PRÁCTICAS DE MICROBIOLOGIA CLINICA

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "PRÁCTICAS DE MICROBIOLOGIA CLINICA"

Transcripción

1 PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante

2 CASO CLINICO: Rubéola

3 Evolución de los anticuerpos

4 Seroconversión 1º SUERO 1/8 N 2º SUERO 1/256 1/ semanas de intervalo

5 Infección aguda PRESENCIA DE IgM DEMOSTRACION DE SEROCONVERSIÓN

6 CASO CLINICO: HIV Paciente 30 años Ex-ADVP (desde hace 5 años) Asintomático

7 PRUEBA DE CRIBADO: ELISA/EIA

8 PRUEBA CONFIRMATORIA: Western Blot

9 CASO CLINICO: Sospecha de tuberculosis pulmonar Paciente de 25 años Tos, fiebre, expectoración sanguinolenta

10 INFECCION TUBERCULOSA

11 INFECCION TUBERCULOSA: Mantoux o tuberculina

12 INFECCION TUBERCULOSA: IGRA (QUANTIFERON)

13 ENFERMEDAD TUBERCULOSA: TINCION

14 ENFERMEDAD TUBERCULOSA: CULTIVO

15 ENFERMEDAD TUBERCULOSA: PCR

16 CASO CLINICO: Toxoplasmosis Mujer embarazada IgG positiva a T. gondii Asintomática

17 Toxoplasmosis

18 CASO CLINICO: Viaje al trópico Cooperante Regreso hace 5 días de Camerún Fiebre

19 MALARIA

20 MALARIA

21 MALARIA

22 HEPATITIS HAV HBV HCV HDV HEV CMV, EBV, Toxoplasma, etc.

23 HEPATITIS B Actividad viral HBsAg HBeAg AntiHBc (IgM) Infección natural AntiHBc Buen pronóstico AntiHBs AntiHBe

24 HEPATITIS B H. aguda H. curada Portador Mutante precore H. crónica

25 HEPATITIS B

26 HEPATITIS B

27 HEPATITIS C Cribado: ELISA Confirmación: Western Blot PCR Genotipado: 1 (1a, 1b) 3 (3a)

28 HEPATITIS D

29 FUNDAMENTOS BASICOS DE MICROBIOLOGIA MOLECULAR

30 FUNDAMENTOS TEORICOS Las técnicas llamadas de microbiología molecular tratan de estudiar el genoma mediante varias metodologías: PCR convencional PCR a tiempo real (real time PCR) Secuenciación Análisis de fragmentos genómicos

31 FUNDAMENTOS TEORICOS La secuencia de bases (adenina, guanina, citosina y timina) codifican la información genética Cuando el gen se expresa, se sintetiza RNA y a partir de él se sintetizan las proteínas Todos los organismos secuenciados están recogidos en una base de datos de acceso público llamada GenBank (pubmed) El programa que está instalado en esa base de datos tiene instalada diversas aplicaciones que son muy interesantes en este tipo de estudios. Otros programas interesantes son: Chromas: analiza secuencias Primer express: Diseña sistemas de PCR a tiempo real Primer 3: Diseña sistemas de PCR convencional

32 EXTRACCION DE DNA OBJETIVO Romper la bacteria y separar el DNA del resto de sus componentes En función de la cantidad de DNA que dispongamos se utilizan diferentes métodos METODOS Mucha cantidad de DNA (cultivo bacteriano): Chelex Poca cantidad de DNA (muestra clínica): Columnas (Quiagen) TNAI (Roche)

33 PCR convencional REACTIVOS Buffer Cloruro de magnesio: Entre 1,5 y 3 mm dntp: A, G, C, T Cebadores o primers Taq polimerasa Agua DNA diana

34 PCR convencional PARAMETROS DEL TERMOCICLADOR Apertura de las hebras de DNA: 94ºC Hibridación de los cebadores: Temperatura variable Elongación de las cadenas: 72ºC Número de ciclos: Entre 30 y 40

35 PCR convencional DETECCION DE LA AMPLIFICACION Preparación del gel de agarosa Electroforesis a 100 V Visualización con bromuro de etidio ojo, es cancerígeno!!!!

36 PCR a tiempo real REACTIVOS Master mix Cebadores o primers Sonda Agua DNA diana

37 PCR a tiempo real

38 PCR a tiempo real DETECCION DE LA AMPLIFICACION

39 SECUENCIACION REACTIVOS 1ª REACCION Taq gold Cebadores o primers Agua DNA diana DETECCION DE LA AMPLIFICACION Preparación del gel de agarosa Electroforesis a 100 V Visualización con bromuro de etidio ojo, es cancerígeno!!!! ELIMINACION DE CEBADORES Y OTROS FRAGMENTOS PEQUEÑOS DE DNA Tratamiento con enzima específico

40 SECUENCIACION REACTIVOS 2ª REACCION Mezcla de secuenciación Un solo cebador diluido Agua Amplificado de la primera amplificación DETECCION DE LA SECUENCIACION Preparación de la muestra Envío a la UMH

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas Juan Carlos Rodríguez S. Microbiología Hospital General Universitario de Alicante Universidad

Más detalles

Pruebas para el diagnóstico microbiológico de las infecciones del Sistema Nervioso

Pruebas para el diagnóstico microbiológico de las infecciones del Sistema Nervioso Pruebas para el diagnóstico microbiológico de las infecciones del Sistema Nervioso Dr. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche E-mail: rodriguez_juadia@gva.es

Más detalles

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS S. Microbiología Hospital General Universitario de Elche Abril 2009 HEPATITIS A INTRODUCCION La principal característica diferencial

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis virales Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis Características generales Es un proceso asociado a muchas causas, tanto infecciosas como

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA

PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA 2 PROCEDIMIENTO PARA LA UTILIZACIÓN DEL POLIMORFISMO DEL GEN COMT (CATECOL-OXI-METILTRANSFERASA) EN EL DIAGNÓSTICO DEL SÍNDROME DE FIBROMIALGIA D E S C R I P C I Ó N OBJETO DE LA INVENCIÓN La presente

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA

ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA Diagnóstico de las infecciones por DENV y CHIKV María Gabriela Barbás Bioq. Esp.en Virología Jefa del Servicio Bioquímico Laboratorio Central de la Provincia de Córdoba

Más detalles

Informe de vigilancia basada en laboratorio del dengue

Informe de vigilancia basada en laboratorio del dengue Centro Nacional de Referencia de Virología Informe de vigilancia basada en laboratorio del dengue Período: enero a diciembre, 2012 Volumen 1, Número 1, 2013 Fecha: 29-01-13 1. Introducción Contenidos 2.

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

Hepatitis HEPATITIS A

Hepatitis HEPATITIS A Hepatitis Es una enfermedad inflamatoria que afecta al hígado. La inflamación, se puede presentar en forma aguda o ser un proceso crónico, dependiendo de la etiología que le dio origen. Sus causas pueden

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

Comprobando la calidad del DNA genómico mediante electroforesis en gel

Comprobando la calidad del DNA genómico mediante electroforesis en gel Comprobando la calidad del DNA genómico mediante electroforesis en gel GELES 1 Y 2 Agarosa 0.8 %, electroforesis a 1 V/cm Muestras: Se ha cargado muestras de DNA genómico no digerido, antes (líneas impares)

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS I. TÉCNICAS EN BIOLOGÍA MOLECULAR: ESQUEMA DE TÉCNICAS UTILIZADAS 1. TECNICAS DE HIBRIDACIÓN CON SONDAS DE ACIDOS NUCLEICOS.

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Tamizaje de infecciones transmisibles por transfusión en Argentina (Ley 22.990 - Ley Nacional de Sangre ) HVB: Enzimoinmunoensayos

Más detalles

INSTRUCTIVO IT G 001 Revisión 01. Instructivo de toma de muestras

INSTRUCTIVO IT G 001 Revisión 01. Instructivo de toma de muestras Página 1 de 9 Tipo de Evento Estudio solicitado Tiempo estimado de entrega de resultados Tipo de muestra biológica Especificaciones acerca de la muestra Oportunidad de toma de la muestra Conservación y

Más detalles

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar HBV - Marcadores Serológicos HBsAg: Antígeno de Superficie Anti-HBc (total):

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

Diagnóstico e Historia Natural de la Hepatitis B

Diagnóstico e Historia Natural de la Hepatitis B Diagnóstico e Historia Natural de la Hepatitis B Infección por el Virus de la Hepatitis B Un Gran Problema de Salud Pública Distribución universal 300 millones de portadores crónicos 1/3 de la población

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

HERRAMIENTAS PARA EL DIAGNOSTICO DE LA INFECCION POR VIRUS DENGUE EN EL URUGUAY. Dr. José C. Russi Dr. Héctor Chiparelli Marzo 2007

HERRAMIENTAS PARA EL DIAGNOSTICO DE LA INFECCION POR VIRUS DENGUE EN EL URUGUAY. Dr. José C. Russi Dr. Héctor Chiparelli Marzo 2007 HERRAMIENTAS PARA EL DIAGNOSTICO DE LA INFECCION POR VIRUS DENGUE EN EL URUGUAY Dr. José C. Russi Dr. Héctor Chiparelli Marzo 2007 VIRUS DENGUE Familia: Flaviviridae Género: Flavivirus Virus Envuelto Nucleocápside

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

El diagnóstico genómico de las enfermedades. (Seminario práctico) radica en el DNA que se encuentra empaquetado

El diagnóstico genómico de las enfermedades. (Seminario práctico) radica en el DNA que se encuentra empaquetado El diagnóstico genómico de las enfermedades (Seminario práctico) La información n genética radica en el DNA que se encuentra empaquetado en el núcleo n de las célulasc 1 Si todas las células c del organismo

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Lic. en Bioquímica Lic. en Biotecnología Microbiología de los Alimentos 2016 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente

Más detalles

Como interpretar las pruebas de serología hepatica

Como interpretar las pruebas de serología hepatica Introducción Para descartar en un paciente la presencia de infección viral se deben determinar exclusivamente el antígeno de superficie del virus de la hepatitis B (VHB) (HbsAg) y los anticuerpos frente

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

5-MARCO DE REFERENCIA

5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

METODOS MOLECULARES DE INNOVACION EN BANCO DE SANGRE

METODOS MOLECULARES DE INNOVACION EN BANCO DE SANGRE VI CONGRESO DEL GRUPO COOPERATIVO IBERO- AMERICANO DE MEDICINA TRANSFUSIONAL G-CIAMT 06-11 de junio 2009 METODOS MOLECULARES DE INNOVACION EN BANCO DE SANGRE Dr. César Sánchez Zúñiga Laboratorio de Biomedicina

Más detalles

TÉCNICAS MOLECULARES DE DETECCIÓN DE PATÓGENOS Y DE SUS FACTORES DE VIRULENCIA

TÉCNICAS MOLECULARES DE DETECCIÓN DE PATÓGENOS Y DE SUS FACTORES DE VIRULENCIA TÉCNICAS MOLECULARES DE DETECCIÓN DE PATÓGENOS Y DE SUS FACTORES DE VIRULENCIA TÉCNICAS MOLECULARES:VENTAJAS 1- RAPIDEZ 2- SENSIBILIDAD 3- NO NECESITAN MICROORGANISMO VIABLE 4- DETECTAN MICRORGANISMOS

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

Dra. MERCEDES CARRILLO

Dra. MERCEDES CARRILLO Fiebre Amarilla Importancia y Uso Racional del Laboratorio en la Vigilancia y Atención de los pacientes con cuadro clínico icterohemorrágicos agudos Dra. MERCEDES CARRILLO Directora General Laboratorio

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Absoluta sencillez. Absoluta seguridad. Simple. Confiable. Económico

Absoluta sencillez. Absoluta seguridad. Simple. Confiable. Económico Absoluta sencillez. Absoluta seguridad. Simple. Confiable. Económico Más de 20 determinaciones HIV Anticuerpos, Ag p24 y confirmatorio HEPATITIS A, B y C ToRCH Toxoplasmosis (Toxo) Rubeola Citomegalovirus

Más detalles

Un centro de biotecnología al servicio de la salud

Un centro de biotecnología al servicio de la salud Tecnologías para la Vida S. de R.L. de C.V. En búsqueda del bienestar humano Un centro de biotecnología al servicio de la salud Mexicali, Baja California, México Septiembre de 2012 Tecnologías para la

Más detalles

CURSO ACADÉMICO 2012-2013

CURSO ACADÉMICO 2012-2013 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2012-2013 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, ecología y Genética Área de conocimiento: Genética Ciclo:2º Curso: 4º Tipo:

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

HEPATITIS VIRALES CEFA 2011 Etiopatogenia microbiológica Instituto de Higiene Fac. de Medicina - UDELAR Dr. Héctor Chiparelli Médico Microbiólogo - Virólogo Definición La hepatitis es una enfermedad caracterizada

Más detalles

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO.

DETECCIÓN DEL GENOMA DEL VPPA MEDIANTE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) CONVENCIONAL REV. 2013 1. OBJETO. Página 1 de 7 CONTENIDO CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130,

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles

4Genética forense 1. QUÉ ES LA GENÉTICA FORENSE? tema

4Genética forense 1. QUÉ ES LA GENÉTICA FORENSE? tema tema 4Genética forense 1. QUÉ ES LA GENÉTICA FORENSE? Con la denominación de genética forense se define el uso de ciertas técnicas empleadas en genética para la identificación de los individuos en base

Más detalles

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx)

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS

TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS EN LOS ALIMENTOS. Aplicación de la reacción en cadena de la polimerasa Marta Terrón Cuadrado Junio 2008 Curso de Experto Universitario

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires OBJETIVO DETECTAR Y DESCARTAR PRECOZMENTE UNIDADES DE SANGRE DE DONANTES CON VIREMIA PARA HIV, HBV Y HCV, CON PRUEBAS SEROLÓGICAS

Más detalles

Virus Hepatitis B. Confirmación HBsAg

Virus Hepatitis B. Confirmación HBsAg Virus Hepatitis B Confirmación HBsAg Dr. Eliecer Villagra Cornejo Sección Virus Hepáticos y Emergentes Subdepartamento Enfermedades Virales Laboratorio Biomédico Nacional de Referencia. Virus Hepatitis

Más detalles

PRUEBAS DE DIAGNOSTICO. Hospital Roosevelt Laboratorio Clínica de Enfermedades Infecciosas Septiembre 2013

PRUEBAS DE DIAGNOSTICO. Hospital Roosevelt Laboratorio Clínica de Enfermedades Infecciosas Septiembre 2013 PRUEBAS DE DIAGNOSTICO Hospital Roosevelt Laboratorio Clínica de Enfermedades Infecciosas Septiembre 2013 DIAGNÓSTICO DE LA INFECCIÓN POR EL VIH El diagnóstico definitivo de la infección por el VIH sólo

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles