Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Caracteristicas del ADN. Se rompen con las siguientes condiciones -Temperaturas >90 - ph >10.5"

Transcripción

1 PCR

2 Caracteristicas del ADN Se rompen con las siguientes condiciones -Temperaturas >90 C - ph >10.5

3 Baja astringencia tiene uniones parciales o imperfectas. Renaturalización Dependiendo de: -Contenido de sales -Temperatura -ph En alta astringencia solo se pega con las bases complementarias, perfectamente organizadas.

4 Tm Tm (Temperatura de fusión), es la temperatura a la cual el 50 % de los acidos nucleicos se mantiene disociado o desnaturalizado Calculo de Tm (método de G-C) Por ejemplo para la secuencia: ttc ccc ggt ctt gta aac c N= 10 # GC= 10 %GC= 52% Tm= 2 C * (A+T) + 4 C * (G+C) = = 2 * (9) + 4 (10) = 58 C corrección 58-5=

5 Blot

6 Digoxigenina

7 Tipos de transferencias Metodos Southern Transferencia de ADN Nothern Transferencia de ARN Westhern Transferencia de proteínas Blott Siembra en la membrana

8 Hibridación de colonias Plaqueo

9

10

11 Condiciones Químicas Reactivos Físicas Temperatura

12 Condiciones químicas dntps Deoxinucleotidos -trifosfato Amortiguador tris HCl y KCl Taq (Obtenida de Thermus aquaticus) Cebador 1 (hacia delante- Forward) Cebador 2 (hacia atrás - Reverse) ADN molde (templete)

13 Componente Mezcla maestra Mezcla maestra Vol/ reacción Concentración final / reacción Amortiguador 10 x 10 µl 1 x MgCl 2, 25mM * * dntp mezcla (10 mm de cada uno) 2 µl 200 µm de cada dntp Cebador forward (hacia adelante) variable 0.1 a 0.5 µm Cebador forward (hacia adelante) variable 0.1 a 0.5 µm Taq polimerasa ADN 0.5 µl 2.5 u H 2 O *ddue variable -- ADN molde variable < 1 µg/ reacción TOTAL 100 µl Concentración final Mg Volúmen requerido de 25mM

14 Variables Cuidados y limpieza Secuencia del cebador (10-30 bases ) y del molde (hasta 10 Kb, en general de 100 a 1000 Kb) Concentración de componentes Cebador Molde 0.2, 0.4 a 0.8,1.0 micro M 1, 5 a 15, hasta 100 ng dntps (desoxinucleotidos) 50 a 220 micromolar Taq polimerasa0.9 a 0.2 u Cloruro de Magnesio 1.5 a 2.5 M Amortiguador (Tris HCL milimolar, ph 8.4 nota con la temperatura que se utiliza convencionalmente cambia de 6.8 a 7.8- con 50 a 55 milimolar de cloruro de potasio Condiciones termociclador

15 Concentración de ADN 1, 5 10, 15 ng Ojo con la contaminación

16 RAPDs Amplificación aleatoria de ADN polimórfico Usa un solo cebador El cebador de aproximadamante 10 bases

17 Cebadores universales Características básicas: 10 a 30 bases, aproximadamente 50% CG

18 Cebador 20 a 25 bases No forme pasadores Proporción similar de GC vs AT Específico

19 Ejemplo

20 Ciclo típico Desnaturalización inicial C ( 5 minutos) Desnaturalización Denaturation C (1 min) Alineación Annealing (al TM) C (1.5 min) Polimerización o Elongación Extension C (1 min/ Kb) Ciclos generalmente 25 a 35 Polimerización final 72 C 10 minutos

21 Tm Tm (Temperatura de fusión), es la temperatura a la cual el 50 % de los acidos nucleicos se mantiene disociado o desnaturalizado Calculo de Tm (método de G-C) Por ejemplo para la secuencia: ttc ccc ggt ctt gta aac c N= 10 # GC= 10 %GC= 52% Tm= 2 C * (A+T) + 4 C * (G+C) = = 2 * (9) + 4 (10) = 58 C corrección 58-5= 53 C

22 Número de ciclos

23 Grafica de las condiciones -Amplitud de cada etapa -Pendiente -Cambios en la corrida

24 Aplicaciones 1. Secuenciación Una de las razones mas comunes para el uso de la PCR es la formación de suficiente cantidad de ADN molde para su secuenciación. Es mucho mas sencillo y rapido que la clonación en células. 2. Estudios evolutivos Mediante la PCR se pueden amplificar genes de organismos ya extinguidos, como del mamut, o restos antiguos humanos. Se pueden comparar estos genes con los genes semejantes de organismos actuales y poder reconstruir árboles filogenéticos. El PCR también se ha utilizado para conseguir el mapa del genoma humano. 3. Huellas dactilares del ADN. La determinación de las huellas dactilares genéticas constituye una de las aplicaciones mas interesantes de la PCR.

25 Secuenciación Se utiliza Taq FS (fluorescente sequencing), a partir de la Taq polimerasa de Thermus aquaticus y modificada genéticamente de forma que posee muy baja actividad exonucleasa 5 ->3 y en consecuencia incorpora los ddntps marcados fluorescentemente

26 Estudios evolutivos y poblacionales PCR-RAPD (Random Amplified Polymorphic DNA) Este tipo de marcadores denominados Polimorfismos del ADN Amplificados Aleatoriamente, permiten analizar regiones homólogas del genoma de los individuos al amplificar al azar diferentes secciones del genoma.

27 VNTR (Variable Number of Tandem Repeats). La Variación en el Número de Repeticiones en Tira se enfoca al análisis de diferencias en la longitud de regiones repetitivas dentro del genoma nuclear no codificante. Los "minisatélites" se utilizan para efectuar una prueba denominada DNA fingerprint (huella digital del ADN) y es tan poderosa que permite individualizar organismos. Los "microsatélites" son otro tipo de repeticiones del genoma nuclear su análisis es similar al de las alozimas, pero en este caso el polimorfismo se basa en las diferencias en el número de repeticiones (longitud).

28 Pruebas de PCR

Química Biológica Patológica Técnicas de Biología Molecular aplicadas a Bioquímica Clínica Tema 2 Dra. Silvia Varas qbpatologica.unsl@gmail.com Tema 2 PCR Historia Bases Optimización de una reacción de

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología de los Alimentos Ingeniería en alimentos 2015 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente una región

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Microbiología General Microbiología M de los Alimentos Licenciatura en Bioquímica i Ingeniería en alimentos c Microbiología r 2015 Licenciatura en Biotecnología

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

UNIVERSIDAD NACIONAL DE MISIONES Facultad de Ciencias Exactas Químicas y Naturales TRABAJO PRÁCTICO Nº 4 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

UNIVERSIDAD NACIONAL DE MISIONES Facultad de Ciencias Exactas Químicas y Naturales TRABAJO PRÁCTICO Nº 4 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) TRABAJO PRÁCTICO Nº 4 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) INTRODUCCIÓN La reacción en cadena de la polimerasa o PCR (del inglés Polymerase Chain Reaction) es una técnica relativamente simple y poderosa

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Bases Moleculares. Efrén Santos

Bases Moleculares. Efrén Santos Bases Moleculares Efrén Santos ADN, ARN, proteínas ADN, contiene la información genética ARN, muy similar al ADN. (1) Copia temporal del ADN (2) Parte funcional y estructural del aparato traductor Proteinas,

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) Un poco de historia La técnica de PCR fue inventada por Kary B. Mullis en 1983. La primer publicación sobre PCR apareció en 1985, aunque el principio básico de replicar

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

ELECTROFORESIS. Agarosa. Poliacrilamida

ELECTROFORESIS. Agarosa. Poliacrilamida ELECTROFORESIS DE ADN ELECTROFORESIS Agarosa Poliacrilamida Finalidad de la electroforesis Separar Identificar Purificar 1 2 3 4 5 Tinción del ADN Bromuro de etidio Absorbancia a 302 y 366 y emisión a

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

N 1 Reacción n en Cadena de la Polimerasa

N 1 Reacción n en Cadena de la Polimerasa Trabajo Práctico N 1 Reacción n en Cadena de la Polimerasa Definición n e importancia. Usos y aplicaciones. Optimización. Tipos de PCR. Electroforesis. Fundamentos. Asociado al Programa Teórico: Tema 2.

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

PCR Múltiplex. Listeria monocytogenes

PCR Múltiplex. Listeria monocytogenes PCR Múltiplex Listeria monocytogenes PCR-múltiplex En una sola reacción de PCR se amplifican al mismo tiempo 2 o más genes Condiciones similares de PCR para los genes amplificar: Desnaturalización Alineamiento

Más detalles

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro

Tipos de Muestras. Técnicas de Biología Molecular. Extracción de ácidos nucleicos. Extracción de DNA genómico. Muestra de sangre en papel filtro Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Tipos de Muestras Extracción de ácidos nucleicos o DNA o RNA Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

40. Identificación de clones y fragmentos de ADNc mediante la reacción en cadena de la polimerasa (PCR)

40. Identificación de clones y fragmentos de ADNc mediante la reacción en cadena de la polimerasa (PCR) 40. Identificación de clones y fragmentos de ADNc mediante la reacción en cadena de la polimerasa (PCR) José Luis Caballero Repullo, Enriqueta Moyano Cañete, Juan Muñoz Blanco Departamento de Bioquímica

Más detalles

REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Lic. en Bioquímica Lic. en Biotecnología Microbiología de los Alimentos 2016 Desarrollada por Kary Mullis en 1986 Técnica in vitro que permite amplificar enzimáticamente

Más detalles

IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006

IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006 IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006 REACCION EN CADENA DE LA POLIMERASA (PCR) EN EL DIAGNOSTICO DE Campylobacter jejuni/coli Viernes 19 de mayo María Rosa Viñas Servicio

Más detalles

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos

Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Análisis de la Presencia de Organismos Genéticamente Modificados en Muestras de Alimentos Sesión nº 6 Reacción en Cadena de la Polimerasa (PCR) M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

PCR. Dr. Francisco Pérez Bravo Laboratorio de Genómica Nutricional Departamento de Nutrición Facultad de Medicina Universidad de Chile

PCR. Dr. Francisco Pérez Bravo Laboratorio de Genómica Nutricional Departamento de Nutrición Facultad de Medicina Universidad de Chile FUNDAMENTOS BASICOS EN PCR Dr. Francisco Pérez Bravo Laboratorio de Genómica Nutricional Departamento de Nutrición Facultad de Medicina Universidad de Chile Manipulación del DNA en el uso Principio diagnóstico

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15

TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 TEMA 2 LA INFORMACIÓN GENÉTICA COLEGIO LEONARDO DA VINCI BIOLOGÍA Y GEOLOGÍA 4º ESO CURSO 2014/15 OBJETIVOS DEL TEMA * Ácidos nucleicos. Composición. Estructura. Tipos. Funciones. * Procesos del dogma

Más detalles

PCR gen 16S ARNr bacteriano

PCR gen 16S ARNr bacteriano PCR gen 16S ARNr bacteriano Ref. PCR16S 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y la práctica de la Reacción en Cadena de la Polimerasa

Más detalles

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA. Estudio comparativo del diagnóstico del virus del PRRS por RT-PCR, PCR anidada y RT-PCR en tiempo real. Zoalli Angélica

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

Técnicas de amplificación. Fundamento teórico. PCR

Técnicas de amplificación. Fundamento teórico. PCR Técnicas de amplificación. Fundamento teórico. PCR JJuul lli iiáánn Saannzz Orrt teeggaa,, hhoossppi iit taal ll Cl llí ínni iiccoo Saann Caarrl llooss,, Maaddrri iidd 1.- Concepto El genoma humano consta

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

CURSO ACADÉMICO 2009 2010

CURSO ACADÉMICO 2009 2010 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2009 2010 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, Ecología y Genética Área de conocimiento: Genética Ciclo: 2º Curso: 4º Tipo:

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Tema 1. El análisis genético

Tema 1. El análisis genético Tema 1 El análisis genético Gen Genoma Genética Genómica Genómica estructural Genómica funcionall Mapas genéticos Mapas físicos EXPRESIÓN Transcriptoma Proteoma Interactoma FUNCIÓN Genética inversa ANÁLISIS

Más detalles

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17

Índice. 4. Protocolo de envío de muestras 9 5. Problemas más frecuentes durante la secuenciación 10 6. Algunos datos y formulas de utilidad 17 Índice Introducción 1 1. Modalidades de secuenciación 2 a. Secuenciación de una sola cadena 2 b. Secuenciación analítica 3 c. Secuenciación diagnóstica 3 2. Oligonucleótidos disponibles 5 3. Protocolo

Más detalles

Fisiogenética Vegetal

Fisiogenética Vegetal Fisiogenética Vegetal USO DE MARCADORES MOLECULARES, aplicaciones y ejemplos Cecilia Baginsky - Tradicionalmente los marcadores moleculares utilizados en estudios genéticos y de mejoramiento eran aquellos

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ Northern blot Marcación no radioactiva: Digoxigenina: se usa uno de los dntps marcado con digoxigenina Detección: Anticuerpo conjugado con enzima (ALP) o fluorocromo Biotina: se usa uno de los dntps

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

TÉCNICAS DE DIAGNÓSTICO MOLECULAR

TÉCNICAS DE DIAGNÓSTICO MOLECULAR TÉCNICAS DE DIAGNÓSTICO MOLECULAR Dra. Mariana L. Ferramola Curso de Técnicas moleculares aplicadas a bioquímica clínica. Área de Qca. Biológica FQByF, UNSL 2014 REACCIÓN DE PCR Esta reacción permite obtener

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

SECCIÓN I - INTRODUCCIÓN

SECCIÓN I - INTRODUCCIÓN Facultad de Medicina Genética 1 er Curso SECCIÓN I - INTRODUCCIÓN Tema 1. TÉCNICAS BÁSICAS DE GENÉTICA MOLECULAR Facultad de Medicina Genética 1 er Curso TEMA 1 TÉCNICAS BÁSICAS DE GENÉTICA MOLECULAR 1.1

Más detalles

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias.

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Dra. Sonia Arduino Dep. de Clínica Estomatología Facultad de Postgrado en Ciencias de la Salud

Más detalles

Organización del genoma eucariotico. 1. Complejidad del genoma eucariota

Organización del genoma eucariotico. 1. Complejidad del genoma eucariota Organización del genoma eucariotico Procariotas: Prácticamente todo el ADN existe en forma de copia única y codifica productos génicos (proteínas y ARNs) Eucariotas: La mayor parte del ADN es NO codificante.

Más detalles

ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR

ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR Ref. PCRALU 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena

Más detalles

CURSO ACADÉMICO 2012-2013

CURSO ACADÉMICO 2012-2013 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2012-2013 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, ecología y Genética Área de conocimiento: Genética Ciclo:2º Curso: 4º Tipo:

Más detalles

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS

TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS TEMA 7. TÉCNICAS EN BIOLOGÍA MOLECULAR: DETECCIÓN E IDENTIFICACIÓN DE MICROORGANISMOS I. TÉCNICAS EN BIOLOGÍA MOLECULAR: ESQUEMA DE TÉCNICAS UTILIZADAS 1. TECNICAS DE HIBRIDACIÓN CON SONDAS DE ACIDOS NUCLEICOS.

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

NUEVO MÉTODO DE PCR ANIDADA EN TIEMPO REAL CON EVAGREEN PARA DETERMINAR LA CARGA DE PAPILOMAVIRUS

NUEVO MÉTODO DE PCR ANIDADA EN TIEMPO REAL CON EVAGREEN PARA DETERMINAR LA CARGA DE PAPILOMAVIRUS NUEVO MÉTODO DE PCR ANIDADA EN TIEMPO REAL CON EVAGREEN PARA DETERMINAR LA CARGA DE PAPILOMAVIRUS Socorro Hernández-Arteaga, Mireya Sánchez-Garza, Rubén López-Revilla División de Biología Molecular, IPICYT,

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS

TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS TÉCNICAS MOLECULARES EN LA DETECCIÓN DE ORGANISMOS GENÉTICAMENTE MODIFICADOS EN LOS ALIMENTOS. Aplicación de la reacción en cadena de la polimerasa Marta Terrón Cuadrado Junio 2008 Curso de Experto Universitario

Más detalles

Taller Ciencia para Jóvenes CIMAT 2012 Bachillerato julio 8 14 Cinvestav Campus Guanajuato

Taller Ciencia para Jóvenes CIMAT 2012 Bachillerato julio 8 14 Cinvestav Campus Guanajuato Introducción Taller Ciencia para Jóvenes CIMAT 2012 Bachillerato julio 8 14 Cinvestav Campus Guanajuato Visita al CINVESTAV - Irapuato. 19 julio, 2012. Las bacterias son los organismos más abundantes que

Más detalles

ADN: USOS FORENSES. Juan Antiñolo Borrego 11ºC Nº3. Ensayo de C.C.M.C

ADN: USOS FORENSES. Juan Antiñolo Borrego 11ºC Nº3. Ensayo de C.C.M.C ADN: USOS FORENSES Juan Antiñolo Borrego 11ºC Nº3 Ensayo de C.C.M.C Dra. Rosario García Repetto, INTCF, Departamento Sevilla: 23/04/2013 1 ÍNDICE Qué es el INTCF? Pág. 3 Bases Genéticas para la identificación

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles

ESTRATEGIAS PARA LA DETECCÍON Y DIAGNOSIS DE VIRUS EN PLATANOS Y BANANOS EN LA COMUNIDAD ANDINA DE NACIONES

ESTRATEGIAS PARA LA DETECCÍON Y DIAGNOSIS DE VIRUS EN PLATANOS Y BANANOS EN LA COMUNIDAD ANDINA DE NACIONES ESTRATEGIAS PARA LA DETECCÍON Y DIAGNOSIS DE VIRUS EN PLATANOS Y BANANOS EN LA COMUNIDAD ANDINA DE NACIONES CIRO BARRERA Instituto Nacional de Innovación Agraria (INIA) PERÚ Piura, Junio 2011 INTRODUCCION

Más detalles

Extracción y purificación de los ácidos nucleicos

Extracción y purificación de los ácidos nucleicos Extracción y purificación de los ácidos nucleicos Todos los tipos de macromoléculas biológicas tienen una característica en común que va a permitir el desarrollo de un método de separación especifico para

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Comprobando la calidad del DNA genómico mediante electroforesis en gel

Comprobando la calidad del DNA genómico mediante electroforesis en gel Comprobando la calidad del DNA genómico mediante electroforesis en gel GELES 1 Y 2 Agarosa 0.8 %, electroforesis a 1 V/cm Muestras: Se ha cargado muestras de DNA genómico no digerido, antes (líneas impares)

Más detalles

Análisis de los microsatélites FGA, D7S820, D5S818 y D16S539 para la identificación de individuos.

Análisis de los microsatélites FGA, D7S820, D5S818 y D16S539 para la identificación de individuos. Clave: 140430 Análisis de los microsatélites FGA, D7S820, D5S818 y D16S539 para la identificación de individuos. Olicón-Hernández, Darío Rafael; Jaimes-Díaz, Hueman; Santiago-Hernández, Juan Carlos. DIRECCIÓN

Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Aplicaciones y Tendencias en secuenciación de ADN

Aplicaciones y Tendencias en secuenciación de ADN Aplicaciones y Tendencias en secuenciación de ADN Agus%n Arasanz Duque Unidad de Genómica Centres Cien%fics i Tecnològics Universidad de Barcelona Aplicaciones y Tendencias en secuenciación de ADN Introducción

Más detalles

EL EMPLEO DE ANÁLISIS BIOQUÍMICOS Y MOLECULARES EN EL EXAMEN DHE MOLECULARES EN EL EXAMEN DHE

EL EMPLEO DE ANÁLISIS BIOQUÍMICOS Y MOLECULARES EN EL EXAMEN DHE MOLECULARES EN EL EXAMEN DHE X Curso de Formación sobre la Protección de las Obtenciones Vegetales para Países Iberoamericanos Montevideo (URUGUAY) 12 al 16 de Diciembre de 2011 EL EMPLEO DE ANÁLISIS BIOQUÍMICOS Y MOLECULARES EN EL

Más detalles

LA NUEVA BIOTECNOLOGÍA

LA NUEVA BIOTECNOLOGÍA LA NUEVA BIOTECNOLOGÍA Ingeniería genética: técnicas que permiten manipular la información genética de un ser vivo. TECNOLOGÍA TRADICIONAL DEL ADN RECOMBINANTE CLONACIÓN DE GENES: Obtención de muchas copias

Más detalles