PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN"

Transcripción

1 PCR

2 PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

3 Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos Primers (Imprimadores) Polimerasa

4 Primers Se debe tener información de la secuencia que rodea el fragmento de interés Primers dan especificidad a la reacción, delimitan región a amplificar 6-40 nucléotidos Usualmente A no más de 4 kb uno de otro

5 Primers 2 primers: complementarios a bandas opuestas Deben estar en exceso

6 Para realizar la técnica se necesitan: dntps Dos cebadores (o primers) Iones divalentes. Se suele usar magnesio (Mg2+), agregado comúnmente como cloruro de magnesio (MgCl2), Actúan como cofactores de la polimerasa. Una solución tampón o buffer que mantiene el ph adecuado para el funcionamiento de la ADN polimerasa. ADN polimerasa (la más común es la Taq polimerasa). ADN molde Termociclador

7 Ciclos 20 a 35 ciclos de: 1. Desnaturalización:

8 2. Annealing

9 3. Elongación 72 C

10 Ciclo completo de PCR

11 Tamaño definido

12

13

14 Clave para facilidad proceso: polimerasa Debe ser termoestable Thermus aquaticus, una bacteria

15 Desventajas de la Taq No corrige errores 1 error en 2 x 10 4 bases Nuevas polimerasas cometen menos errores

16 Termociclador

17 Templete para PCR Se pueden usar bajas cantidades En teoría: una sola molécula No se debe aislar la secuencia de interés No debe ser muy puro ADN es una molécula muy estable en ausencia de nucleasas

18 A partir de: Sangre Semen Pelo Mucosa bucal Uñas Cepillo dientes

19 Cuidado con PCR Es tan sensible que se debe evitar la contaminación

20 Resolución de problemas de PCR

21 Primers

22 Características importantes de un primer Longitud Tm

23 T m Temperatura de melting, separación, fusión la temperatura a la que la mitad de las hebras de ADN son simple banda y la mitad son doble banda. Entre más G- C más alta Tm. Cálculos: Menos de 13: Tm= (wa+xt) * 2 + (yg+zc) * 4 Más largo de 13: Tm= *(yG+zC-16.4)/(wA+xT+yG+zC) Programas usan fórmulas modificadas más exactas. Consideran concentración de sales, de iones, etc

24 Características de un buen primer Tm en el rango de 52 C a 65 C. Idealmente ambos primers con Tm parecida. Que no sean capaces de dimerizar Ausencia de formación de horquillas Falta de sitios secundarios de unión

25 Unión única Secuencia debe ser única en el ADN templete No debe existir annealing en posibles fuentes contaminantes (humano, rata, ratón). Se logra haciendo BLAST o BLAT con el genoma correspondiente 5...TCAACTTAGCATGATCGGGTA...GTAGCAGTTGACTGTACAACTCAGCAA...3 TGCTAAGTT G CAGTCAACTGCTAC A TGCT AGTTG Primer candidato 1 5 -TGCTAAGTTG-3 Primer candidato 2 5 -CAGTCAACTGCTAC-3 No único! Único!

26 Longitud del primer En términos generales: Entre más largo más específico Entre más largo más alta Tm y temp annealing Por lo menos 15pb de longitud Por lo general 17-28pb Caso especial: mutagénesis dirigida. Longitud: 25-45pb

27 Temperatura de Annealing Temperatura de Annealing, T anneal temperatura a la que los primers se unen al molde de ADN. Se puede calcular a partir de T m. Ta Opt = 0.3 x (Tm de primer) x (Tm del producto) - 25 Tm del primer: es la Tm del primer que tenga la más baja

28 Estructura Interna Unión de primer con él mismo, o con el otro primer antes que con el molde: disminuye eficiencia Podría no ser tan importante si la temperatura de annealing no los deja formarse. Algunos dímeros y horquillas se forman a 30 C.

29 Pareja de primers debe calzar Primers funcionan en parejas Se usan en la misma reacción de PCR: las condiciones deben ser adecuadas para ambos Máxima diferencia entre temperaturas de annealing debería ser 3 C

30 Especificidad del producto T anneal es el factor principal en determinar especificidad del annealing y que se obtenga el producto deseado T anneal : muy baja menos específico unión de primers en otro lado bandas inespecíficas muy alta primers pueden no unirse

31 Estabilidad 3 y 5 Elongación de primer empieza en extremo 3. Mientras el extremo 3 se una al molde, la elongación empieza. 5 menos importante Problema: Si 3 tiene 3 o más C/G, se puede unir establemente a casi cualquier secuencia con tres C/G Situación Ideal: Extremo 5 estable + extremo 3 menos estable, elimina unión incorrecta debida a unión de sólo extremo 3. Preferiblemente: extremo 5 con 1 o 2 bases G/C. Extremo 3 no tiene más de una base G/C.

32 Resumen criterios para diseño 1. Unión única 2. Longitud: bases. Podría variar 3. Composición: contenido promedio de (G+C) alrededor 50-60%; evitar secuencia larga de (A+T) y región rica en (G+C) 4. Optimizar apareamiento: estabilidad en extremo 5 debe ser alta y relativamente baja en 3, para evitar unión equivocada de los primers 5. Tm preferiblemente entre C 6. Primers en un juego con diferencia de t. de annealing entre 2-3 C 7. Minimizar estructura secundaria interna: horquillas y dímeros se deben evitar

33 Diseño de primers con computadora Mucho mejores resultados que a mano Algunos programas: - Primer3: MIT -Oligo -GCG -BioTools - Otros: GeneFisher, Primer!, Web Primer Software para calcular Tm: - BioMath:

34 PCR Multiplex Varias parejas de primers en mismo tubo al hacer PCR Bueno para amplificar sitios múltiples Ej: microsatélites Dificultad de diseño Tm deberían ser parecidas Evitar dímeros

35 Primers universales Basados en alineamiento de secuencias Ejemplo: todos los genes de una familia el mismo gen en diferentes organismos Estrategia 1. Alinear secuencias a amplificar. 2. Buscar regiones más conservadas en extremos 5 y Diseño de primer F en la región conservada Diseño de primer R en la región conservada Buscar la mejor pareja en cuanto a Tm etc 6. Asegurarse de amplificación única en todas secuencias 7. Asegurar que no amplifique posibles contaminantes

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Curso Posgrado 2014 Dra. María Gabriela Lacoste

Curso Posgrado 2014 Dra. María Gabriela Lacoste Curso Posgrado 2014 Dra. María Gabriela Lacoste EldiseñodelosprimersparaunaPCResFUNDAMENTAL. Longitud Especificidad Temperatura de Hibridación Complementariedad de secuencias Contendido GC Reconocer una

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático Criterios para diseñar primers Iván Ferrer Rodríguez, Ph.D. Catedrático 1 Qué es un primer? Es una cadena corta de nucleótidos, un oligonucleótido. Sirve como punto de partida para la replicación del DNA.

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Química Biológica Patológica Técnicas de Biología Molecular aplicadas a Bioquímica Clínica Tema 2 Dra. Silvia Varas qbpatologica.unsl@gmail.com Tema 2 PCR Historia Bases Optimización de una reacción de

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5

Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5 PCR Caracteristicas del ADN Se rompen con las siguientes condiciones -Temperaturas >90 C - ph >10.5 Baja astringencia tiene uniones parciales o imperfectas. Renaturalización Dependiendo de: -Contenido

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Técnicas de amplificación. Fundamento teórico. PCR

Técnicas de amplificación. Fundamento teórico. PCR Técnicas de amplificación. Fundamento teórico. PCR JJuul lli iiáánn Saannzz Orrt teeggaa,, hhoossppi iit taal ll Cl llí ínni iiccoo Saann Caarrl llooss,, Maaddrri iidd 1.- Concepto El genoma humano consta

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Un poco de historia La técnica de PCR fue inventada por Kary B. Mullis en 1983. La primer publicación sobre PCR apareció en 1985, aunque el principio básico de replicar

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler

Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler Por Olfert Landt y Andreas Nitsche, TIB MOLBIOL, Berlín Traducción: Adriana

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Veamos rápidamente el ciclo celular

Veamos rápidamente el ciclo celular Replicación del adn Veamos rápidamente el ciclo celular Fase G1: Fase de crecimiento celular. Fase G2: la célula ya duplicó su material genético, y se prepara para la mitosis. Fase M: fase de división

Más detalles

Introducción al diseño de primers

Introducción al diseño de primers Introducción al diseño de primers INTRODUCCIÓN Esta guía es una breve aproximación al diseño de primers, utilizando programas bioinformáticos y pretende dar una orientación a aquellas personas que están

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles

La Biotecnología como Tema de Integración Curricular y su Relevancia en el Desarrollo de las Destrezas del Pensamiento

La Biotecnología como Tema de Integración Curricular y su Relevancia en el Desarrollo de las Destrezas del Pensamiento La Biotecnología como Tema de Integración Curricular y su Relevancia en el Desarrollo de las Destrezas del Pensamiento Gerardo Arroyo Cruzado, Ph.D. Departamento de Ciencias Biológicas, Facultad de Ciencias

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

Amplificación de ácidos nucleicos in vitro.

Amplificación de ácidos nucleicos in vitro. Amplificación de ácidos nucleicos in vitro. El principal objetivo de las técnicas de amplificación de ácidos nucleicos in vitro, es mejorar la sensibilidad de los test basados en ácidos nucleicos y simplificarlos

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS

SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS SECUENCIACIÓN SANGER DE ADN: GUÍA DE SOLUCIONES TÉCNICAS Secugen recomienda que para la visualización de las secuencias se usen programas que permitan ver el dato crudo, ya que a partir de ese dato se

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo

PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo Índice: PCR: Reacción en cadena de la polimerasa Gonzalo Greif. Unidad de Biología Molecular. Institut Pasteur Montevideo Historia La Reacción en cadena de la polimerasa (PCR) Algunos tips experimentales

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Sesión nº 6 Reacción en Cadena de la Polimerasa (PCR) M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007

8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007 8º CONGRESO IBEROAMERICANO DE INGENIERIA MECANICA Cusco, 23 al 25 de Octubre de 2007 SIMULACIÓN Y ANÁLISIS TÉRMICO DE UN PROTOTIPO DE PORTA MUESTRAS PARA UN TERMOCICLADOR PARA USO EN INGENIERÍA Y BIOLOGÍA

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS I. TÉCNICAS EN BIOLOGÍA MOLECULAR: ESQUEMA DE TÉCNICAS UTILIZADAS 1. TECNICAS DE HIBRIDACIÓN CON SONDAS DE ACIDOS NUCLEICOS.

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Amplificación de Nucleó.dos Reacción en Cadena de la Polimerasa

Amplificación de Nucleó.dos Reacción en Cadena de la Polimerasa Amplificación de Nucleó.dos Reacción en Cadena de la Polimerasa Historia de la PCR Reacción en Cadena de la Polimerasa 1983: Kary Mullis tuvo la idea de PCR mientras trabajaba para Cetus Corpora.on in

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS

TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS EN LOS ALIMENTOS. Aplicación de la reacción en cadena de la polimerasa Marta Terrón Cuadrado Junio 2008 Curso de Experto Universitario

Más detalles

ELECTROFORESIS. Agarosa. Poliacrilamida

ELECTROFORESIS. Agarosa. Poliacrilamida ELECTROFORESIS DE ADN ELECTROFORESIS Agarosa Poliacrilamida Finalidad de la electroforesis Separar Identificar Purificar 1 2 3 4 5 Tinción del ADN Bromuro de etidio Absorbancia a 302 y 366 y emisión a

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias.

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Dra. Sonia Arduino Dep. de Clínica Estomatología Facultad de Postgrado en Ciencias de la Salud

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Lic. en Bioquímica Lic. en Biotecnología Microbiología de los Alimentos 2016 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente

Más detalles

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO INSTITUTO DE BIOTECNOLOGÍA MÉTODOS FÍSICO-QUÍMICOS EN BIOTECNOLOGÍA PCR

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO INSTITUTO DE BIOTECNOLOGÍA MÉTODOS FÍSICO-QUÍMICOS EN BIOTECNOLOGÍA PCR UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO INSTITUTO DE BIOTECNOLOGÍA MÉTODOS FÍSICO-QUÍMICOS EN BIOTECNOLOGÍA PCR ALUMNOS: CORTAZAR MARTÍNEZ ADRIANA SILVA RINCÓN ELSA PATRICIA JUNIO, 2004 1 ÍNDICE Introducción

Más detalles

GUÍA N 1: MATERIAL GENETICO Y REPLICACIÓN DE ADN

GUÍA N 1: MATERIAL GENETICO Y REPLICACIÓN DE ADN SUBSECTOR PROFESOR NIVEL AÑO UNIDAD SEMESTRE Biología Iris Gaete IVº medio Hum 2016 Información Génica y Proteínas I GUÍA N 1 MATERIAL GENETICO Y REPLICACIÓN DE ADN Nombre Curso I. ESTRUCTURA DEL MATERIAL

Más detalles

Extracción y purificación de los ácidos nucleicos

Extracción y purificación de los ácidos nucleicos Extracción y purificación de los ácidos nucleicos Todos los tipos de macromoléculas biológicas tienen una característica en común que va a permitir el desarrollo de un método de separación especifico para

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

FUNDAMENTOS DE LA TÉCNICA PCR

FUNDAMENTOS DE LA TÉCNICA PCR FUNDAMENTOS DE LA TÉCNICA PCR 1 2 PCR Qué es? REACCIÓN EN CADENA DE LA POLIMERASA Técnica que nos permite amplificar selectivamente un segmento específico de DNA, hasta obtener una cantidad suficiente

Más detalles

Bases Moleculares. Efrén Santos

Bases Moleculares. Efrén Santos Bases Moleculares Efrén Santos ADN, ARN, proteínas ADN, contiene la información genética ARN, muy similar al ADN. (1) Copia temporal del ADN (2) Parte funcional y estructural del aparato traductor Proteinas,

Más detalles

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores.

Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Mutaciones asociadas a resistencia a estreptomicina y etambutol en Mycobacterium tuberculosis - secuenciación y desarrollo de cebadores. Dr. Jaeson S. Calla Choque Universidad Peruana Cayetano Heredia

Más detalles

Marcadores moleculares (MM)

Marcadores moleculares (MM) Marcadores moleculares (MM) Un marcador genético o marcador molecular es un segmento de ADN situado en un lugar específico del genoma (locus) y cuya herencia genética se puede rastrear. Puede ser un gen

Más detalles

La división celular. .Interfase

La división celular. .Interfase .Interfase La división celular El conjunto de procesos propios de la interfase hacen posible el mantenimiento o el incremento de las estructuras celulares, lo que conlleva, en principio, un incremento

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles

Capítulo 13 REPLICACIÓN DEL ADN

Capítulo 13 REPLICACIÓN DEL ADN REPLICACIÓN DEL ADN La reproducción necesita la correcta y precisa transmisión de la información genética de padres a hijos, por lo que resulta imprescindible la previa replicación o duplicación del ADN

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

Guía práctica sobre la técnica de PCR

Guía práctica sobre la técnica de PCR Guía práctica sobre la técnica de PCR 517 Capítulo 17 Guía práctica sobre la técnica de PCR Laura Espinosa Asuar PCR son las siglas en inglés de Polymerase Chain Reaction o Reacción en Cadena de la Polimerasa.

Más detalles