Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

2 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Es un técnica in vitro que se utiliza para la síntesis enzimática de un fragmento de ADN específico en pocas horas. El fragmento puede representar una parte de una mezcla compleja de ADNs, por ejemplo un exón de un gen específico. PCR



5 REACTIVOS Muestra (Template DNA) Esta Esta contiene la la región del del fragmento a ser ser amplificado Par Par de de primers (oligonucleótidos) determinan el el comienzo y el el final de de la la región a ser ser amplificada dntp s (deoxinucleótidos trifosfato) moléculas a partir de de las las cuales la la polimerasa construye el el nuevo fragmento de de ADN DNA Polimerasa (Usualmente Taq) PCR

6 ETAPAS DE LA REACCION Desnaturalización (95 o C) separación de las cadenas de ADN Annealling (56-70 o C) unión de los primers a la molécula de ADN Extensión (72 o C) se produce mediante el agregado de dntps 1 ciclo PCR

7 ETAPAS DE LA REACCION Desnaturalización

8 ETAPAS DE LA REACCION Annealling (56-70 C)



11 ANALISIS Corrida electroforetica Gel Gel de de agarosa, revelado con EtBr Comprobar la la formación de de producto Determinar la la aparición de de mas de de una banda en en la la misma reacción Verificar el el peso molecular (PM) del del producto formado Mediante un un marcador de de PM PM PCR


13 EQUIPAMIENTO Unidad de electroforesis Micropipetas Tubos Tips con filtro Reactivos Equipo para documentación digital TERMOCICLADOR TRANSILUMINADOR PCR

14 REAL TIME PCR Incorpora un módulo que permite detectar el producto de PCR (Amplicon) en el momento de su amplificación No requiere de corrida electroforética en geles Rápido screening del producto sin necesidad de geles Es un método cuantitativo que permite correlacionar la cantidad de producto de partida con el producto formado en la etapa exponencial de la reacción. REAL TIME PCR

15 Detección del Amplicon (SYBR) REAL TIME PCR

16 Detección del Amplicon (Taqman) Forward Primer Polimerización R TaqMan Probe Q Reverse Primer REAL TIME PCR

17 Detección del Amplicon (Taqman) Forward Primer Desplazamiento R Q Reverse Primer REAL TIME PCR

18 Detección del Amplicon (Taqman) R Hidrólisis Q REAL TIME PCR

19 Detección del Amplicon (Taqman) Polimerización n Completa R Q REAL TIME PCR

20 Resultados REAL TIME PCR

21 PCR PCR en tiempo real Cualitativo Cuantitativo

22 OPTIMIZACION Diseño de de primers parámetros para el el diseño, alineación de de secuencia, formación de de estructuras secundarias Temperatura de de annealing esta determinada por por los los primers Concentración de de Cl Cl 2 Mg 2 Mg Tiempos en en cada paso de de la la reacción Cantidad de de muestra y cantidad de de polimerasa a utilizar PCR

23 CONSIDERACIONES Una Una pequeña cantidad de de ADN ADN es es suficiente Contaminaciones puede puede ser ser a través través de de pipetas, saliva, saliva, manos, manos, ropa, ropa, lugar lugar comunitario de de trabajo trabajo Tamaño del del producto en en general general el el tamaño varia varia entre entre pb pb Falta Falta de de amplificación debido debido a ADN ADN impuro impuro o falta falta del del mismo, mismo, primers que que no no son son óptimos o reactivos ineficientes Amplificación no no especifica puede puede deberse a diseño diseño no no óptimo óptimo de de los los primers, o a una una temperatura de de annelling demasiado baja baja PCR

24 TIPOS DE PCR SSCP-PCR (single strand conformational polymorphims PCR) Se Se utiliza para detectar mutaciones RT-PCR (Reverse Transcriptase PCR) Permite ver expresión de de genes Real Time-PCR (PCR en en tiempo real) Permite ver en en tiempo real la la acumulación de de producto PCR

25 APLICACIONES Detección de mutaciones Screening de enfermedades hereditarias (desordenes genéticos heredados) Diagnostico de enfermedades infecciosas Clonación de genes Perfil genético utilizando microsatélites Medicina forense Estudio de especies Test de paternidad Producción de gran cantidad de ADN para secuenciación, o de secuencias especificas de ADN o ARN para utilizar como sonda PCR

26 DETECCION DE MUTACIONES 641bp Región a amplificar 300bp 941bp Región a amplificar

27 ANALISIS DE LA APLICACION 941 bp 641 bp +/+ -/- +/- PCR

28 Diagnostico de de enfermedades infecciosas RT-PCR



31 TEST DE PATERNIDAD Electroforesis de fragmentos de ADN amplificados por PCR. (1) Padre. (2) Hijo. (3) Madre. El hijo heredó algunos, pero no todos los fragmentos de los padres, lo cual lo hace unico. PCR


33 ELISA (Enzime Linked ImmunoSorbent Assay) Enzimo Inmuno Ensayo (EIA) desarrollado para medir pequeñas cantidades de sustancias en diversas muestras. MUESTRAS Suero Plasma Medios de de cultivo Lavado broncoalveolar Homogenatos Células en en cultivo (Spot ELISA) ELISA

34 ELISA TIPOS DE ELISA ELISA competitivo directo () ELISA Indirecto (Ac) ELISA Sandwich ()

35 ELISA ELISA COMPETITIVO DIRECTO () Fase Sólida (PVC o PS) Adición de Solución de Antígeno



38 ELISA ELISA COMPETITIVO DIRECTO () Adición de una dilución conocida de Anticuerpo acoplado a enzima.

39 ELISA ELISA COMPETITIVO DIRECTO () Adición de sustrato/cromógeno s s s






45 A Adición del -Ac de Detección Acoplado a Enzima ELISA ELISA COMPETITIVO DIRECTO ()





50 ELISA ELISA COMPETITIVO DIRECTO () Adición de Anticuerpo de Detección Acoplado a Enzima C




54 ELISA 0,25 ELISA COMPETITIVO DIRECTO () D.O. 0,2 0,15 0,1 0, Concentración (pg/ml)

55 ELISA COMPETITIVO DIRECTO () D.O. 0,25 0,2 0,15 0,1 0, Log 10 conc ELISA

56 ELISA ELISA INDIRECTO (Ac) Antígeno adosado a la fase sólida

57 ELISA INDIRECTO (Ac) Anticuerpo primario (muestra) Antígeno adosado a la fase sólida ELISA

58 ELISA INDIRECTO (Ac) Conjugado antiespecie (Ac 2º acoplado a enzima) Anticuerpo primario (muestra) Antígeno adosado a la fase sólida ELISA

59 ELISA INDIRECTO (Ac) Sustrato/cromógeno Conjugado antiespecie (Ac 2º acoplado a enzima) Anticuerpo primario (muestra) Antígeno adosado a la fase sólida s s s ELISA

60 ELISA ELISA INDIRECTO (Ac) 0,25 0,2 0,15 0,1 0, LECTURA p p p

61 ELISA ELISA SANDWICH Anticuerpo de captura adosado a la fase sólida

62 ELISA ELISA SANDWICH Antígeno (muestra) Anticuerpo de captura adosado a la fase sólida

63 ELISA ELISA SANDWICH Ac conjugado dirigido contra el de interés Antígeno (muestra) Anticuerpo de captura adosado a la fase sólida

64 ELISA ELISA SANDWICH Sustrato/cromógeno Ac conjugado dirigido contra el de interés Antígeno (muestra) Anticuerpo de captura adosado a la fase sólida s s s


66 ELISA Consideraciones - Sensibilidad aprox. 100 % - Especificidad 99.9 % - Lecturas: Positivo, Indeterminado, Negativo. - Proporción de Falsos negativos 1: : Falsos Positivos: Multíparas, Politransfundidos.

67 ELISA Aplicaciones de ELISA - Enfermedades Infecto-Contagiosas - Dosaje de Hormonas - Enfermedades Inflamatorias y Autoinmunitarias - Perfil de Citoquinas en Modelos Experimentales - Factores de Crecimiento - Proteínas de Secreción

68 Universidad Nacional de Córdoba

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60.

Más detalles


2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles


DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles



Más detalles



Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles



Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles



Más detalles


TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA TRABAJO PRACTICO Nº 3 ENZIMOINMUNOANALISIS ELISA Docentes encargados: Bioq. Natalia Guiñazú Bioq. Maria Sol Renna Biol. Virginia Andreani Bioq. Mauricio Figueredo Bioq. Vanina Garrido Bioq. Laura Dulgerian

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Herramientas diagnós.cas para la determinación de alérgenos en alimentos. Mgr., Bqca. Patricia Silvina Knass Romer Labs La:n America Adviser

Herramientas diagnós.cas para la determinación de alérgenos en alimentos. Mgr., Bqca. Patricia Silvina Knass Romer Labs La:n America Adviser Herramientas diagnós.cas para la determinación de alérgenos en alimentos Mgr., Bqca. Patricia Silvina Knass Romer Labs La:n America Adviser Resumen de la presentación Porqué vamos a analizar? Qué vamos

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: http://microbiologí

Más detalles


III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

Ministerio del Ambiente 1

Ministerio del Ambiente 1 Módulo Didáctico: Recursos Genéticos y Bioseguridad BASES TÉCNICAS PARA LA SEGURIDAD DE BIOTECOLOGÍA Cajamarca, 19 21 junio de 2012 Blgo. David Castro Garro Especialista en Biotecnología Ministerio del

Más detalles


PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: CASO CLINICO: Rubéola Evolución

Más detalles


DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles


5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles



Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv RESULTADOS Y DISCUSIÓN Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv La curva estándar con la que se estimó la concentración proteica del filtrado

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Tamizaje de infecciones transmisibles por transfusión en Argentina (Ley 22.990 - Ley Nacional de Sangre ) HVB: Enzimoinmunoensayos

Más detalles



Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas Juan Carlos Rodríguez S. Microbiología Hospital General Universitario de Alicante Universidad

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles


FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles



Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles

Diagnó Molecular 1

Diagnó Molecular 1 Diagnó Molecular 1 Relevancia, Áreas de Aplicación y Tendencias Actuales PCR hizo crecer al Diagnó Molecular Técnicas derivadas de PCR: Basadas en Métodos Enzimá.cos Basadas en Métodos Electroforé.cos

Más detalles


ELECTROFORESIS WESTERN BLOT ELISA ELECTROFORESIS WESTERN BLOT ELISA INTEGRANTES: Arguelles, Rocío Assandri, Matías Almirón, Marianela Buonanduci, Facundo Gómez, Alan Miller, Florencia López, Rocío Vidal, Sol Sillingardi, Leonardo Soria,

Más detalles



Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado TIPIFICACION HLA Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado Tipificación HLA: Estudio mediante el cual se determina cuales de todas las variantes conocidas del locus HLA están presentes

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles


MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles



Más detalles


PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles



Más detalles



Más detalles


DIAGNÓSTICO DE CMV CONGÉNITO POR NESTED-PCR DIAGNÓSTICO DE CMV CONGÉNITO POR NESTED-PCR obertrand, María Victoria oflores, Antonio Ezequiel ogoyechea, Roxana María Itatí omartinez, Silvina María Inmunología Clínica 2009 CITOMEGALOVIRUS: CARACTERISTICAS

Más detalles


IDENTIFICACIÓN Y MEDICIÓN DE LA RESPUESTA INMUNE IDENTIFICACIÓN Y MEDICIÓN DE LA RESPUESTA INMUNE RESPUESTA INMUNE HUMORAL SEROLOGÍA suero estudio Ciencia de la detección de anticuerpos Medición de las interacciones Ag - Ac, con fines diagnósticos, a

Más detalles