high speed not only to genome sequencing and personal medicine, it has also changed the way we do genome research Got a question on genome organization? SEQUENCE IT!!! Ana Conesa, bioinformatics researcher at Principe Felipe Research Center NGS Data analysis

62 NGS means high sequencing capacity GS FLX 454 (ROCHE) HiSeq 2000 (ILLUMINA) 5500xl SOLiD (ABI) GS Junior Ion TORRENT NGS Data analysis

63 NGS Platforms Performance 454 GS Junior 35MB NGS Data analysis

64 454 Sequencing NGS Data analysis

65 ABI SOLID Sequencing NGS Data analysis

66 Solexa sequencing NGS Data analysis

67 Applications of Next-Generation Sequencing

68 Comparison of 2nd NGS NGS Data analysis

69 Some numbers Platform 454/FLX Solexa (Illumina) AB SOLID Read length ~ bp 36, 75, or 106 bp 50bp Single read Yes Yes Yes Paired-end Reads Yes Yes Yes Long-insert (several Kbp) mate-paired reads Yes Yes No Number of reads por instrument run 5.00K >100 M 400M Max Data output 0.5Gbp 20.5 Gbp 20Gbp Run time to 1Gb 6 Days > 1 Day >1 Day Ease of use (workflow) Difficult Least difficult Difficult Base Calling Flow Space Nucleotide space Color sapce DNA Applications Whole genome sequencing and resequencing Yes Yes Yes de novo sequencing Yes Yes Yes Targeted resequencing Yes Yes Yes Discovery of genetic variants ( SNPs, InDels, CNV,...) Yes Yes Yes Chromatin Immunopecipitation (ChIP) Yes Yes Yes Methylation Analysis Yes Yes Yes Metagenomics Yes No No RNA Applications Yes Yes Yes Whole Transcriptome Yes Yes Yes Small RNA Yes Yes Yes Expression Tags Yes Yes Yes NGS Data analysis

70 Bioinformatics challenges of NGS NGS Data analysis

71 I have my sequences/images. Now what? NGS Data analysis

72 NGS pushes (bio)informatics needs up Need for computer power VERY large text files (~10 million lines long) Can t do business as usual with familiar tools such as Perl/Python. Impossible memory usage and execution time Impossible to browse for problems Need sequence Quality filtering Need for large amount of CPU power Informatics groups must manage compute clusters Challenges in parallelizing existing software or redesign of algorithms to work in a parallel environment Need for Bioinformatics power!!! The challenges turns from data generation into data analysis! How should bioinformatics be structured Bigger centralized bioinformatics services? (or research groups providing service?) Distributed model: bioinformaticians must be part of the temas. Interoperability? NGS Data analysis

73 Data management issues Raw data are large. How long should be kept? Processed data are manageable for most people 20 million reads (50bp) ~1Gb More of an issue for a facility: HiSeq recommends 32 CPU cores, each with 4GB RAM Certain studies much more data intensive than other Whole genome sequencing A 30X coverage genome pair (tumor/normal) ~500 GB 50 genome pairs ~ 25 TB NGS Data analysis

74 So what? In NGS we have to process really big amounts of data, which is not trivial in computing terms. Big NGS projects require supercomputing infrastructures Or put another way: it's not the case that anyone can do everything. Small facilities must carefully choose their projects to be scaled with their computing capabilities. NGS Data analysis

75 Computational infrastructure for NGS There is great variety but a good point to start with: Computing cluster Multiple nodes (servers) with multiple cores High performance storage (TB, PB level) Fast networks (10Gb ethernet, infiniband) Enough space and conditions for the equipment ("servers room") Skilled people (sysadmin, developers) CNAG, in Barcelona: 36 people, more than 50% of them informaticians NGS Data analysis

76 Alternatives (1): Cloud Computing Pros Flexibility. You pay what you use. Don t need to maintain a data center. Cons Transfer big datasets over internet is slow. You pay for consumed bandwidth. That is a problem with big datasets. Lower performance, specially in disk read/write. Privacy/security concerns. More expensive for big and long term projects. NGS Data analysis

77 Alternatives (2): Grid Computing Pros Cheaper. More resources available. Cons Heterogeneous environment. Slow connectivity (specially in Spain). Much time required to find good resources in the grid. NGS Data analysis

78 In summary? NGS arrived 2007/8 No-one predicted NGS in 2001 (ten years ago) Therefore we cannot predict what we will come up against TGS represents specific challenges Large Data Storage Technology-aware software Enables new assays and new science We would have said the same about NGS. These are not new problems, but will require new solutions There is a lag between technology and software. NGS Data analysis

79 Bioinformatics and bioinformaticians The term bioinformatician means many things Some may require a wide range of skills Others require a depth of specific skills The best thing we can teach is the ability to learn and adapt The spirit of adventure There is a definite skills shortage There always has been NGS Data analysis

80 Increasing importance of data analysis needs NGS Data analysis

81 NGS data analysis NGS Data analysis

82 NGS data analysis stages NGS Data analysis

83 Quality control and preprocessing of NGS data NGS Data analysis

84 Data types NGS Data analysis

85 Why QC and preprocessing Sequencer output: Reads + quality Natural questions Is the quality of my sequenced data OK? If something is wrong can I fix it? Problem: HUGE files... How do they look? Files are flat files and big... tens of Gbs (even hard to browse them) NGS Data analysis

86 Preprocessing sequences improves results NGS Data analysis

87 How is quality measured? Sequencing systems use to assign quality scores to each peak Phred scores provide log(10)-transformed error probability values: If p is probability that the base call is wrong the Phred score is Q =.10 log 10 p score = 20 corresponds to a 1% error rate score = 30 corresponds to a 0.1% error rate score = 40 corresponds to a 0.01% error rate The base calling (A, T, G or C) is performed based on Phred scores. Ambiguous positions with Phred scores <= 20 are labeled with N. NGS Data analysis

88 Data formats FastA format (everybody knows about it) Header line starts with > followed by a sequence ID Sequence (string of nt). FastQ format (http://maq.sourceforge.net/fastq.shtml) First is the sequence (like Fasta but starting ) Then + and sequence ID (optional) and in the following line are QVs encoded as single byte ASCII codes Different quality encode variants Nearly all downstream analysis take FastQ as input sequence NGS Data analysis

89 The fastq format A FASTQ file normally uses four lines per sequence. Line 1 begins with a character and is followed by a sequence identifier and an optional description (like a FASTA title line). Line 2 is the raw sequence letters. Line 3 begins with a '+' character and isoptionally followed by the same sequence identifier (and any description) again. Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence. Different encodings are in use Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to description GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 NGS Data analysis

90 Some tools to deal with QC Use FastQC to see your starting state. Use Fastx-toolkit to optimize different datasets and then visualize the result with FastQC to prove your success! Hints: Trimming, clipping and filtering may improve quality But beware of removing too many sequences Go to the tutorial and try the exercises... NGS Data analysis

91 Applications [1] Metagenomics [2] De novo sequencing [3] Amplicon analysis [4] Variant discovery [5] Transcriptome analysis and more NGS Data analysis

92 [1] Metagenomics &other community-based omics Zoetendal E G et al. Gut 2008;57: NGS Data analysis

93 [1] Metagenomic Approaches SMALL-SCALE: 16S rrna gene profiling The basic approach is to identify microbes in a complex community by exploiting universal and conserved targets, such as rrna genespetrosini. Challenges and limitations: Chimeric sequences caused by PCR amplification and sequencing errors. LARGE-SCALE: Whole Genome Shotgun (WGS) Whole-genome approaches enable to identify and annotate microbial genes and its functions in the community. Challenges and limitations: relatively large amounts of starting material required potential contamination of metagenomic samples with host genetic material high numbers of genes of unknown function. Environmental Shotgun Sequencing (ESS). A primer on metagenomics. PLoS Comput Biol Feb 26;6(2):e

94 [1] A metagenomics workflow AAGACGTGGACA GTCCGTCACAACTGA CATGCGTGCATG AGTCGTCAGTCATGGG Short reads ( bps) Assembly AAGACGTGGACAGATCTGCTCAGGCTAGCATGAAC GATAGGTGGACCGATATGCATTAGACTTGCAGGGC Contigs Gene prediction Proteins, families, functions Homology searching ORFs Functional classification Ontologies Binning Functional profiles Sequences into species

95 [1] Comparative Metagenomics Comparing two or more metagenomes is necessary to understand how genomic differences affect, and are affected by the abiotic environment. MEGAN can also be used to compare the OTU composition of two or more frequencynormalized samples. MG-RAST provides a comparative functional and sequence-based analysis for uploaded samples. Other software based on phylogenetic data are UniFrac.

96 [1] Some Metagenomics projects "whole-genome shotgun sequencing" was applied to microbial populations A total of billion base pairs of nonredundant sequence were analyzed "whole-genome shotgun sequencing" 78 million base pairs of unique DNA sequence were analyzed To date, 242 metagenomic projects are on going and 103 are completed (www.genomesonline.org).

97 [2] De novo sequencing NGS Data analysis

98 [3] Amplicon analysis Each amplicon (PCR product) is sequenced individually, allowing for the identification of rare variants and the assignment of haplotype information over the full sequence length Some applications: Detection of low-frequency (<1%) variants in complex mixtures rare somatic mutations, viral quasispecies... Ultradeep sequencing amplicon Identification of rare alleles associated with hereditary diseases, heterozygote SNP calling... Ultra-broad amplicon sequencing Metabolic profiling of environmental habitats, bacterial taxonomy and phlylogeny 16S rrna amplicon sequencing

99 [3] Example of raw data generation with GS-FLX...

100 Data Processing [3] Data Workflow...

101 [3] Final output examples... NT substitution (error) matrices Bar plots output example (with circular legend for the AA) AA frequency tables

102 [4] Variant discovery Your aligner decides the type/amount of variants you can identify Naive SNP calling Reads counting Statistic support SNP calling Maximum likelihood, Bayesian Quality score recalibration Recalibrate quality score from whole alignment Local realignment around indels Realign reads Known variants (limited species) dbsnp

103 [4] Example: Exome Variant Analysis

104 [4] Genotype calling tools

105 [4] GATK pipeline

106 [4] NGS Data analysis

107 [4] Many ongoing sequencing projects NGS Data analysis

108 [5] Transcriptome Analysis using NGS RNA-Seq, or "Whole Transcriptome Shotgun Sequencing" ("WTSS") refers to use of HTS technologies to sequence cdna in order to get information about a sample's RNA content. Reads produced by sequencing Aligned to a reference genome to build transcriptome mappings.

109 [5] Applications (1) Whole transcriptome analysis mrna cdna library sequencing AAAA Fragmentation RT Detects expression of known and novel mrnas Identification of alternative splicing events Detects expressed SNPs or mutations Identifies allele specific expression patterns Reads cover the full length of a transcript CEMCAT-Neuroimmunology

110 [5] Applications (2) Differential expression 1.Reads are mapped to the reference genome or transcriptome 2.Mapped reads are assembled into expression summaries (tables of counts, showing how may reads are in coding region, exon, gene or junction); 3.The data are normalized; 4.Statistical testing of differential expression (DE) is performed, producing a list of genes with P-values and fold changes.

111 [5] RNA Seq data analysis - Mapping Main Issues: Number of allowed mismatches Number of multihits Mates expected distance Considering exon junctions End up with a list of # of reads per transcript These will be our (discrete) response variable 10 years or plus of high throughput data analysis

112 [5] RNA Seq data analysis -Normalization Two main sources of bias Influence of length: Counts are proportional to the transcript length times the mrna expression level. Influence of sequencing depth: The higher sequencing depth, the higher counts. How to deal with this Normalize (correct) gene counts to minimize biases. Use statistical models that take into account length and sequencing depth 10 years or plus of high throughput data analysis

113 [5] RNA Seq - Differential expression methods Fisher's exact test or similar approaches. Use Generalized Linear Models and model counts using Poisson distribution. Negative binomial distribution. Transform count data to use existing approaches for microarray data. 10 years or plus of high throughput data analysis

114 [5] Advantages of RNA-seq Unlike hybridization approaches does not require existing genomic sequence Expected to replace microarrays for transcriptomic studies Very low background noise Reads can be unabmiguously mapped Resolution up to 1 bp High-throughput quantitative measurement of transcript abundance Better than Sanger sequencing of cdna or EST libraries Cost decreasing all the time Lower than traditional sequencing Can reveal sequence variations (SNPs) Automated pipelines available

115 Software for NGS preprocessing and analysis NGS Data analysis

116 Which software for NGS (data) analysis? Answer is not straightforward. Many possible classifications Biological domains SNP discovery, Genomics, ChIP-Seq, De-novo assembly, Bioinformatics methods Mapping, Assembly, Alignment, Seq-QC, Technology Illumina, 454, ABI SOLID, Helicos, Operating system Linux, Mac OS X, Windows, License type GPLv3, GPL, Commercial, Free for academic use, Language C++, Perl, Java, C, Phyton Interface Web Based, Integrated solutions, command line tools, pipelines, NGS Data analysis

117 Which software for NGS (data) analysis? Answer is not straightforward. Many possible classifications Biological domains SNP discovery, Genomics, ChIP-Seq, De-novo assembly, Bioinformatics methods Mapping, Assembly, Alignment, Seq-QC, Technology Illumina, 454, ABI SOLID, Helicos, Operating system Linux, Mac OS X, Windows, License type GPLv3, GPL, Commercial, Free for academic use, Language C++, Perl, Java, C, Phyton Interface Web Based, Integrated solutions, command line tools, pipelines, NGS Data analysis

118 Some popular tools and places NGS Data analysis

119 Galaxy Site 11 9

120 Obtain data from many data sources including the UCSC Table Browser, BioMart, WormBase, or your own data. Prepare data for further analysis by rearranging or cutting data columns, filtering data and many other actions. Analyze data by finding overlapping regions, determining statistics, phylogenetic analysis and much more 12 0

121 User Register contains links to the downloading, pre-procession and analysis tools displays menus and data inputs Shows the history of analysis steps, data and result viewing 12 1

122 Click Get Data 12 2

123 Get Data from Database 12 3

124 Upload File File Format Upload or paste file 12 4

125 12 5

126 FASTQ file manipulation: format conversation, summary statistics, trimming reads, filtering reads by quality score

127 Input: sanger FASTQ Output: SAM format

128 Downstream analysis: SAM -> BAM

129 List saved histories and shared histories. Work on a current history, create new, share workflow Co py rig ht Op en He lix. No us e or re pr od uct ion wit ho ut ex pr es s wri tte n co ns en 12 t9

130 Creates a workflow, allows user to repeat analysis using different datasets.

131 DATA VISUALIZATION NGS Data analysis

132 History of Genome Visualization 1800s 1900s 2000s time

133 Why is visualization important? make large amounts of data more interpretable glean patterns from the data sanity check / visual debugging more

134 What is a Genome Browser linear representation of a genome position-based annotations, each called a track continuous annotations: e.g. conservation interval annotations: e.g. gene, read alignment point annotations: e.g. SNPs user specifies a subsectionof genome to look at

135 Server-side model (e.g. UCSC, Ensembl, Gbrowse) server central data store renders images sends to client client requests images displays images

136 Client-side model (e.g. Savant, IGV) server stores data client local HTS store renders images displays images HTS machine

137 Rough comparison of Genome Browsers UCSC Ensem GBrows Savant IGV Model Server Server bl Server e Client Client Interactive HTS support Database of tracks Plugins No support Some support Good support

138 Limitations of most genome browsers do not support multiple genomes simultaneously do not capture 3-dimensional conformation do not capture spatial or temporal information do not integrate well with analytics cannot be customized The SAVANT GENOME BROWSER has been created to overcome these limitations

139 Integrative Genomics Viewer (IGV) he Integrative Genomics Viewer (IGV) is a high-performance visualization tool for interactive exploration of large, integrated datasets. It supports a wide variety of data types including sequence alignments, microarrays, and genomic annotations.

140 Acknowledgements Grupo de investigación en Estadística y Bioinformática del departamento de Estadística de la Universidad de Barcelona. All the members at the Unitat d Estadística i Bioinformàtica del VHIR (Vall d Hebron Institut de Recerca) Unitat de Serveis Científico Tècnics (UCTS) del VHIR (Vall d Hebron Institut de Recerca) People whose materials have been borrowed or who have contributed with their work Manel Comabella, Rosa Prieto, Paqui Gallego, Javier Santoyo, Ana Conesa, Thomas Girke and Silvia Cardona. NGS Data analysis

141 Gracias por la atención y la paciencia NGS Data analysis

LA EVOLUCIÓN DE LA GENÓMICA

LA EVOLUCIÓN DE LA GENÓMICA UAM 10 julio 2014 1 LA EVOLUCIÓN DE LA GENÓMICA 2 LOS DOS OBJETIVOS DE LA GENÓMICA IDENTIFICAR GENES CUANTIFICAR GENES DNA & RNA 3 CONOCER LOS GENES Y SUS VARIANTES IMPACTA EN EL ESTADO DE SALUD Y ENFERMEDAD

Más detalles

Aplicaciones y Tendencias en secuenciación de ADN

Aplicaciones y Tendencias en secuenciación de ADN Aplicaciones y Tendencias en secuenciación de ADN Agus%n Arasanz Duque Unidad de Genómica Centres Cien%fics i Tecnològics Universidad de Barcelona Aplicaciones y Tendencias en secuenciación de ADN Introducción

Más detalles

Agustiniano Ciudad Salitre School Computer Science Support Guide - 2015 Second grade First term

Agustiniano Ciudad Salitre School Computer Science Support Guide - 2015 Second grade First term Agustiniano Ciudad Salitre School Computer Science Support Guide - 2015 Second grade First term UNIDAD TEMATICA: INTERFAZ DE WINDOWS LOGRO: Reconoce la interfaz de Windows para ubicar y acceder a los programas,

Más detalles

manual de servicio nissan murano z51

manual de servicio nissan murano z51 manual de servicio nissan murano z51 Reference Manual To understand featuring to use and how to totally exploit manual de servicio nissan murano z51 to your great advantage, there are several sources of

Más detalles

Sesión 3: PL 2b: Sistema para la adquisición de señales analógicas.

Sesión 3: PL 2b: Sistema para la adquisición de señales analógicas. Sesión 3: PL 2b: Sistema para la adquisición de señales analógicas. 1 Objetivo... 3 Signal Logging Basics... 3 Configure File Scope (xpc) Blocks... 3 File Scope Usage... 4 Create File Scopes Using xpc

Más detalles

ANÁLISIS Y DESARROLLO DE UNA PLATAFORMA BIG DATA

ANÁLISIS Y DESARROLLO DE UNA PLATAFORMA BIG DATA ANÁLISIS Y DESARROLLO DE UNA PLATAFORMA BIG DATA Autor: de la Cierva Perreau de Pinninck, Leticia Director: Sonia García, Mario Tenés Entidad Colaboradora: VASS RESUMEN DEL PROYECTO Tras la realización

Más detalles

2001 < + 2006 89:8"I%;(

2001 < + 2006 89:8I%;( ! "#$ $%&"'( ))! - ' (()*+ 1953 1977./0 1 / + 1973./, C).0-1975 1987./,C)- 5+,.0- + *+, -+./0123 "#$% 4 55167 %( '-9 $) "';1A2+ ' (()*+, '(()*+ 1996 2005 200 7 2008 23 D4 5)" / %E (+ 2001 < + %2A(512F5G

Más detalles

Universidad de Guadalajara

Universidad de Guadalajara Universidad de Guadalajara Centro Universitario de Ciencias Económico-Administrativas Maestría en Tecnologías de Información Ante-proyecto de Tésis Selection of a lightweight virtualization framework to

Más detalles

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain)

iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) iclef-2002 at Universities of Alicante and Jaen University of Alicante (Spain) ! Introduction! Passage Retrieval Systems! IR-n system! IR-n system at iclef-2002! Conclusions and Future works ! Introduction!

Más detalles

Plataforma de Genómica

Plataforma de Genómica Plataforma de Genómica Dr. Víctor J. Asensio Técnico de Plataforma 27 de febrero de 2015 La Plataforma de Genómica del IdisPa está ubicada en el Hospital Universitario Son Espases; consta de dos salas

Más detalles

Propiedades del Mineral en Molinos SAG y AG Ahorrando tiempo y dinero con MetSMART: Probando y Simulando la Dureza del Mineral

Propiedades del Mineral en Molinos SAG y AG Ahorrando tiempo y dinero con MetSMART: Probando y Simulando la Dureza del Mineral Propiedades del Mineral en Molinos SAG y AG Ahorrando tiempo y dinero con MetSMART: Probando y Simulando la Dureza del Mineral Ore Properties in AG/SAG Mill Saving Time and Money with MetSMART: Testing

Más detalles

Matemáticas Muestra Cuadernillo de Examen

Matemáticas Muestra Cuadernillo de Examen Matemáticas Muestra Cuadernillo de Examen Papel-Lápiz Formato Estudiante Español Versión, Grados 3-5 Mathematics Sample Test Booklet Paper-Pencil Format Student Spanish Version, Grades 3 5 Este cuadernillo

Más detalles

Qué viva la Gráfica de Cien!

Qué viva la Gráfica de Cien! Qué viva la Gráfica de Cien! La gráfica de cien consiste en números del 1 al 100 ordenados en cuadrilones de diez números en hileras. El resultado es que los estudiantes que utilizan estás gráficas pueden

Más detalles

ESTUDIO, ANÁLISIS Y EVALUACIÓN DEL ENTORNO DE TRABAJO HADOOP. Entidad Colaboradora: ICAI Universidad Pontificia Comillas

ESTUDIO, ANÁLISIS Y EVALUACIÓN DEL ENTORNO DE TRABAJO HADOOP. Entidad Colaboradora: ICAI Universidad Pontificia Comillas ESTUDIO, ANÁLISIS Y EVALUACIÓN DEL ENTORNO DE TRABAJO HADOOP. Autor: Director: Rubio Echevarria, Raquel Contreras Bárcena, David Entidad Colaboradora: ICAI Universidad Pontificia Comillas RESUMEN DEL PROYECTO

Más detalles

ADAPTACIÓN DE REAL TIME WORKSHOP AL SISTEMA OPERATIVO LINUX

ADAPTACIÓN DE REAL TIME WORKSHOP AL SISTEMA OPERATIVO LINUX ADAPTACIÓN DE REAL TIME WORKSHOP AL SISTEMA OPERATIVO LINUX Autor: Tomás Murillo, Fernando. Director: Muñoz Frías, José Daniel. Coordinador: Contreras Bárcena, David Entidad Colaboradora: ICAI Universidad

Más detalles

Disfruten su verano! Hola estudiantes,

Disfruten su verano! Hola estudiantes, Hola estudiantes, We hope that your experience during Spanish 1 was enjoyable and that you are looking forward to improving your ability to communicate in Spanish. As we all know, it is very difficult

Más detalles

Guide to Health Insurance Part II: How to access your benefits and services.

Guide to Health Insurance Part II: How to access your benefits and services. Guide to Health Insurance Part II: How to access your benefits and services. 1. I applied for health insurance, now what? Medi-Cal Applicants If you applied for Medi-Cal it will take up to 45 days to find

Más detalles

Welcome to lesson 2 of the The Spanish Cat Home learning Spanish course.

Welcome to lesson 2 of the The Spanish Cat Home learning Spanish course. Welcome to lesson 2 of the The Spanish Cat Home learning Spanish course. Bienvenidos a la lección dos. The first part of this lesson consists in this audio lesson, and then we have some grammar for you

Más detalles

Catálogo de Servicios GenXPro

Catálogo de Servicios GenXPro Catálogo de Servicios GenXPro Aplicando las mejores y más sensibles técnicas de preparación de muestras, en combinación con las técnicas más modernas de secuenciación de última generación, GenXPro ofrece

Más detalles

SOFTWARE PARA LA GESTIÓN INFORMÁTICA DE UNA CLÍNICA DENTAL

SOFTWARE PARA LA GESTIÓN INFORMÁTICA DE UNA CLÍNICA DENTAL SOFTWARE PARA LA GESTIÓN INFORMÁTICA DE UNA CLÍNICA DENTAL Autora: Laura Martín García Director: Alberto Ciudad Sánchez RESUMEN El objetivo de este proyecto es realizar el análisis, diseño y desarrollo

Más detalles

Point of sale. Dossier punto de venta

Point of sale. Dossier punto de venta Point of sale Dossier punto de venta Energy Sistem Starts at your Point of Sale Energy Sistem, parte de tu punto de venta Many purchasing decisions are taken at the P.O.S. Energy Sistem believes in communication

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

Facilities and manufacturing

Facilities and manufacturing Facilities and manufacturing diseño y producción design and production Roomdimensions Ibérica,s.l (RDI) es una empresa experta en la fabricación de mobiliario técnico, diseño integral de soluciones arquitectónicas

Más detalles

RFID TEMPERATURE SENSOR. Autor: Polo Tascón, David. Director: Kramer, Kathleen. Entidad colaboradora: Advantageous Systems LLC.

RFID TEMPERATURE SENSOR. Autor: Polo Tascón, David. Director: Kramer, Kathleen. Entidad colaboradora: Advantageous Systems LLC. RFID TEMPERATURE SENSOR. Autor: Polo Tascón, David. Director: Kramer, Kathleen. Entidad colaboradora: Advantageous Systems LLC. RESUMEN DEL PROYECTO Existen casos en la industria de la tecnología, medicina,

Más detalles

Mi ciudad interesante

Mi ciudad interesante Mi ciudad interesante A WebQuest for 5th Grade Spanish Designed by Jacob Vuiller jvuiller@vt.edu Introducción Tarea Proceso Evaluación Conclusión Créditos Introducción Bienvenidos! Eres alcalde de una

Más detalles

Introducción a la Ingeniería de Software. Diseño Interfaz de Usuario

Introducción a la Ingeniería de Software. Diseño Interfaz de Usuario Introducción a la Ingeniería de Software Diseño Interfaz de Usuario Diseño de la Interfaz de Usuario Normalmente no se contratan especialistas Hay casos en los cuales es más normal: videojuegos y sitiosweb

Más detalles

In the following you see an example of a SPAC calculation run. BKtel systems 26.07.2004 Seite 1/8

In the following you see an example of a SPAC calculation run. BKtel systems 26.07.2004 Seite 1/8 SPAC (System Performance Analysis for CATV Systems) is a tool for planning the performance of CATV distribution networks and their return path channel. SPAC calculates all important system parameters like

Más detalles

Brief Introduction to Docking and Virtual Screening with Autodock4 and Autodock Tools

Brief Introduction to Docking and Virtual Screening with Autodock4 and Autodock Tools Brief Introduction to Docking and Virtual Screening with Autodock4 and Autodock Tools Environment set up Launch AutoDock Tools Gui. Aplicaciones --> MGLTools-1.5.4 --> AutoDockTools-1.5.4 You should see

Más detalles

TOUCH MATH. Students will only use Touch Math on math facts that are not memorized.

TOUCH MATH. Students will only use Touch Math on math facts that are not memorized. TOUCH MATH What is it and why is my child learning this? Memorizing math facts is an important skill for students to learn. Some students have difficulty memorizing these facts, even though they are doing

Más detalles

Tema: Study for the Analysis and the Conceptual Development of a European Port Access System. Ponente: Mario J. Moya Denia

Tema: Study for the Analysis and the Conceptual Development of a European Port Access System. Ponente: Mario J. Moya Denia Tema: Study for the Analysis and the Conceptual Development of a European Port Access System Introduction EPAIC I (European Port Access Identification Card) study, completed in 2008, concluded that there

Más detalles

Expresión de la información genética en eucariotas. metodologías de estudio 1. Qué se transcribe?

Expresión de la información genética en eucariotas. metodologías de estudio 1. Qué se transcribe? Expresión de la información genética en eucariotas similitudes y diferencias con procariotas metodologías de estudio 1 Víctor Romanowski, 2013 Qué se transcribe? Los genes son segmentos del genoma que

Más detalles

Single Cell Genomics. María Méndez Lago. Seminario tecnológico Facultad de Farmacia, UB 5.05.2015

Single Cell Genomics. María Méndez Lago. Seminario tecnológico Facultad de Farmacia, UB 5.05.2015 Single Cell Genomics María Méndez Lago 5.05.2015 Seminario tecnológico Facultad de Farmacia, UB Contenido 1. Introducción a la secuenciación de nueva generación (NGS) y a la genómica de células individuales

Más detalles

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó

MANUAL EASYCHAIR. A) Ingresar su nombre de usuario y password, si ya tiene una cuenta registrada Ó MANUAL EASYCHAIR La URL para enviar su propuesta a la convocatoria es: https://easychair.org/conferences/?conf=genconciencia2015 Donde aparece la siguiente pantalla: Se encuentran dos opciones: A) Ingresar

Más detalles

ETS APPs 26.10.2012 MATELEC 2012. Nuevas Funciones para ETS. Madrid. Casto Cañavate KNX Association International

ETS APPs 26.10.2012 MATELEC 2012. Nuevas Funciones para ETS. Madrid. Casto Cañavate KNX Association International ETS APPs Nuevas Funciones para ETS 26.10.2012 MATELEC 2012 Madrid Casto Cañavate KNX Association International KNX Association International Page No. 2 Introducción Diversidad de Proyectos Viviendas Oficinas

Más detalles

NubaDat An Integral Cloud Big Data Platform. Ricardo Jimenez-Peris

NubaDat An Integral Cloud Big Data Platform. Ricardo Jimenez-Peris NubaDat An Integral Cloud Big Data Platform Ricardo Jimenez-Peris NubaDat Market Size 3 Market Analysis Conclusions Agenda Value Proposition Product Suite Competitive Advantages Market Gaps Big Data needs

Más detalles

SISTEMA DE GESTIÓN Y ANÁLISIS DE PUBLICIDAD EN TELEVISIÓN

SISTEMA DE GESTIÓN Y ANÁLISIS DE PUBLICIDAD EN TELEVISIÓN SISTEMA DE GESTIÓN Y ANÁLISIS DE PUBLICIDAD EN TELEVISIÓN Autor: Barral Bello, Alfredo Director: Alcalde Lancharro, Eduardo Entidad Colaboradora: Media Value S.L. RESUMEN DEL PROYECTO El presente proyecto

Más detalles

SCADA BASADO EN LABVIEW PARA EL LABORATORIO DE CONTROL DE ICAI

SCADA BASADO EN LABVIEW PARA EL LABORATORIO DE CONTROL DE ICAI SCADA BASADO EN LABVIEW PARA EL LABORATORIO DE CONTROL DE ICAI Autor: Otín Marcos, Ana. Directores: Rodríguez Pecharromán, Ramón. Rodríguez Mondéjar, José Antonio. Entidad Colaboradora: ICAI Universidad

Más detalles

A1 Second level. Timeline. Servicio Nacional de Aprendizaje - SENA. Reservados todos los derechos 2013.

A1 Second level. Timeline. Servicio Nacional de Aprendizaje - SENA. Reservados todos los derechos 2013. A1 Second level Timeline Start UP Welcome Hi! It s great to see you again! It s time to learn how to make a timeline to talk about past events of our lives in a sequential manner. Let s begin! 2 /9 Warm

Más detalles

IRS DATA RETRIEVAL NOTIFICATION DEPENDENT STUDENT ESTIMATOR

IRS DATA RETRIEVAL NOTIFICATION DEPENDENT STUDENT ESTIMATOR IRS DATA RETRIEVAL NOTIFICATION DEPENDENT STUDENT ESTIMATOR Subject: Important Updates Needed for Your FAFSA Dear [Applicant], When you completed your 2012-2013 Free Application for Federal Student Aid

Más detalles

HERRAMIENTA PARA LA OPTIMIZACIÓN DEL PORFOLIO DE PRODUCTOS DE LAS REDES DE VENTAS DE UN LABORATORIO FARMACÉUTICO

HERRAMIENTA PARA LA OPTIMIZACIÓN DEL PORFOLIO DE PRODUCTOS DE LAS REDES DE VENTAS DE UN LABORATORIO FARMACÉUTICO HERRAMIENTA PARA LA OPTIMIZACIÓN DEL PORFOLIO DE PRODUCTOS DE LAS REDES DE VENTAS DE UN LABORATORIO FARMACÉUTICO Autor: Tárano Pastor, Ramón. Director: Moreno Alonso, Pablo. Director: Ruiz del Palacio,

Más detalles

DISEÑO DE UN CRONOTERMOSTATO PARA CALEFACCIÓN SOBRE TELÉFONOS MÓVILES. Entidad Colaboradora: ICAI Universidad Pontificia Comillas.

DISEÑO DE UN CRONOTERMOSTATO PARA CALEFACCIÓN SOBRE TELÉFONOS MÓVILES. Entidad Colaboradora: ICAI Universidad Pontificia Comillas. DISEÑO DE UN CRONOTERMOSTATO PARA CALEFACCIÓN SOBRE TELÉFONOS MÓVILES Autor: Sánchez Gómez, Estefanía Dolores. Directores: Pilo de la Fuente, Eduardo. Egido Cortés, Ignacio. Entidad Colaboradora: ICAI

Más detalles

Speak Up! In Spanish. Young s Language Consulting. Young's Language Consulting. Lesson 1 Meeting and Greeting People.

Speak Up! In Spanish. Young s Language Consulting. Young's Language Consulting. Lesson 1 Meeting and Greeting People. Buenos días Good morning Buenos días Good afternoon Buenas tardes Good evening Buenas tardes Good night Buenas noches Sir Señor Ma am/mrs. Señora Miss Señorita Buenas tardes Culture Note: When greeting

Más detalles

INSTRUCCIONES PARA ENVIAR SU PELICULA PARA LA VIDEOLIBRERIA

INSTRUCCIONES PARA ENVIAR SU PELICULA PARA LA VIDEOLIBRERIA For English version, please scroll down to page 11 (eleven) INSTRUCCIONES PARA ENVIAR SU PELICULA PARA LA VIDEOLIBRERIA Especificaciones técnicas Container format:.mp4 / tamaño de archivo no superior a

Más detalles

Entrevista: el medio ambiente. A la caza de vocabulario: come se dice en español?

Entrevista: el medio ambiente. A la caza de vocabulario: come se dice en español? A la caza de vocabulario: come se dice en español? Entrevista: el medio ambiente 1. There are a lot of factories 2. The destruction of the ozone layer 3. In our city there is a lot of rubbish 4. Endangered

Más detalles

PROBLEMAS PARA LA CLASE DEL 20 DE FEBRERO DEL 2008

PROBLEMAS PARA LA CLASE DEL 20 DE FEBRERO DEL 2008 PROBLEMAS PARA LA CLASE DEL 20 DE FEBRERO DEL 2008 Problema 1 Marketing estimates that a new instrument for the analysis of soil samples will be very successful, moderately successful, or unsuccessful,

Más detalles

Connection from School to Home Kindergarten Math Module 2 Topic A. Making 3 with Triangles and Chips

Connection from School to Home Kindergarten Math Module 2 Topic A. Making 3 with Triangles and Chips Connection from School to Home Kindergarten Math Module 2 Topic A Making 3 with Triangles and Chips Here is a simple activity to help your child learn about composing and decomposing the number 3 and analyzing

Más detalles

From e-pedagogies to activity planners. How can it help a teacher?

From e-pedagogies to activity planners. How can it help a teacher? From e-pedagogies to activity planners. How can it help a teacher? Elena de Miguel, Covadonga López, Ana Fernández-Pampillón & Maria Matesanz Universidad Complutense de Madrid ABSTRACT Within the framework

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

RNA-seq y Anotación Funcional. Ana Conesa & Diego de Pannis 26-28 Noviembre 2013 FCEyN UBA. Ciudad Universitaria Buenos Aires, Argentina

RNA-seq y Anotación Funcional. Ana Conesa & Diego de Pannis 26-28 Noviembre 2013 FCEyN UBA. Ciudad Universitaria Buenos Aires, Argentina RNA-seq y Anotación Funcional Ana Conesa & Diego de Pannis 26-28 Noviembre 2013 FCEyN UBA. Ciudad Universitaria Buenos Aires, Argentina Programa Dia 1 Mañana: Introducción a RNA- seq Introducción a las

Más detalles

Human-Centered Approaches to Data Mining: Where does Culture meet Statistics?

Human-Centered Approaches to Data Mining: Where does Culture meet Statistics? Human-Centered Approaches to Data Mining: Where does Culture meet Statistics? Manuel Cebrián & Alejandro (Alex) Jaimes ICT 2008 Collective Intelligence Networking Nov. 26, 2008 Leading PROGRESS Outline

Más detalles

Steps to Understand Your Child s Behavior. Customizing the Flyer

Steps to Understand Your Child s Behavior. Customizing the Flyer Steps to Understand Your Child s Behavior Customizing the Flyer Hello! Here is the PDF Form Template for use in advertising Steps to Understanding Your Child s Behavior (HDS Behavior Level 1B). Because

Más detalles

Centro Nacional Genotipado

Centro Nacional Genotipado Centro Nacional Genotipado Anna Gonzalez-Neira Centro Nacional de Investigaciones Oncológicas (CNIO) Qué es el CeGen? El CeGen es una plataforma tecnológica, iniciativa de GENOMA ESPAÑA, que tiene por

Más detalles

Puede pagar facturas y gastos periódicos como el alquiler, el gas, la electricidad, el agua y el teléfono y también otros gastos del hogar.

Puede pagar facturas y gastos periódicos como el alquiler, el gas, la electricidad, el agua y el teléfono y también otros gastos del hogar. SPANISH Centrepay Qué es Centrepay? Centrepay es la manera sencilla de pagar sus facturas y gastos. Centrepay es un servicio de pago de facturas voluntario y gratuito para clientes de Centrelink. Utilice

Más detalles

Reinforcement Plan. Day 27 Month 03 Year 2015

Reinforcement Plan. Day 27 Month 03 Year 2015 BETHLEMITAS SCHOOL Reinforcement Plan Day 27 Month 03 Year 2015 TERM: I Date: COMPREHENSION GOAL: The students develop comprehension about the Living and Non- living things, plants, animals and their main

Más detalles

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA 1. DESCRIPCIÓN DEL SERVICIO El servicio de Secuenciación Masiva tiene como finalidad el proporcionar asesoramiento y soporte técnico a los grupos de investigación interesados en realizar proyectos de ultrasecuenciación.

Más detalles

Karina Ocaña Izquierdo

Karina Ocaña Izquierdo Estudié Ingeniería en Sistemas Computacionales (1997) y una Maestría en Ingeniería de Cómputo con especialidad en Sistemas Digitales (2000), ambas en el Instituto Politécnico Nacional (México). En el 2003,

Más detalles

Adaptación y Configuración de Procesos de Software Tailoring and Configuration of Software Processes

Adaptación y Configuración de Procesos de Software Tailoring and Configuration of Software Processes Adaptación y Configuración de Procesos de Software Tailoring and Configuration of Software Processes Rodolfo Villarroel Acevedo 1* 1 Pontificia Universidad Católica de Valparaíso. Avenida Brasil 2241,

Más detalles

Contents. Introduction. Aims. Software architecture. Tools. Example

Contents. Introduction. Aims. Software architecture. Tools. Example ED@CON Control Results Management Software Control with Remote Sensing Contents Introduction Aims Software architecture Tools Example Introduction Control results management software (Ed@con) is a computer

Más detalles

APLICACIÓN WEB BASADA EN UNA SOLUCIÓN EN SAP R/3 PARA EL MANTENIMIENTO DE TRENES

APLICACIÓN WEB BASADA EN UNA SOLUCIÓN EN SAP R/3 PARA EL MANTENIMIENTO DE TRENES APLICACIÓN WEB BASADA EN UNA SOLUCIÓN EN SAP R/3 PARA EL MANTENIMIENTO DE TRENES Autor: Alberny, Marion. Director: Alcalde Lancharro, Eduardo. Entidad Colaboradora: CGI. RESUMEN DEL PROYECTO La mayoría

Más detalles

Edgar Quiñones. HHRR: Common Sense Does Not Mean Business. Objective

Edgar Quiñones. HHRR: Common Sense Does Not Mean Business. Objective Edgar Quiñones HHRR: Common Sense Does Not Mean Business Objective Share experiences & insight gained in the last two decades in the management consulting business regarding why Common Sense Does Not Mean

Más detalles

VALE LA PENA INVERTIR EN TECNOLOGÍAS RENOVABLES?

VALE LA PENA INVERTIR EN TECNOLOGÍAS RENOVABLES? Palabras Clave Conservar renovable invertir proceder maximizar!!! Únete al debate nacional! VALE LA PENA INVERTIR EN TECNOLOGÍAS RENOVABLES? WORD GENERATION Unidad 2.15 Lectura Semanal! El!BigBelly!es!una!papelera!(o!basurero)!

Más detalles

Los ensayos que se van a desarrollar son los siguientes:

Los ensayos que se van a desarrollar son los siguientes: I Resumen El objetivo principal del proyecto es desarrollar un software que permita analizar unos datos correspondientes a una serie de ensayos militares. Con este objetivo en mente, se ha decidido desarrollar

Más detalles

La Biología Molecular Aplicada a la detección de patógenos en alimentos

La Biología Molecular Aplicada a la detección de patógenos en alimentos La Biología Molecular Aplicada a la detección de patógenos en alimentos La detección fiable y rápida de microorganismos patógenos en el mercado alimentario es de especial importancia no sólo por sus efectos

Más detalles

Protocolo de desarrollo y producción de paneles génicos de apoyo al diagnóstico

Protocolo de desarrollo y producción de paneles génicos de apoyo al diagnóstico PÁGINA 1 de 14 Protocolo de desarrollo y producción de paneles génicos de apoyo al diagnóstico MODIFICACIONES RESPECTO A LA EDICIÓN ANTERIOR Elaborado por: Dra. Ana F. Marmiesse Revisado por: Aprobado

Más detalles

Learning Masters. Fluent: States of Matter

Learning Masters. Fluent: States of Matter Learning Masters Fluent: States of Matter What I Learned List the three most important things you learned in this theme. Tell why you listed each one. 1. 2. 3. 22 States of Matter Learning Masters How

Más detalles

UNIVERSIDAD NACIONAL MAYOR DE SAN MARCOS UNIDAD DE POSTGRADO DE INGENIERÍA DE SISTEMAS E INFORMATICA

UNIVERSIDAD NACIONAL MAYOR DE SAN MARCOS UNIDAD DE POSTGRADO DE INGENIERÍA DE SISTEMAS E INFORMATICA UNIVERSIDAD NACIONAL MAYOR DE SAN MARCOS UNIDAD DE POSTGRADO DE INGENIERÍA DE SISTEMAS E INFORMATICA DISEÑO E IMPLEMENTACIÓN DE UNA OFICINA DE GESTION DE PROYECTOS PARA LA POSITIVA SEGUROS Informe Profesional

Más detalles

Sistema de Control Domótico

Sistema de Control Domótico UNIVERSIDAD PONTIFICIA COMILLAS ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA (ICAI) INGENIERO EN ELECTRÓNICA Y AUTOMATICA PROYECTO FIN DE CARRERA Sistema de Control Domótico a través del bus USB Directores:

Más detalles

System Management: como elemento diferencial para alcanzar sus objetivos

System Management: como elemento diferencial para alcanzar sus objetivos Juan Paulo Cabezas Especialista de Ventas de Soluciones de Seguridad para IBM Latino America Junio 2010 System Management: como elemento diferencial para alcanzar sus objetivos Agenda Problemática y nuestra

Más detalles

ESTUDIO, PLANIFICACIÓN Y GESTIÓN DE LA IMPLEMENTACIÓN DE UN SISTEMA BIG DATA PARA LA MONITORIZACIÓN EXTREMO A EXTREMO DE SERVICIOS DE CLIENTE

ESTUDIO, PLANIFICACIÓN Y GESTIÓN DE LA IMPLEMENTACIÓN DE UN SISTEMA BIG DATA PARA LA MONITORIZACIÓN EXTREMO A EXTREMO DE SERVICIOS DE CLIENTE ESTUDIO, PLANIFICACIÓN Y GESTIÓN DE LA IMPLEMENTACIÓN DE UN SISTEMA BIG DATA PARA LA MONITORIZACIÓN EXTREMO A EXTREMO DE SERVICIOS DE CLIENTE Autor: Giménez González, José Manuel. Director: Romero Orobio,

Más detalles

Diseño y fabricación de expositores PLV. Design and fabrication of POP displays

Diseño y fabricación de expositores PLV. Design and fabrication of POP displays Diseño y fabricación de expositores PLV Design and fabrication of POP displays Empresa Company Soluciones para el diseño y fabricación de expositores PLV Solutions design and manufacture POP displays Con

Más detalles

INNOVACIÓN Tecnologías de información La nueva Era. Javier Cordero Torres Presidente y Director General Oracle México Febrero 27, 2015

INNOVACIÓN Tecnologías de información La nueva Era. Javier Cordero Torres Presidente y Director General Oracle México Febrero 27, 2015 INNOVACIÓN Tecnologías de información La nueva Era Javier Cordero Torres Presidente y Director General Oracle México Febrero 27, 2015 Oracle Confidential Internal/Restricted/Highly Restricted 3 4 OF WORLD

Más detalles

SISTEMA CONTROL DE ACCESOS A EDIFICIOS MEDIANTE TARJETAS CRIPTOGRÁFICAS Y TARJETAS DE RADIOFRECUENCIA (RFID)

SISTEMA CONTROL DE ACCESOS A EDIFICIOS MEDIANTE TARJETAS CRIPTOGRÁFICAS Y TARJETAS DE RADIOFRECUENCIA (RFID) SISTEMA CONTROL DE ACCESOS A EDIFICIOS MEDIANTE TARJETAS CRIPTOGRÁFICAS Y TARJETAS DE RADIOFRECUENCIA (RFID) Alumno: Velayos Sardiña, Marta Director: Palacios Hielscher, Rafael Entidad Colaboradora: ICAI

Más detalles

VI. Appendix VI English Phrases Used in Experiment 5, with their Spanish Translations Found in the Spanish ETD Corpus

VI. Appendix VI English Phrases Used in Experiment 5, with their Spanish Translations Found in the Spanish ETD Corpus VI. Appendix VI English Phrases Used in Experiment 5, with their Spanish Translations Found in the Spanish ETD Corpus App. VI. Table 1: The 155 English phrases and their Spanish translations discovered

Más detalles

WLAB SISTEMA DE CONTROL REMOTO EN TIEMPO REAL DE EQUIPOS DE LABORARIO. Directores: Rodríguez Pecharromán, Ramón. Palacios Hielscher, Rafael.

WLAB SISTEMA DE CONTROL REMOTO EN TIEMPO REAL DE EQUIPOS DE LABORARIO. Directores: Rodríguez Pecharromán, Ramón. Palacios Hielscher, Rafael. WLAB SISTEMA DE CONTROL REMOTO EN TIEMPO REAL DE EQUIPOS DE LABORARIO. Autor: Rodríguez de la Rosa, Alicia. Directores: Rodríguez Pecharromán, Ramón. Palacios Hielscher, Rafael. Entidad Colaboradora: ICAI

Más detalles

Benchmarking de Transporte México. Mayo 2013

Benchmarking de Transporte México. Mayo 2013 Benchmarking de Transporte México Mayo 2013 1 Benchmarking de Transporte México (Primario) Objetivo: El desarrollo de medidas comparativas (benchmarking) de aspectos cualitativos/cuantitativos del transporte

Más detalles

Tesis de Maestría titulada

Tesis de Maestría titulada Tesis de Maestría titulada EL ANALISIS DE CONFIABILIDAD COMO HERRAMIENTA PARA OPTIMIZAR LA GESTIÓN DEL MANTENIMIENTO DE LOS EQUIPOS DE LA LÍNEA DE FLOTACIÓN EN UN CENTRO MINERO RESUMEN En la presente investigación

Más detalles

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes

Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Sistemas de impresión y tamaños mínimos Printing Systems and minimum sizes Para la reproducción del Logotipo, deberán seguirse los lineamientos que se presentan a continuación y que servirán como guía

Más detalles

MANUAL DE INSTRUCCIONES CAJA FUERTE CF-4333

MANUAL DE INSTRUCCIONES CAJA FUERTE CF-4333 MANUAL DE INSTRUCCIONES CAJA FUERTE CF-4333 ESTIMADO CLIENTE Con el fin de que obtenga el mayor desempeño de su producto, por favor lea este manual de instrucciones cuidadosamente antes de comenzar a utilizarlo,

Más detalles

Comité de usuarios de la RES

Comité de usuarios de la RES Comité de usuarios de la RES Jordi Torra CURES Comité de usuarios de la RES (CURES) - Las grandes infraestructuras nacionales e internacionales tienen Comité de Usuarios - Es una obligación para las ICTS

Más detalles

REUNIÓN DE DIRECTORES DE LOS SNMH DEL ÁFRICA OCCIDENTAL (Banjul, Gambia del 1 al 5 febrero de 2010) Taller previo a la reunión sobre

REUNIÓN DE DIRECTORES DE LOS SNMH DEL ÁFRICA OCCIDENTAL (Banjul, Gambia del 1 al 5 febrero de 2010) Taller previo a la reunión sobre The Gambia REUNIÓN DE DIRECTORES DE LOS SNMH DEL ÁFRICA OCCIDENTAL (Banjul, Gambia del 1 al 5 febrero de 2010) Taller previo a la reunión sobre Movilización de Recursos y Apoyo Estratégico 1 y 2 de febrero

Más detalles

V. Appendix V: Experiment 5

V. Appendix V: Experiment 5 V. Appendix V: Experiment 5 171 172 173 Pre-Test Questions (Spanish version used in experiment): Antes de empezar, le pedimos que por favor conteste 5 breves preguntas. Cuál es su ID#? 1. Cuántos años

Más detalles

TRABAJO FIN DE MÁSTER MÁSTER DIRECCIÓN TIC JAIME RIVERO RAMOS

TRABAJO FIN DE MÁSTER MÁSTER DIRECCIÓN TIC JAIME RIVERO RAMOS TRABAJO FIN DE MÁSTER MÁSTER DIRECCIÓN TIC JAIME RIVERO RAMOS Fundación Computación y Tecnologías Avanzadas de Extremadura was established by the Junta de Extremadura as an organization in nature non-profit

Más detalles

Gaia en las universidades españolas y los centros de inves3gación

Gaia en las universidades españolas y los centros de inves3gación Gaia en las universidades españolas y los centros de inves3gación Ana Ulla Miguel (GGG) Depto. de Física Aplicada, Universidade de Vigo The GGG group is presently composed of the following members: Dra.

Más detalles

Forex ebook "My Book of Trading. Forex."

Forex ebook My Book of Trading. Forex. Forex ebook "My Book of Trading. Forex." "Dedicado a todos aquellos que piensan, que la vida es un continuo análisis de riesgo, que hay que ir valorando." "Dedicated to those who think that life is a continuous

Más detalles

DUAL IMMERSION PROGRAM INFORMATION PRESCHOOL PRESENTATION SEPTEMBER 10, 2014 6:30 P.M.

DUAL IMMERSION PROGRAM INFORMATION PRESCHOOL PRESENTATION SEPTEMBER 10, 2014 6:30 P.M. DUAL IMMERSION PROGRAM INFORMATION PRESCHOOL PRESENTATION SEPTEMBER 10, 2014 6:30 P.M. Presented by Dr. Norma R. Delgado, Director of Curriculum & Instruction 1 The United States Government has identified

Más detalles

PROYECTO INFORMÁTICO PARA LA CREACIÓN DE UN GESTOR DOCUMENTAL PARA LA ONG ENTRECULTURAS

PROYECTO INFORMÁTICO PARA LA CREACIÓN DE UN GESTOR DOCUMENTAL PARA LA ONG ENTRECULTURAS PROYECTO INFORMÁTICO PARA LA CREACIÓN DE UN GESTOR DOCUMENTAL PARA LA ONG ENTRECULTURAS Autor: García Lodares, Victor. Director: Castejón Silvo, Pedro. Entidad Colaboradora: Entreculturas. Resumen del

Más detalles

Please join us in circle. Please put on a nametag. Por favor, únete a nosotros en ronda. Ponte una etiqueta con su nombre.

Please join us in circle. Please put on a nametag. Por favor, únete a nosotros en ronda. Ponte una etiqueta con su nombre. Welcome! Bienvenido! Please join us in circle. Please put on a nametag. Por favor, únete a nosotros en ronda. Ponte una etiqueta con su nombre. Questions for You to Think About Preguntas para que pienses

Más detalles

EMPLOYER & EMPLOYEE RETIREMENT PLAN TAX CREDITS

EMPLOYER & EMPLOYEE RETIREMENT PLAN TAX CREDITS EMPLOYER & EMPLOYEE RETIREMENT PLAN TAX CREDITS For employers who set up and maintain retirement plans, the setup costs, annual administrative costs, and retirement-related employee education costs are

Más detalles

Estrategias para la secuenciación de Genomas y NGS

Estrategias para la secuenciación de Genomas y NGS Taller ensamblaje y anotación de Genomas y Metagenomas usando Galaxy Estrategias para la secuenciación de Genomas y NGS Alejandro Reyes PhD Sep=embre 12 de 2015 Universidad de los Andes El camino al genoma

Más detalles

Kuapay, Inc. Seminario Internacional Modernización de los medios de pago en Chile

Kuapay, Inc. Seminario Internacional Modernización de los medios de pago en Chile Kuapay, Inc. Seminario Internacional Modernización de los medios de pago en Chile Our value proposition Kuapay s motto and mission Convert electronic transactions into a commodity Easy Cheap!!! Accessible

Más detalles

Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos.

Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos. Universidad Nueva Esparta Facultad de Ciencias Administrativas Escuela de Administración de Diseño de un directorio Web de diseñadores gráficos, ilustradores y fotógrafos. Tutor: Lic. Beaujon, María Beatriz

Más detalles

SAFETY ROAD SHOW 2015 Paul Teboul Co Chairman HST México

SAFETY ROAD SHOW 2015 Paul Teboul Co Chairman HST México SAFETY ROAD SHOW 2015 Paul Teboul Co Chairman HST México How did started the Safety Road Show? Airbus Helicopters and others manufacturers did invest since a long time in improving Aviation Safety. In

Más detalles

Creating your Single Sign-On Account for the PowerSchool Parent Portal

Creating your Single Sign-On Account for the PowerSchool Parent Portal Creating your Single Sign-On Account for the PowerSchool Parent Portal Welcome to the Parent Single Sign-On. What does that mean? Parent Single Sign-On offers a number of benefits, including access to

Más detalles

Learning Masters. Early: Force and Motion

Learning Masters. Early: Force and Motion Learning Masters Early: Force and Motion WhatILearned What important things did you learn in this theme? I learned that I learned that I learned that 22 Force and Motion Learning Masters How I Learned

Más detalles

Instalación: Instalación de un agente en una máquina cliente y su registro en el sistema.

Instalación: Instalación de un agente en una máquina cliente y su registro en el sistema. HERRAMIENTA DE MONITORIZACIÓN DE SISTEMAS Autor: Sota Madorrán, Iñaki. Director: Igualada Moreno, Pablo. Entidad Colaboradora: Evotec Consulting, S.L. RESUMEN DEL PROYECTO El proyecto consiste en el diseño,

Más detalles

Learning Masters. Fluent: Wind, Water, and Sunlight

Learning Masters. Fluent: Wind, Water, and Sunlight Learning Masters Fluent: Wind, Water, and Sunlight What I Learned List the three most important things you learned in this theme. Tell why you listed each one. 1. 2. 3. 22 Wind, Water, and Sunlight Learning

Más detalles

A Member of My Community

A Member of My Community Connection from School to Home Kindergarten Social Studies Unit 1 A Member of My Community Here is an easy activity to help your child learn about what it means to be a member of a community. Here is what

Más detalles

TEDECO Tele-Conference

TEDECO Tele-Conference TEDECO Tele-Conference http://teteco.googlecode.com Ignacio Martín Oya Tutor: Jesús Martínez Mateo Tecnología para el Desarrollo y la Cooperación Facultad de Informática Universidad Politécnica de Madrid

Más detalles