Materiales para la secuenciación de ADN

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Materiales para la secuenciación de ADN"

Transcripción

1 Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la ADN polimerasa usando una mezcla de desoxinucleótidos trifosfato (dntps normales) y de terminaciónes de cadena-trifosfatos de didesoxinucleótidos (ddntps).los ddntps carecen del grupo 3 'OH al cual se añade el dntp siguiente de la cadena de ADN en crecimiento. Sin el 3 'Oh, no se pueden añadir más nucleótidos, y la ADN polimerasa se cae. Los cadenas de ADN resultantes recién sintetizadas serán de diferentes longitudes, dependiendo de que tamaño tenia la cadena cuando se incorporó al azar un ddntp. La mayoría de la secuenciación del ADN se ha automatizado. Las reacciones método de Sanger de terminación de cadena se utilizan todavía, pero el vertido, el proceso, y la lectura de los geles de poliacrilamida se han sustituido por métodos automatizados. En lugar de etiquetar los productos de las 4 reacciones de secuenciación (con un desoxinucleótido radiactivo), cada uno de los didesoxinucleótidos está marcado con un marcador fluorescente diferente. Cuando se excita con un láser, los 4 tipos diferentes de productos se detectan y la intensidad de la fluorescencia de los datos se traduce en un "pico". Así, todas las reacciones de las cuatro cadenas de terminación se pueden realizar en el mismo tubo, y ejecutarse en un solo carril en un gel. Una máquina escanea el carril con un láser. La longitud de onda de fluorescencia de la etiqueta de conjugado ddntps puede ser interpretado por la máquina como una indicación de el lugar en el cual tubo lugar la reacción (ddg, dda, ddt, o ddc) en una banda de ADN particular. 1

2 Materiales para la secuenciación de ADN Patrón de ADN Mix dntp Agua destilada Buffer de amplificación Primers Delantero, trasero Mix para PCR Taq ADN polimerasa Enzima EXO-SAP Columna de purificación Mezcla tinte Sephadex Buffer de corrido Secuencia de polímero Placa de secuencia Septa de placa Método para la secuenciación de ADN A. Preparar plantilla de ADN genómico a. El ADN genómico se preparó de acuerdo con los protocolos estándar para el aislamiento de ADN de alto peso molecular 2

3 b.la concentración de ADN genómico se determinó por la incorporación de tinte A260,o un análisis espectrofotométrico equivalente. c. De acuerdo a la concentración determinada, el ADN genómico se diluye con agua estéril, agua desionizada o Tris 10 mm, ph 8,0 con el fin de obtener una concentración de ADN de entre ng / ml. d. A continuación, el ADN diluido se dividió en alícuotas y se almacenó a -15 C a -25 C. e. La calidad del ADN se determinó mediante el cálculo de la relación A260/A280. Nota: Para obtener ADN de alta calidad, la proporción A260/A280 está obligado a estar en entre 1,7 a 1,9 B. Amplificación por PCR Preparación de reacción de PCR: i. Se prepara la mezcla de reacción. ii. Si el número de muestras a analizar es más que 5, se recomienda preparar una mezcla maestra. Dependiendo del volumen calculado, combinar los componentes y aplicar el vortex suavemente. 3

4 Reactivos a utilizar: PCR Master Mix... 12,5 l El PCR Master Mix incluye los productos químicos necesarios para la reacción en cadena de la polimerasa como el MgCl2, dntps, la Taq polimerasa y la solución tampón. Cebador... 2,5 l Cebador para ser usado en la reacción que tiene que ser diseñado apropiadamente para la región de ADN genómico de interés. Cebador inverso... 2,5 l El cebador inverso se utilizá en la reacción y tiene que ser diseñado apropiadamente para la región de ADN genómico de interés. G / C Enhancer... 5 l Cataliza la unión de los cebadores para la región de ADN de interés. El ADN genómico (30-60 l)... 2,5 l Después de que todas las reacciones se añadan, se procede a agitar en el vórtex suavemente el tubo para PCR con el fin de mezclar adecuadamente los productos químicos.el volumen total es de 25 l. Coloque los tubos de PCR en ciclo térmico. Coloque el ciclo térmico en las condiciones de temperatura y tiempo de activación,para la activación, amplificación y extensión de acuerdo a los tipos de productos químicos utilizados y el ADN genómico de la región de interés. Un protocolo de PCR ilustrativo es el siguiente: Activación: No se repite 95 C ' Amplificación: 40 repeticiones 95 C... 40'' 62 C... 1 ' 72 C... 50'' Elongación: No repetir 72 C... 7 ' Mantenimiento: 4 C. 4

5 C. Determine la cantidad de ADN a. Con el fin de determinar la cantidad de producto de PCR mezclar 5 l de producto de PCR con carga de tinción. b. Preparar gel de agarosa al 2% y realizar la electroforesis. c.. Cargar el marcador de ADN de bajo peso en un pocillo de gel de agarosa. d. Visualizar el gel bajo iluminador UV y analizar la imagen adquirida. e. Limpie protocolo de producto PCR f. Centrifugue brevemente los tubos de PCR antes de su uso. g. Etiquete nuevamente los tubos PCR de acuerdo a los nombres de muestra. h. Añada 5 l de producto de PCR. i. Añada 2 l de enzima específica para limpiar los componentes no utilizados de la PCR en el tubo. j. El volumen total debe ser de 7 l. k. Coloque los tubos en el termociclador. l. Establezca las condiciones en función de la enzima que se utiliza para limpiar los excesos de reactivos. un protocolo ilustrativo es el siguiente: 5

6 Incubación enzimática: 37 C ' Inactivación de enzimas: 80 C ' Mantenimiento: 4 C. D. Preparación de la reaccion de secuenciación Los componentes de la reacción y la cantidad de productos químicos son: Mezcla de tinción... 2 l Buffer de Secuenciación... 2 l Primers... 2 l Producto de PCR... 2 l ddh2o... 2 l 6

7 El Volumen total es de 10 l. Agite en el Vortex los tubos para mezclar los componentes correctamente y centrifugar brevemente. Colocar los tubos en el ciclo térmico y establecer las condiciones. Un ejemplo ilustrativo de las condiciónes para la PCR es el siguiente: Activación: No se repiten 96 C... 1 ' Extensión: 25 ciclos 96 C... 10'' 50 C... 5'' 60 C... 4 ' Mantenimiento: 4 C... E. Purificación del producto de extensión Los productos amplificados se purifican mediante el uso de dos puntos de Sephadex. Preparación de las columnas de purificación: 7

8 a. Añadir 750 l de ddh2o a las columnas incluyendo Sephadex b. Realice Vortex hasta que el polvo de Sephadex se disuelva correctamente y mantener a temperatura ambiente durante 30 min. c. Centrifugar las columnas durante 2 minutos a 4600 rpm d. Desechar el agua en el tubo de recogida y asegurar que no queda agua. e. Añadir todo producto de la PCR en el centro de la columna. f. Centrifugar durante 2 minutos a 4600 rpm. F. Realizar electroforesis capilar a. Añadir todo el producto purificado en una placa de 96 pocillos. b. Cubrir la placa con Septa. c. Colocar la placa en un soporte de placa. 8

9 d. Coloque la placa en el instrumento de secuenciación del ADN. e. Espere a que el instrumento realice la electroforesis y recoga los datos. f. Analice los datos. 9

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

Instrucciones de Uso GenDx SBTexcellerator

Instrucciones de Uso GenDx SBTexcellerator Octavo Edición Julio de 2011 Instrucciones de Uso GenDx SBTexcellerator Para Tipificación Basada en Secuenciación de HLA de alta resolución Genome Diagnostics B.V. Teléfono: +31 302 523 799 Correo electrónico:

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA 2 PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA D E S C R I P C I Ó N OBJETO DE LA INVENCIÓN La presente

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 Instrucciones de uso Wipe test Control de Contaminación Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 40 Reacciones 1. Descripción del Producto El uso de la

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

MEMORIA DE PRÁCTICAS

MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17 Índice Introducción 1 1. Modalidades de secuenciación 2 a. Secuenciación de una sola cadena 2 b. Secuenciación analítica 3 c. Secuenciación diagnóstica 3 2. Oligonucleótidos disponibles 5 3. Protocolo

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS

SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS Secugen recomienda que para la visualización de las secuencias se usen programas que permitan ver el dato crudo, ya que a partir de ese dato se

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271.

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

UNIÓN INTERNACIONAL PARA LA PROTECCIÓN DE LAS OBTENCIONES VEGETALES

UNIÓN INTERNACIONAL PARA LA PROTECCIÓN DE LAS OBTENCIONES VEGETALES S Directrices del BMT (proj.5) ORIGINAL: Inglés FECHA: 25 de febrero de 2006 UNIÓN INTERNACIONAL PARA LA PROTECCIÓN DE LAS OBTENCIONES VEGETALES GINEBRA PROYECTO DIRECTRICES PARA LOS PERFILES DE ADN: SELECCIÓN

Más detalles

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS.

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. ASUNTO Con fundamento en lo dispuesto en los Artículos

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles

Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012

Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012 Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012 NOMBRE DE LA INVESTIGACIÓN ANÁLISIS DE DIVERSIDAD GENÉTICA DE UNA COLECCIÓN DE AGUAJE DE Mauritia flexuosa (Aracaceae:

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271.

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. Technical Manual SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. IMPRESO EN ESTADOS UNIDOS Nro. de pieza: TMD037 SwabSolution Kit Toda la bibliografía técnica está disponible en Internet,

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5 PCR Caracteristicas del ADN Se rompen con las siguientes condiciones -Temperaturas >90 C - ph >10.5 Baja astringencia tiene uniones parciales o imperfectas. Renaturalización Dependiendo de: -Contenido

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

Kits BAGene SSP C IVD

Kits BAGene SSP C IVD Línea de Pruductos BAGene ES Instrucciones de Uso Kits BAGene SSP C IVD Kits de Pruebas para la determinación de los grupos sanguíneos ABO blood, tipos RH, sistemas Kell, Kidd y Duffy, sistema MNS, especificidades

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO.

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO. Página 1 de 7 CONTENIDO CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130,

Más detalles

METODOS DE ANALISIS BIOMEDICOS

METODOS DE ANALISIS BIOMEDICOS METODOS DE ANALISIS BIOMEDICOS 2010 Profesora a cargo: Dra. Viviana Lepek PARTE PRÁCTICA Jefe de T.P.: Dra. Mara Roset Ayudantes: Dra. Ines Marchesini Lic. Lucas Bukata Dr. Juan Mucci Dr. Adrián Mutto

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

Electroforesis de proteínas en geles de poliacrilamida. Electroforesis de proteínas en geles de poliacrilamida: Introducción y técnica básica

Electroforesis de proteínas en geles de poliacrilamida. Electroforesis de proteínas en geles de poliacrilamida: Introducción y técnica básica Electroforesis de proteínas en geles de poliacrilamida Electroforesis de proteínas en geles de poliacrilamida: Introducción y técnica básica La electroforesis de proteínas en geles con una matriz de poliacrilamida,

Más detalles

Biotechnology Explorer. Kit de huella genética (ADN fingerprint) Manual de instrucciones. Número de catálogo 166-0007-EDU. www.explorer.bio-rad.

Biotechnology Explorer. Kit de huella genética (ADN fingerprint) Manual de instrucciones. Número de catálogo 166-0007-EDU. www.explorer.bio-rad. Biotechnology Explorer Kit de huella genética (ADN fingerprint) Manual de instrucciones Número de catálogo 166-0007-EDU www.explorer.bio-rad.com Los reactivos liofilizados se pueden almacenar a temperatura

Más detalles

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas)

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

IgK-IgL Rearrangements Molecular Analysis Kit Nº CAT. MAD-003999M (20 tests)

IgK-IgL Rearrangements Molecular Analysis Kit Nº CAT. MAD-003999M (20 tests) IgK-IgL Rearrangements Molecular Analysis Kit Nº CAT. MAD-003999M (20 tests) El diagnóstico de los linfomas malignos es una de las áreas que más dificultad reviste dentro de la histopatología. Si bien

Más detalles

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares.

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. INTRODUCCIÓN La determinación morfológica y morfométrica de nematodos fitopatógenos en los laboratorios

Más detalles

ELECTROFORESIS BASICA

ELECTROFORESIS BASICA Ref.ELECBASICA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS BASICA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

PROTOCOLO REGISTRO DE SEMILLA PRE-INOCULADA

PROTOCOLO REGISTRO DE SEMILLA PRE-INOCULADA Dirección General de Servicios Agrícolas Ministerio de Ganadería, Agricultura y Pesca República Oriental del Uruguay Av. Millán 4703, Montevideo. CP 12.900. Teléfono: (598) -2304 3992 Web: http://www.mgap.gub.uy

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles