SSI DERMATOPHYTE PCR KIT PRUEBA PCR DERMATOFITO

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "SSI DERMATOPHYTE PCR KIT PRUEBA PCR DERMATOFITO"

Transcripción

1 SSI DERMATOPHYTE PCR KIT PRUEBA PCR DERMATOFITO

2 2

3 Prueba de PCR para la detección de dermatofitos y Trichophyton rubrum Para uso diagnóstico in vitro Aplicación La prueba de PCR para dermatofitos en uñas ha sido desarrollada para su uso en la detección diagnóstica in vitro de dermatofitos en general (pan-dermatofitos) y, específicamente, Trichophyton rubrum. Descripción La prueba incluye un tampón A y otro B para la preparación de muestras, una PCR ReadyMix (que incluye tampón de carga), un cebador y dos muestras de ADN de control. El cebador contiene dos pares de base dirigidas a la codificación genética de la quitina sintetasa 1 para la detección de dermatofitos en general y ITS2 (espaciador interno de transcriptasa) para la detección de T. rubrum. Todas las bases son oligonucleótidos de secuencia única sintéticos con terminaciones de 5 - y 3 -hidroxil libres. Se añade al cebador plásmido de control interno que funciona como muestra para las bases 3

4 específicas de T. rubrum. El control 1 consiste en un ADN genómico de dermatofito y el control 2 consiste en un ADN genómico de T. rubrum. El kit contiene los suficientes reactivos para realizar 100 reacciones PCR multiplex. Antecedentes Las infecciones en las uñas están causadas principalmente por T. rubrum y T. mentagrophytes. Tradicionalmente, el tiempo necesario para la identificación de las especies mediante cultivo varia desde 10 y 15 días hasta 3 ó 4 semanas. Este método de diagnóstico basado en PCR 1 puede detectar dermatofitos en general y, específicamente, T. rubrum en 5 horas. A continuación se describen los tamaños de los amplicones para la identificación de un dermatofito en general o un T. rubrum. Gen Detección Tamaño del amplicón (pb) chs1 Pan-dermatofitos 366 its2 T. rubrum 203 ADN recombinante Control interno ~660 4

5 Materiales necesarios no incluidos Gel de agarosa 2.0 % Marcador de ADN Tubos para la preparación de muetras Procedimiento La preparación de muestras y la configuración PCR deberán realizarse en áreas específicas libres de posibles contaminantes. Preparación del ADN 1. Añada 100 µl de tampón A a la muestra de uña e incube a 95 ºC durante 10 minutos*. 2. Inmediatamente, añada 100 µl de tampón B y mezcle en el vortex. La muestra está lista para realizar la PCR. * Si la muestra de uña es de gran tamaño, deberá aumentarse la cantidad de tampón A para cubrir la muestra. Aumente el volumen del tampón B en la misma medida. Configuración de PCR 3. Prepare la master mix (PCR ReadyMix y cebador) acorde a la cantidad de muestras a analizar y dispense 18 µl de la mezcla en cada tubo. Cada tubo debe contener la siguiente cantidad de reactivos: 5

6 Muestra de uña Control positivo T. rubrum Control Pan-derm. positivo Control negativo PCR 10,0 µl 10,0 µl 10,0 µl 10,0 µl ReadyMix Cebador 8,0 µl 8,0 µl 8,0 µl 8,0 µl Muestra 2,0 µl de uña ADN - 2,0 µl - - T. rubrum ADN - - 2,0 µl - Pan-derm. Mezcla Tampón * ,0 µl Total 20,0 µl 20,0 µl 20,0 µl 20,0 µl * 1 Mezcla de tampón A y tampón B en una proporción de 1:1. 4. Realice la amplificación de la PCR en el termociclador bajo las siguientes condiciones. 6

7 Paso Temp. (ºC) Tiempo Desnaturalización 94 5 min. inicial 45 ciclos de: Desnaturalización seg. Hibridación seg. Extensión seg. Extensión final 72 3 min. 5. Coloque 18 µl de cada muestra de PCR amplificada en pocillos independientes en gel de agarosa al 2%. Interpretación de los resultados El gráfico muestra los resultados de PCR en comparación con un DNA Ladder de 100 pb. Una muestra de uña positiva en T. rubrum a menudo ofrece una banda fuerte de 203 pb y una banda más débil o inexistente a 366 pb debido al número de copia relativa superior de its2 en comparación con chs1. Del mismo modo, una muestra de uña positiva, a menudo, ofrece como resultado una banda de control interna débil o inexistente debido a las concentraciones relativas altas de pan-dermatofitos. 7

8 pb 600 pb Control interno (~660 pb) Pan-dermatofitos (366 pb) T. rubrum (203 pb) 100 pb Figura 1. Análisis de producto específico de T. rubrum y PCR multiplex de pan-dermatofitos. Pocillo 1: Marcador de tamaño molecular (DNA Ladder de 100 pb); Pocillo 2: ADN genómico de dermatofito (control 1); Pocillo 3: ADN genómico de T. rubrum (control 2); Pocillo 4: Muestra de uña positivo en pan-dermatofitos (débil); Pocillo 5: Muestra de uña positivo en pan-dermatofitos (fuerte); Pocillo 6: Muestra de uña positivo en T. rubrum; Calle 7: Muestra de uña negativo. Especificidad Se analizaronun total de 118 muestras de uñas en busca de infecciones de pan-dermatofitos o de T. rubrum siguiendo tanto el método de PCR multiplex como los métodos convencionales (microscopía y/o cultivo) 1. Los resultados fueron positivos para pan-dermatofitos en el 42,4 % de las muestras mediante PCR, mientras que el 38,1 % dio positivo con los métodos convencionales. La sensibilidad de la identificación 8

9 de pan-dermatofitos en muestras de uñas se aumentó en en un 4,3 % mediante el método de PCR multiplex. Además, la prueba mostró que la sensibilidad para la identificación de T. rubrum aumentó en un 18,6 % con el diagnóstico basado en PCR (ver tabla). Pan-dermatophytes T. rubrum Métodos convencionales 38,1 % 22,9 % PCR 42,4 % 41,5 % Aumento de sensibilidad 4,3 % 18,6 % 9

10 Conservación y caducidad Conservar a -20 ºC. La fecha de caducidad del kit está impresa en la etiqueta. Referencias 1. Brillowska-Dabrowska, A., Saunte, D. M. and Arendrup, M. C Five-Hour Diagnosis of Dermatophyte Nail Infection with Specific Detection of Trichophyton rubrum. Jour. Clin. Microbiol

11 11

12 SSI Diagnostica Herredsvejen 2 DK-3400 Hillerød Dinamarca T F w ssi.dk/ssidiagnostica Statens Serum Institut 1 a edición Mayo

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles

ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR

ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR Ref. PCRALU 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Lic. en Bioquímica Lic. en Biotecnología Microbiología de los Alimentos 2016 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente

Más detalles

PCR Múltiplex. Listeria monocytogenes

PCR Múltiplex. Listeria monocytogenes PCR Múltiplex Listeria monocytogenes PCR-múltiplex En una sola reacción de PCR se amplifican al mismo tiempo 2 o más genes Condiciones similares de PCR para los genes amplificar: Desnaturalización Alineamiento

Más detalles

SSI IMMUVIEW LEGIONELLA BLOOD TEST ANÁLISIS DE SANGRE IMMUVIEW LEGIONELLA

SSI IMMUVIEW LEGIONELLA BLOOD TEST ANÁLISIS DE SANGRE IMMUVIEW LEGIONELLA SSI IMMUVIEW LEGIONELLA BLOOD TEST ANÁLISIS DE SANGRE IMMUVIEW LEGIONELLA Aplicación El análisis de sangre ImmuView Legionella de Statens Serum Institute se ha creado para el diagnóstico de una infección

Más detalles

IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006

IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006 IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006 REACCION EN CADENA DE LA POLIMERASA (PCR) EN EL DIAGNOSTICO DE Campylobacter jejuni/coli Viernes 19 de mayo María Rosa Viñas Servicio

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

IMMUVIEW PRUEBA DE ANTÍGENOS URINARIOS PARA S. PNEUMONIAE Y L. PNEUMOPHILA ESPAÑOL

IMMUVIEW PRUEBA DE ANTÍGENOS URINARIOS PARA S. PNEUMONIAE Y L. PNEUMOPHILA ESPAÑOL IMMUVIEW PRUEBA DE ANTÍGENOS URINARIOS PARA S. PNEUMONIAE Y L. PNEUMOPHILA ESPAÑOL Para otras lenguas Para outros lenguas Für andere Sprachen Pour d autres langues Per le altre lingue For andre språk Для

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

1. Contaminación de agua y alimentos por microorganismos patógenos 1

1. Contaminación de agua y alimentos por microorganismos patógenos 1 INTRODUCCIÓN GENERAL 1. Contaminación de agua y alimentos por microorganismos patógenos 1 2. Papel del agua en la transmisión de enfermedades infecciosas 2 2.1. Las aguas residuales 2 2.2. El agua potable

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

3. MATERIALES Y MÉTODOS

3. MATERIALES Y MÉTODOS 3. MATERIALES Y MÉTODOS El proceso general llevado a cabo en la presente tesis se ilustra en el siguiente esquema: Exudado uretral/ cervical y/o biopsias Extracción del ADN PCR Digestión Algoritmo computacional:

Más detalles

La Patología a Molecular y el Control de Calidad

La Patología a Molecular y el Control de Calidad UNIDAD DIDÁCTICA 7: LOS PROCESOS EN ANATOMÍA PATOLÓGICA La Patología a Molecular y el Control de Calidad Asunción n Olmo Sevilla Master Diagnóstica S. L. Patología Molecular: Patología del futuro X Personal:

Más detalles

UNIVERSIDAD NACIONAL DE MISIONES Facultad de Ciencias Exactas Químicas y Naturales TRABAJO PRÁCTICO Nº 4 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

UNIVERSIDAD NACIONAL DE MISIONES Facultad de Ciencias Exactas Químicas y Naturales TRABAJO PRÁCTICO Nº 4 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) TRABAJO PRÁCTICO Nº 4 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) INTRODUCCIÓN La reacción en cadena de la polimerasa o PCR (del inglés Polymerase Chain Reaction) es una técnica relativamente simple y poderosa

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

2. ESTRATEGIA PARA EFECTUAR LA CLONACION Y EXPRESION DEL GEN

2. ESTRATEGIA PARA EFECTUAR LA CLONACION Y EXPRESION DEL GEN 1. CONTROL FINAL Nombre Internacional y nombre de la vacuna Nombre del propietario Nombre y dirección del fabricante Número de Lote Fecha de fabricación Fecha de caducidad Temperatura de almacenamiento

Más detalles

Instrucciones de uso. BAG Cycler Check. Kit de para la validación de la uniformidad de la temperatura en los termocicladores

Instrucciones de uso. BAG Cycler Check. Kit de para la validación de la uniformidad de la temperatura en los termocicladores Instrucciones de uso BAG Cycler Check Kit de para la validación de la uniformidad de la temperatura en los termocicladores listo para usar, prealicuotado REF 7104 (10 tests) REF 71044 (4 tests) Contenidos

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Fase aguda: Entre el 40% a 90% sintomáticos (similar mononucleosis) Fase crónica: asintomaticos El

Más detalles

Kit artus EBV QS-RGQ. Características de rendimiento. Mayo Sample & Assay Technologies. Sensibilidad analítica (plasma)

Kit artus EBV QS-RGQ. Características de rendimiento. Mayo Sample & Assay Technologies. Sensibilidad analítica (plasma) Kit artus EBV QS-RGQ Características de rendimiento Kit artus EBV QS-RGQ, versión 1, 4501363 Compruebe la disponibilidad de nuevas revisiones electrónicas de las especificaciones en www.qiagen.com/products/artusebvpcrkitce.aspx

Más detalles

12.359,04 IMPORTE MAXIMO LOTE 1: ,92 IMPORTE MAXIMO LOTE 2: IMPORTE MAXIMO LOTE 3: ,54 REACTIVOS PARA AISLAMIENTO DE ACIDOS NUCLEICOS

12.359,04 IMPORTE MAXIMO LOTE 1: ,92 IMPORTE MAXIMO LOTE 2: IMPORTE MAXIMO LOTE 3: ,54 REACTIVOS PARA AISLAMIENTO DE ACIDOS NUCLEICOS HOSPITAL RAMON Y CAJAL RAZON SOCIAL: SUMINISTROS - PETICION DE OFERTAS C.I.F.: SERVICIO DE GENETICA MEDICA DOMICILIO: LOCALIDAD: TRAMITA: HOSPITAL RAMON Y CAJAL TELEFONO/FAX: Nº DE COMPRA: CONCURSO ABIERTO

Más detalles

INTERPRETACIÓN DE GELES DE DNA DIGERIDOS CON ENZIMAS DE RESTRICCIÓN

INTERPRETACIÓN DE GELES DE DNA DIGERIDOS CON ENZIMAS DE RESTRICCIÓN INTERPRETACIÓN DE GELES DE DNA DIGERIDOS CON ENZIMAS DE RESTRICCIÓN El empleo de las enzimas de restricción y los plásmidos es habitual en el laboratorio de Biología Molecular. Con este ejercicio se pretende

Más detalles

HBsAg CONFIRMATORY TEST Para la confirmación de muestras positivas con el UMELISA HBsAg PLUS

HBsAg CONFIRMATORY TEST Para la confirmación de muestras positivas con el UMELISA HBsAg PLUS HBsAg CONFIRMATORY TEST Para la confirmación de muestras positivas con el UMELISA HBsAg PLUS INTERES CLÍNICO Con el descubrimiento del antígeno de superficie del virus de la Hepatitis B (1) se crearon

Más detalles

KIT PARA ESTUDIO MOLECULAR DE LA TRANSLOCACIÓN t(14;18) Nº CAT. MAD M-2/5 (20 DETERMINACIONES)

KIT PARA ESTUDIO MOLECULAR DE LA TRANSLOCACIÓN t(14;18) Nº CAT. MAD M-2/5 (20 DETERMINACIONES) KIT PARA ESTUDIO MOLECULAR DE LA TRANSLOCACIÓN t(14;18) Nº CAT. MAD-003997M-2/5 (20 DETERMINACIONES) El diagnóstico de los procesos linfoproliferativos se ha realizado tradicionalmente en base a las alteraciones

Más detalles

Utilidad clínica de la prueba de Captura de Híbridos en la detección del Cáncer del Cuello Uterino

Utilidad clínica de la prueba de Captura de Híbridos en la detección del Cáncer del Cuello Uterino Utilidad clínica de la prueba de Captura de Híbridos en la detección del Cáncer del Cuello Uterino Alejandro García Carrancá, PhD Jefe del Laboratorio de Virus y Cáncer Unidad de Investigación Biomédica

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

Química Biológica Patológica Técnicas de Biología Molecular aplicadas a Bioquímica Clínica Tema 2 Dra. Silvia Varas qbpatologica.unsl@gmail.com Tema 2 PCR Historia Bases Optimización de una reacción de

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

Taller Ciencia para Jóvenes CIMAT 2012 Bachillerato julio 8 14 Cinvestav Campus Guanajuato

Taller Ciencia para Jóvenes CIMAT 2012 Bachillerato julio 8 14 Cinvestav Campus Guanajuato Introducción Taller Ciencia para Jóvenes CIMAT 2012 Bachillerato julio 8 14 Cinvestav Campus Guanajuato Visita al CINVESTAV - Irapuato. 19 julio, 2012. Las bacterias son los organismos más abundantes que

Más detalles

DETECCIÓN DE MAÍZ TRANSGÉNICO POR PCR Ref. PCR6 (25 alumnos)

DETECCIÓN DE MAÍZ TRANSGÉNICO POR PCR Ref. PCR6 (25 alumnos) DETECCIÓN DE MAÍZ TRANSGÉNICO POR PCR Ref. PCR6 (25 alumnos) 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena

Más detalles

WITNESS RELAXIN (plasma, serum) RLX RLX u d 9 n n ersio V X RLX L R -W IO B S

WITNESS RELAXIN (plasma, serum) RLX RLX u d 9 n n ersio V X RLX L R -W IO B S WITNESS RELAXIN (plasma, serum) SBIO-W Version n 9 du 28.07.2010 WITNESS RELAXIN WITNESS RELAXIN GENERALIDADES El kit WITNESS RELAXIN permite diagnosticar la gestación en la perra y en la gata, y permite

Más detalles

figura1 : esquema PCR introducción a la PCR termocicladoresnahita

figura1 : esquema PCR introducción a la PCR termocicladoresnahita Gracias a sus altas prestaciones e increíble precio, los termocicladores Nahita son los equipos de elección de gran cantidad de laboratorios y centros de investigación para llevar a cabo la reacción en

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA. Estudio comparativo del diagnóstico del virus del PRRS por RT-PCR, PCR anidada y RT-PCR en tiempo real. Zoalli Angélica

Más detalles

PROCEDIMIENTO DETECCION NOROVIRUS RT-qPCR EN EXTRACTO VIRAL PROVENIENTE DE MOLUSCOS BIVALVOS. PRT-712.07.01-097 Página 1 de 7

PROCEDIMIENTO DETECCION NOROVIRUS RT-qPCR EN EXTRACTO VIRAL PROVENIENTE DE MOLUSCOS BIVALVOS. PRT-712.07.01-097 Página 1 de 7 PRT-712.07.01-097 Página 1 de 7 1. OBJETIVO Realizar la detección molecular de genes de Norovirus en muestras de moluscos bivalvos. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a concentrados

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD. Molecular

COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD. Molecular COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD Dra.. Flora Calzadilla Lugo Laboratorio de Genética Molecular POLIMORFISMO GENETICO Presencia en una población de múltiples un gen y que debe estar presente en el

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Bases Moleculares. Efrén Santos

Bases Moleculares. Efrén Santos Bases Moleculares Efrén Santos ADN, ARN, proteínas ADN, contiene la información genética ARN, muy similar al ADN. (1) Copia temporal del ADN (2) Parte funcional y estructural del aparato traductor Proteinas,

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

VALIDACIÓN Y CONTROL DE CALIDAD DE LOS MÉTODOS DE LA REACCIÓN EN CADENA DE LA POLIMERASA UTILIZADOS PARA EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS

VALIDACIÓN Y CONTROL DE CALIDAD DE LOS MÉTODOS DE LA REACCIÓN EN CADENA DE LA POLIMERASA UTILIZADOS PARA EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS CAPÍTULO I.1.4. VALIDACIÓN Y CONTROL DE CALIDAD DE LOS MÉTODOS DE LA REACCIÓN EN CADENA DE LA POLIMERASA UTILIZADOS PARA EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS INTRODUCCIÓN El diagnóstico de enfermedades

Más detalles

RapidFinder STEC Detection Workflow

RapidFinder STEC Detection Workflow QUICK REFERENCE RapidFinder STEC Detection Workflow Aislamiento automático de ADN y detección de la PCR en tiempo real de E. coli O157:H7 y cepas "Big 6" de STEC no O157 Número de catálogo 4480466, 4428176,

Más detalles

- Las mezclas de amplificación se presentan en formato monotest en tubos de PCR de 0.2 ó 0.5 ml, identificadas con diferentes colores.

- Las mezclas de amplificación se presentan en formato monotest en tubos de PCR de 0.2 ó 0.5 ml, identificadas con diferentes colores. ! El diagnóstico de los linfomas malignos es una de las áreas que más dificultad reviste dentro de la histopatología. Si bien muchos casos se diagnostican a través de los datos histomorfológicos e inmunohistoquímicos,

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Fecha de elaboración: 14 de mayo de 2010 Fecha de última actualización: 27 de Mayo de 2010

Fecha de elaboración: 14 de mayo de 2010 Fecha de última actualización: 27 de Mayo de 2010 PROGRAMA DE ESTUDIO Programa Educativo: Área de Formación : Licenciatura en Biología Integral Profesional Programa elaborado por: GENÉTICA MOLECULAR Horas teóricas: 2 Horas prácticas: 2 Total de Horas:

Más detalles

Manual de Uso (Ref /2)

Manual de Uso (Ref /2) Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Tel. (34) 91 710 00 74 Fax (34) 93 843 78 84 e-mail: info@biotools.eu www.biotools.eu Diseñado para la purificación

Más detalles

UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU

UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU La Unidad de secuenciación del Hospital Universitario Sant Joan de Déu, es una unidad de reciente creación que nace con el objetivo de prestar

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

1 Uso previsto. 2 Descripción del método. 4 Composición. 3 Especificaciones. 5 Estabilidad y almacenamiento. INOCVK-U INOCVK-G v.2.

1 Uso previsto. 2 Descripción del método. 4 Composición. 3 Especificaciones. 5 Estabilidad y almacenamiento. INOCVK-U INOCVK-G v.2. Formato UNIVERSAL INOCVK-U INOCVK-G v.2 1 Uso previsto RealCycler INOCVK-U / INOCVK-G es un kit de reactivos que permite la detección por PCR a tiempo real del gen metalobetalactamasa blaimp, del gen blandm

Más detalles

DIGESTIÓN DEL FAGO LAMBDA CON ENZIMAS DE RESTRICCIÓN

DIGESTIÓN DEL FAGO LAMBDA CON ENZIMAS DE RESTRICCIÓN DIGESTIÓN DEL FAGO LAMBDA CON ENZIMAS DE RESTRICCIÓN Ref.ER2 (4 PRÁCTICAS) 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir los principios de la digestión del ADN con enzimas de

Más detalles

Inmunohematología. Dra. Ana Cecilia Haro

Inmunohematología. Dra. Ana Cecilia Haro Inmunohematología 2016 Dra. Ana Cecilia Haro Sensibilización Aglutinación Ag + Ac Ag-Ac Enzimas LISS SAGH PEG Polibrene Albúmina Potencial zeta Tipo de Ac Densidad antigénica Tiempo de incubación Fuerza

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

Septiembre 2015 artus CMV QS-RGQ Kit: Características de rendimiento

Septiembre 2015 artus CMV QS-RGQ Kit: Características de rendimiento Septiembre 2015 artus CMV QS-RGQ Kit: Características de rendimiento artus CMV QS-RGQ Kit, versión 1 4503363 Compruebe la disponibilidad de nuevas versiones de la documentación electrónica en www.qiagen.com/products/artuscmvpcrkitce.aspx

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

SPEED-OLIGO MYCOPLASMA PNEUMONIAE

SPEED-OLIGO MYCOPLASMA PNEUMONIAE 1 SPEED-OLIGO MYCOPLASMA PNEUMONIAE SP001: Ensayo oligocromatográfico para la detección cualitativa de Mycoplasma pneumoniae en muestras clínicas. 40 tests. INTRODUCCIÓN: Mycoplasma pneumoniae es un patógeno

Más detalles

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271.

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS.

1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS. Página 1 de 5 CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain.

Más detalles

1 Uso previsto. 5 Estabilidad y almacenamiento. 2 Descripción del método. 6 Material y equipamiento adicional requerido y no suministrado

1 Uso previsto. 5 Estabilidad y almacenamiento. 2 Descripción del método. 6 Material y equipamiento adicional requerido y no suministrado ULCGEN v.2 1 Uso previsto RealCycler ULCGEN es un kit de reactivos que permite la detección cualitativa por PCR a tiempo real del ADN de Treponema pallidum, del virus Herpes Simple (tipo 1 + tipo 2) y

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas Juan Carlos Rodríguez S. Microbiología Hospital General Universitario de Alicante Universidad

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

AGRADECIMIENTOS... VII RESUMEN... XIII RESUM... XV SUMMARY... XVII ABREVIATURAS... XIX ÍNDICE DE CONTENIDO... XXIII ÍNDICE DE FIGURAS...

AGRADECIMIENTOS... VII RESUMEN... XIII RESUM... XV SUMMARY... XVII ABREVIATURAS... XIX ÍNDICE DE CONTENIDO... XXIII ÍNDICE DE FIGURAS... ÍNDICE AGRADECIMIENTOS... VII RESUMEN... XIII RESUM... XV SUMMARY... XVII ABREVIATURAS... XIX ÍNDICE DE CONTENIDO... XXIII ÍNDICE DE FIGURAS... XXXI ÍNDICE DE TABLAS... XXXVII INTRODUCCIÓN... 1 1. La mitocondria...

Más detalles

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente M.Sc. Viviana Fino - DuPont N&H ACHIPIA 2015 8 de octubre de 2015 Santiago, Chile Necesidades de la Industria

Más detalles

- Las mezclas de amplificación se presentan en formato monotest en tubos de PCR de 0.2 0.5 ml, identificados con diferente color.

- Las mezclas de amplificación se presentan en formato monotest en tubos de PCR de 0.2 0.5 ml, identificados con diferente color. ! El diagnóstico de los linfomas malignos es una de las áreas que más dificultad reviste dentro de la histopatología. Si bien muchos casos se diagnostican a través de los datos histomorfológicos e inmunohistoquímicos,

Más detalles

Tecnología HaloPlex by Genycell Biotech España

Tecnología HaloPlex by Genycell Biotech España Paneles de genes custom-made Tecnología HaloPlex by Genycell Biotech España SERVICIO NGS CLÍNICA HALO: OVERVIEW 1. DISEÑO DEL PANEL DE GENES Y DEL KIT DE CAPTURA 2. PREPARACIÓN DE LA MUESTRA EN EL LABORATORIO

Más detalles

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores.

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Dr. Jaeson S. Calla Choque Universidad Peruana Cayetano Heredia

Más detalles

DIAGNÓSTICO DE CMV CONGÉNITO POR NESTED-PCR

DIAGNÓSTICO DE CMV CONGÉNITO POR NESTED-PCR DIAGNÓSTICO DE CMV CONGÉNITO POR NESTED-PCR obertrand, María Victoria oflores, Antonio Ezequiel ogoyechea, Roxana María Itatí omartinez, Silvina María Inmunología Clínica 2009 CITOMEGALOVIRUS: CARACTERISTICAS

Más detalles

BIOLOGIA CELULAR Y MOLECULAR. LABORATORIO No 5: ENZIMAS DE RESTRICCION

BIOLOGIA CELULAR Y MOLECULAR. LABORATORIO No 5: ENZIMAS DE RESTRICCION BIOLOGIA CELULAR Y MOLECULAR LABORATORIO No 5: ENZIMAS DE RESTRICCION 1. INTRODUCION Las enzimas de restricción, también conocidas como endonucleasas, son enzimas que cortan los enlaces fosfodiéster del

Más detalles

CURSO ACADÉMICO 2009 2010

CURSO ACADÉMICO 2009 2010 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2009 2010 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, Ecología y Genética Área de conocimiento: Genética Ciclo: 2º Curso: 4º Tipo:

Más detalles

SANIDAD ANIMAL (CISA INIA)

SANIDAD ANIMAL (CISA INIA) Hoja 1 de 10 CENTRO DE PROCEDIMIENTO PARA LA DETECCIÓN DEL VIRUS DE LA PESTE PORCINA AFRICANA (VPPA) MEDIANTE REACCIÓN EN CADENA DE LA Fecha de entrada en vigor: Diciembre 2008 REV. FECHA EPÍGRAFE/S CAUSA

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

Los Marcadores Moleculares y su aplicación en la agricultura moderna. Dr. Luis Wong Vega Instituto de Innovación en Biotecnología e Industria (IIBI)

Los Marcadores Moleculares y su aplicación en la agricultura moderna. Dr. Luis Wong Vega Instituto de Innovación en Biotecnología e Industria (IIBI) Los Marcadores Moleculares y su aplicación en la agricultura moderna Dr. Luis Wong Vega Instituto de Innovación en Biotecnología e Industria (IIBI) La biotecnología posee un impacto potencial significativo

Más detalles

Laboratorio de Habilidades 5

Laboratorio de Habilidades 5 Universidad Nacional de Rosario Facultad de Ciencias Médicas Área Injuria Laboratorio de Habilidades 5 Métodos directos (IV) Inves gación molecular de ácidos nucleicos: Fundamentos. Biología molecular.

Más detalles

Detección de mutaciones en el gen rpob de M. tuberculosis 8 MATERIALES Y MÉTODOS

Detección de mutaciones en el gen rpob de M. tuberculosis 8 MATERIALES Y MÉTODOS 8 MATERIALES Y MÉTODOS 8.2 CEPAS DE M. TUBERCULOSIS. Se utilizó 1 cepa control y se analizaron un total de 13 extracciones diferentes de DNA de cepas de M. tuberculosis previamente aisladas de muestras

Más detalles

Proyecto de Fin de Cursos

Proyecto de Fin de Cursos Universidad de la República Oriental del Uruguay Proyecto de Fin de Cursos ELECTROFORESIS EN GEL DE MOLÉCULAS DE ADN Noviembre de 2006 Carolina Etchart C.I. 3.757.708-8 Marcelo Lavagna C.I. 3.508.715-8

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 28 de abril de 2009 Revisión 1 (30 de abril e 2009) El Centro Colaborador para la Influenza de la

Más detalles

Comprobando la calidad del DNA genómico mediante electroforesis en gel

Comprobando la calidad del DNA genómico mediante electroforesis en gel Comprobando la calidad del DNA genómico mediante electroforesis en gel GELES 1 Y 2 Agarosa 0.8 %, electroforesis a 1 V/cm Muestras: Se ha cargado muestras de DNA genómico no digerido, antes (líneas impares)

Más detalles

IdentiClone BCL1/JH Translocation Assay Para la Identificación del Linfoma del Manto y de otros Linfomas y Leucemias Para Diagnóstico In Vitro

IdentiClone BCL1/JH Translocation Assay Para la Identificación del Linfoma del Manto y de otros Linfomas y Leucemias Para Diagnóstico In Vitro Servicio Técnico: support@invivoscribe.com Servicio al Cliente (EUA): sales@invivoscribe.com Servicio al Cliente (UE): sales-eu@invivoscribe.com IdentiClone BCL1/JH Translocation Assay Para la Identificación

Más detalles

Prueba BD GeneOhm MRSA ACP Kit de amplificación

Prueba BD GeneOhm MRSA ACP Kit de amplificación Prueba Kit de amplificación REF. 441637 REF. 441639 48 pruebas 200 pruebas P0057(02)_ES Fecha: 2014-09 ÍNDICE USO PREVISTO... 3 RESUMEN Y EXPLICACIÓN... 3 PRINCIPIOS DEL PROCEDIMIENTO... 3 REACTIVOS...

Más detalles