Tamaño: px
Comenzar la demostración a partir de la página:




2 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas exponencialmente mediante síntesis enzimática dirigida por una DNA polimerasa termoestable que es cebada por dos oligonucleótidos (cebadores o primers) y por el agregado de los desoxirribonucleótidos.


4 PROBLEMA DE PCR CLÁSICO (EJ. APLICACIÓN DIAGNÓSTICO) (3) La siguiente secuencia obtenida por RT-PCR, corresponde a la región 5 no codificante del cadn del virus de la hepatitis C (VHC). Se desea desarrollar un protocolo de amplificación por PCR de dicha secuencia que será utilizado para el diagnóstico de infección por VHC. 5...GTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTAT GCCTTGTGGTACTGCCTGAT AGGGTCGTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACCATGAGCA...3 a- Diseñe un par de cebadores adecuados (n 22) y un protocolo de PCR que permitan la amplificación de la región de interés. Marque claramente en qué región hibridan los oligonucleótidos diseñados y su T M. b- Indique el tamaño del producto de amplificación obtenido y qué sistema utilizaría para visualizarlo. c- Qué control diseñaría para evaluar la presencia de sustancias inhibitorias en la muestra de un paciente a procesar? d- Realice un esquema de las bandas que visualizaría en un gel (de las características especificadas en el ítem b) en el que se corrieron las siguientes muestras: calle 1: control negativo. calle 2: control positivo. calle 3: muestra de un paciente positivo para VHC (obtenida con EDTA). calle 4: muestra de un paciente positivo para VHC (obtenida con heparina). calle 5: marcador de tamaño molecular de tipo Ladder 100 pb.


6 a- Diseñe un par de cebadores adecuados (n 22) y un protocolo de PCR que permitan la amplificación de la región de interés. Marque claramente en qué región hibridan los oligonucleótidos diseñados y su T M. 5...GTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTAT G CCTTGTGGTACTGCCTGATAGGGTCGTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCAC CATGAGCA ACTATCCCAGCAACGCTCAC 5 Cebador directo: 5 TACTGTCTTCACGCAGAAAGC 3 T M : 11x2 + 10x4 = 62 C; 21 nt Cebador reverso: 5 CACTCGCAACGACCCTATCA 3 T M : 9x2 + 11x4 = 62 C; 20 nt b- Indique el tamaño del producto de amplificación obtenido y qué sistema utilizaría para visualizarlo. Tamaño del producto: 258 pb. Se puede visualizar en gel de agarosa al 2% (p/v).

7 c- Qué control diseñaría para evaluar la presencia de sustancias inhibitorias en la muestra de un paciente a procesar? d- Realice un esquema de las bandas que visualizaría en un gel (de las características especificadas en el ítem b) en el que se corrieron las siguientes muestras:

8 PROBLEMA DE TRANSCRIPCIÓN REVERSA SEGUIDA DE PCR (EJ. NIVEL DE EXPRESIÓN) (7) Usted desea comprobar si el gen biot se expresa en tejido hepático sometido a una droga mutagénica. Utilizando un programa de computación usted realizó el diseño de cebadores para amplificar un fragmento del cadn de longitud entre 100 y 300 pb. La siguiente secuencia de ADN genómico corresponde a una parte del gen biot que incluye un intrón (indicado en letra cursiva: 282 pb) que abarca desde el nucleótido 2779 al Los cebadores diseñados por el programa se encuentran subrayados en la secuencia y numerados del 1 al 6 entre paréntesis arriba de la secuencia doble hebra del ADN (1) (2) ACGTTTGCACGGATCCGATTAAACAGTACGAGTGGTCACATGGGCGGCTCTCAGATCAT 3 -TGCAAACGTGCCTAGGCTAATTTGTCATGCTCACCAGTGTACCCGCCGAGAGTCTAGTA TAGTCACAC pb tagcccacacatag ATCAGTGTG ATCGGGTGTGTATC (3) TGCTGCACTCCCGGGATATATTGACACTGC pb agat ACGACGTGAGGGCCCTATATAACTGTGACG TCTA (4) 3571 AACGTTGACCGTACGGTACCTTGGAACCCATGCGTACTGTGGGCGGCTCTCAGATCATGCA TTGCAACTGGCATGCCATGGAACCTTGGGTACGCATGACACCCGCCGAGAGTCTAGTACGT (5) 3591 (6) CATGCATGCACCAATGACCA pb ccggtcaccat GTACGTACGTGGTTACTGGT GGCCAGTGGTA ACACGTGTCGCACGCACTACTA-3 TGTGCACAGCGTGCGTGATGAT-5 a- Qué material de partida utilizaría para realizar el análisis de la expresión? b- Qué método utilizaría para medir la expresión del gen biot? Explique y justifique la metodología. c- Qué controles son necesarios para la interpretación de los resultados de la expresión del gen biot? d- Escriba las secuencias de todos los oligonucleótidos y calcule las T M de los mismos. e- Qué par de cebadores elegiría y cuáles no? Considere todos los pares de cebadores posibles y justifique su elección o no en cada caso. f- Calcule el tamaño del fragmento amplificado con el par de cebadores elegidos y diseñe un programa de PCR adecuado para llevar a cabo la reacción. g- Si su muestra estuviera contaminada con ADN genómico, los cebadores seleccionados le servirían para distinguir esta contaminación? Justifique. h- Proponga la amplificación de un producto que distinga tal situación.


10 a- Qué material de partida utilizaría para realizar el análisis de la expresión? RNA TOTAL O FRACCIÓN POLI-A DEL RNA DE EXTRACTO DE HÍGADO b- Qué método utilizaría para medir la expresión del gen biot? Explique y justifique la metodología. TÉCNICAS PARA DETERMINAR NIVELES DE EXPRESIÓN GÉNICA NORTHERN BLOT RT-PCR c- Qué controles son necesarios para la interpretación de los resultados de la expresión del gen biot? CONTROL NEGATIVO CONTROL POSITIVO CONTROL INTERNO CONTROL DE AUSENCIA DE ADN GENÓMICO d- Escriba las secuencias de todos los oligonucleótidos y calcule las T M de los mismos. Cebador 1: TTTGCACGGATCCGA T M = 46 C Cebador 2: GGCGGCTCTCAGATCAT T M = 54 C Cebador 3: GCAGTGTCAATATATCCCGGG T M = 64 C Cebador 4: ACCGTACGGTACCTTGG T M = 54 C Cebador 5: TGGTCATTGGTGCATGC T M = 52 C Cebador 6: CGTGTATGGTGACCGG T M = 52 C

11 e- Qué par de cebadores elegiría y cuáles no? Considere todos los pares de cebadores posibles y justifique su elección o no en cada caso (1) (2) ACGTTTGCACGGATCCGATTAAACAGTACGAGTGGTCACATGGGCGGCTCTCAGATCAT 3 -TGCAAACGTGCCTAGGCTAATTTGTCATGCTCACCAGTGTACCCGCCGAGAGTCTAGTA TAGTCACAC pb tagcccacacatag ATCAGTGTG ATCGGGTGTGTATC (3) TGCTGCACTCCCGGGATATATTGACACTGC pb agat ACGACGTGAGGGCCCTATATAACTGTGACG TCTA (4) 3571 AACGTTGACCGTACGGTACCTTGGAACCCATGCGTACTGTGGGCGGCTCTCAGATCATGCA TTGCAACTGGCATGCCATGGAACCTTGGGTACGCATGACACCCGCCGAGAGTCTAGTACGT (5) 3591 (6) CATGCATGCACCAATGACCA pb ccggtcaccat GTACGTACGTGGTTACTGGT GGCCAGTGGTA 1-3 hibrida sobre intrón 1-5 tamaño pdto tamaño pdto 4-6 ACACGTGTCGCACGCACTACTA-3 TGTGCACAGCGTGCGTGATGAT-5 f- Calcule el tamaño del fragmento amplificado con el par de cebadores elegidos y diseñe un programa de PCR adecuado para llevar a cabo la reacción. Tamaño amplificado: 294 pb ciclos de: Desnaturalización: 45 s a 94 C Anillado: 45 s a 48 C Elongación: 30 s a 72 C Elongación final: 5-10 min a 72 C

12 g- Si su muestra estuviera contaminada con ADN genómico, los cebadores seleccionados le servirían para distinguir esta contaminación? Justifique. h- Proponga la amplificación de un producto que distinga tal situación. Ó producto de mayor tamaño cebadores 1 y 5 pdto 859 pb sobre molde de ADN genómico (incluye el intrón) pdto 577 pb sobre molde de cadn.

13 PROBLEMA DE PCR PARA CLONADO MOLECULAR (3) Usted desea amplificar por PCR un gen bacteriano cuya secuencia se muestra a continuación (se subrayan los sitios de inicio y terminación de la traducción). HindIII 5 GGT CCC AAG CGA ATG TTC GGT CAG GAA CTG -582 nt- ACA TAA AAG CTT ATC TTC AGC TGC ATT 3 La proteína que codifica se debe obtener con todos los aminoácidos y se la quiere purificar introduciendo un tag de histidina amino terminal, para lo cual se realizará el clonado en el vector pet28. En el laboratorio se dispone sólo de las enzimas HindIII, BamHI y EcoRI, las cuales no se encontraron en la secuencia codificante. a- Diseñe los oligonucleótidos que usará, introduciendo sitios de restricción para realizar el clonado en el vector pet28, teniendo en cuenta que tengan temperaturas de anillado similares. b- Especifique cómo se induce la expresión, cuántos aminoácidos tendrá la proteína y cómo puede purificarla. c- Cómo puede eliminar la cola de histidina una vez purificada la proteína?

14 a- Diseñe los oligonucleótidos que usará, introduciendo sitios de restricción para realizar el clonado en el vector pet28, teniendo en cuenta que tengan temperaturas de anillado similares. Enzimas en el laboratorio: BamHI: G GATCC EcoRI: G AATTC HindIII: A AGCTT 5 GGT CCC AAG CGA ATG TTC GGT CAG GAA CTG 582 nt ACA TAA AAG CTT ATC TTC AGC TGC 3 Hind III

15 BamHI: G GATCC EcoRI: G AATTC HindIII: A AGCTT 5 GGT CCC AAG CGA ATG TTC GGT CAG GAA CTG 582 nt ACA TAA AAG CTT ATC TTC AGC TGC 3 Posibles combinaciones: D: BamHI - R: EcoRI D:BamHI - R: HindIII (A) D: EcoRI - R: HindIII (B) OLIGO REVERSO: 5 GCTGAAGATAAGCTTTTATG 3 Hind III Ta= Tm 4 C= ((4x7)+(2x13)) 4 C= 50 C; 20 nt.

16 OPCIÓN A: oligo directo con sitio para BamHI incorporando missmatches BamHI: G GATCC A T 5 GGT CCC AAG CGA ATG TTC GGT CAG GAA CTG 582 nt ACA TAA AAG CTT ATC TTC AGC TGC 3 OLIGO DIRECTO: 5 NNNGGATCCAAGCGAATGTTCGG 3 Ta= (Tm 4 C x missmatch) 4 C= ((4x11)+(2x9)) (2 x 4 C) 4 C= 50 C; 23 nt. GATCCAAGCGAATG.

17 OPCIÓN B: oligo directo con sitio para EcoRI incorporando el sitio de restricción entero. EcoRI: G AATTC 5 GGT CCC AAG CGA ATG TTC GGT CAG GAA CTG 582 nt ACA TAA AAG CTT ATC TTC AGC TGC 3 OLIGO DIRECTO: 5 NNNGAATTCATGTTCGGTCAGGAACTG 3 Ta= (Tm 4 C) = ((4x9)+(2x9)) 4 C= 50 C; 27 nt. AATTCATG.

18 b- Especifique cómo se induce la expresión, cuántos aminoácidos tendrá la proteína y cómo puede purificarla. Para expresar la proteína recombinante se transformará una cepa de Escherichia coli como la BL21(DE3) la cual posee el gen que codifica para la T7 ARN polimerasa. Esta enzima reconoce el promotor del bacteriófago T7 que dirige la expresión del gen de interés en el vector derivado de la serie pet28. La expresión será inducida mediante el agregado de IPTG (isopropil-β- D-tiogalactósido) el cual se une al represor LacI y libera el sitio de unión para la RNA polimerasa en el promotor. La proteína de fusión tendrá 237 aminoácidos en ambas opciones de clonado. La secuencia de polihistidinas amino terminal de la proteína recombinante permitirá purificarla selectivamente mediante una columna cromatográfica con resina de Ni-NTA. La proteína se eluye con imidazol.

19 OPCIÓN A: oligo directo con sitio para BamHI incorporando missmatches 5 GGT CCC AAG CGA ATG TTC GGT CAG GAA CTG 582 nt ACA TAA AAG CTT ATC TTC AGC TGC 3 10 aa aa + 1 aa + 29 aa + 3 aa = 237 aa

20 OPCIÓN B: oligo directo con sitio para EcoRI incorporando el sitio de restricción entero. 5 GGT CCC AAG CGA ATG TTC GGT CAG GAA CTG 582 nt ACA TAA AAG CTT ATC TTC AGC TGC 3 8 aa aa + 1 aa + 29 aa + 5 aa = 237 aa

21 c- Cómo puede eliminar la cola de histidina una vez purificada la proteína? El hexámero de histidinas amino terminal se puede eliminar de la proteína purificada mediante un tratamiento de proteólisis con trombina.

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles



Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

BIOLOGIA MOLECULAR. 04 de septiembre de 2017 Dra. Silvana Petrocelli

BIOLOGIA MOLECULAR. 04 de septiembre de 2017 Dra. Silvana Petrocelli CLASE DE PROBLEMAS: CLONADO BIOLOGIA MOLECULAR Lic. en Biotecnología 04 de septiembre de 2017 Dra. Silvana Petrocelli Problema 1-Clonado en fase-guía de problemas 2017 Se desea expresar un gen de superóxido

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

Soluciones de la serie de ejercicios 4 (Curso 7.012)

Soluciones de la serie de ejercicios 4 (Curso 7.012) Pregunta 1 Soluciones de la serie de ejercicios 4 (Curso 7.012) Usted está estudiando la síntesis del aminoácido triptófano en las bacterias. Las enzimas TrpA, TrpB, TrpC, TrpD, TrpE and AroH son necesarias

Más detalles

Problemas de clonado. Col. azul. Col. blanca. Patrón PM. 4500 pb. 2200 pb 2000 pb

Problemas de clonado. Col. azul. Col. blanca. Patrón PM. 4500 pb. 2200 pb 2000 pb LICENCIATURA EN BIOTECNOLOGÍA GUIA DE PROBLEMAS DE BIOLOGÍA MOLECULAR AÑO 2015 CLONADO, TRANSFORMACIÓN, PCR, HIBRIDACIÓN MOLECULAR, REGULACIÓN Y DESARROLLO Problemas de clonado 1) Se desea clonar en el

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética

Microbiología General 2006-2007. Tema 5: Transmisión de la información genética Microbiología General 2006-2007 Tema 5: Transmisión de la información genética Transmisión de la información genética Reparto del material genético en procariontes y eucariontes. Transferencia horizontal

Más detalles


QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA. Julio A. Carrasco Vallejo Julio 2014 QUÉ ES BIOLOGÍA MOLECULAR Y BIOTECNOLOGÍA Julio A. Carrasco Vallejo Julio 2014 Definiciones Biología Molecular: Estudio de los flujos de información genética en una célula Biotecnología: Uso de sistemas

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras...

Preguntas de selectividad en Andalucía. Ácidos nucleicos. Análisis e interpretación de imágenes, esquemas, figuras... Año 2001 Describa las funciones más relevantes de los nucleótidos. Cite un ejemplo de nucleótido que participe en cada una de ellas [1,5]. Explique las funciones de los distintos tipos de RNA que participan

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Comprobando la calidad del DNA genómico mediante electroforesis en gel

Comprobando la calidad del DNA genómico mediante electroforesis en gel Comprobando la calidad del DNA genómico mediante electroforesis en gel GELES 1 Y 2 Agarosa 0.8 %, electroforesis a 1 V/cm Muestras: Se ha cargado muestras de DNA genómico no digerido, antes (líneas impares)

Más detalles


TECNOLOGÍA DEL ADN RECOMBINANTE TECNOLOGÍA DEL ADN RECOMBINANTE Algunas preguntas (elementales): - Para que sirve? - Qué preguntas puede responder? Algunas aplicaciones: - Aislamiento o knockout de un gen de su contexto genético para

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles



Más detalles

Tecnología de DNA recombinante I

Tecnología de DNA recombinante I Tecnología de DNA recombinante I Base: capacidad de manipular moléculas de DNA en un tubo de ensayo Enzimas: Purificadas, con actividades conocidas y controladas DNA polimerasas Síntesis de DNA Nucleasas

Más detalles

Clonación. Producción de un gran número de copias de una región de ADN (fragmentos o

Clonación. Producción de un gran número de copias de una región de ADN (fragmentos o CLONACIÓN Clonación Producción de un gran número de copias de una región de ADN (fragmentos o genes) o de ADNc Clonación Celular Acelular Célula anfitriona PCR Secuenciación Estudio de estructura de ácido

Más detalles

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático

Criterios para diseñar primers. Iván Ferrer Rodríguez, Ph.D. Catedrático Criterios para diseñar primers Iván Ferrer Rodríguez, Ph.D. Catedrático 1 Qué es un primer? Es una cadena corta de nucleótidos, un oligonucleótido. Sirve como punto de partida para la replicación del DNA.

Más detalles

Técnicas descritas en el curso 7.28

Técnicas descritas en el curso 7.28 Técnicas descritas en el curso 7.28 Técnica: Clase 1 Experimento de incorporación de dntps Ensayo de extensión del cebador Ensayo de unión en filtro Electroforesis en gel Análisis de ADN Helicasa Polaridad

Más detalles

VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009

VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009 VECTORES Y CLONADO Martín Monte, viernes 27 de Marzo, 2009 Caracterización y estudio de la función de un gen (Tb podría ser un fragmento de DNA genómico para el estudio de splicing o del promotor de un

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles


I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS Asignatura: Frecuencia: Docente a cargo: Destinatarios: Anual 5 horas por semana Lic. César R. Olsina

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

EXAMEN DE LA PRIMERA PARTE (30%) NOMBRE CÓDIGO FECHA. El examen consta de un total de 20 puntos y el tiempo máximo para contestar es de 1 hora.

EXAMEN DE LA PRIMERA PARTE (30%) NOMBRE CÓDIGO FECHA. El examen consta de un total de 20 puntos y el tiempo máximo para contestar es de 1 hora. 1 PONTIFICIA UNIVERSIDAD JAVERIANA MAESTRÍA EN INFORMÁTICA CURSO DE BIOINFORMÁTICA EXAMEN DE LA PRIMERA PARTE (30%) NOMBRE CÓDIGO FECHA El examen consta de un total de 20 puntos y el tiempo máximo para

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

Biología Profundización

Biología Profundización UNIDAD 1: GENÉTICA SUB-UNIDAD 2: TRANSCRIPCIÓN Y TRADUCCIÓN Biología Profundización En esta sesión tú podrás: - Conocer el proceso transcripcional y post-transcripcional. - Reconocer los sucesivos procesos

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

Genómica y transcriptómica para la generación de datos en Evolución

Genómica y transcriptómica para la generación de datos en Evolución recuadro Genómica y transcriptómica para la generación de datos en Evolución Gabriela Bedó Genómica. Sus objetivos Compilar todas las secuencias de un organismo Establecer la localización de los genes

Más detalles



Más detalles


PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles



Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

Investigación en genes. Tecnología del ADN recombinante

Investigación en genes. Tecnología del ADN recombinante Investigación en genes Tecnología del ADN recombinante Tecnología del ADN recombinante 1º parte: Conocimientos básicos que posibilitaron su desarrollo 2º parte: Instrumentos básicos 3º parte Ejemplos Conocimientos

Más detalles


BIOTECNOLOGÍA Y GENÉTICA MOLECULAR BIOTECNOLOGÍA Y GENÉTICA MOLECULAR Conceptos de biotecnología y genética molecular. Importancia y beneficios de la biotecnología. Genética y Tecnología del DNA recombinante: estrategias de clonación. Enzimas

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles


REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS ANÁLISIS DE LA EXPRESIÓN DE LACZ REGULACIÓN DE LA EXPRESIÓN GÉNICA EN PROCARIOTAS ANÁLISIS DE LA EXPRESIÓN DE LACZ Para conocer la organización del ADN se desarrollaron métodos que permitieron conocer la secuencia exacta de nucleótidos,

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles



Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias.

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Dra. Sonia Arduino Dep. de Clínica Estomatología Facultad de Postgrado en Ciencias de la Salud

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Métodos de análisis biomédicos

Métodos de análisis biomédicos Métodos de análisis biomédicos 1 Aplicación de la biología molecular en medicina *Estudio y diagnóstico de enfermedades producidas por alteraciones genéticas (hereditarias ó somáticas) y aquellas producidas

Más detalles

Ingeniería genética y biotecnología. Ing. MBtA Kevin Estévez Ramírez Departamento de Agroindustria UNAH-CUROC

Ingeniería genética y biotecnología. Ing. MBtA Kevin Estévez Ramírez Departamento de Agroindustria UNAH-CUROC Ingeniería genética y biotecnología. Ing. Departamento de Agroindustria Los organismos involucrados. Virus: bacteriófagos, virus animales. Los organismos involucrados. Bacterias: Seres vivos más utilizados

Más detalles


CURSO ACADÉMICO 2012-2013 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2012-2013 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, ecología y Genética Área de conocimiento: Genética Ciclo:2º Curso: 4º Tipo:

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles



Más detalles

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Tipos de mapas: MAPAS FISICOS (de restricción, citogenéticos, de híbridos de radiación...)

Más detalles

Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular

Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular Unidad9. Principios de Ingeniería Genética Aplicaciones de Biología Molecular Aislamiento, análisis y manipulación de ácidos nucleicos Generación de moléculas de DNA recombinante Ingeniería Genética AISLAMIENTO

Más detalles

Métodos de análisis biomédicos

Métodos de análisis biomédicos Métodos de análisis biomédicos 1 Métodos de análisis biomédicos Comprenden métodos de análisis a nivel de DNA, RNA y proteínas que permitan tener un mayor conocimiento de una enfermedad dada, que puedan

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO

Más detalles

Soluciones de la serie de ejercicios 3 (Curso 7.012)

Soluciones de la serie de ejercicios 3 (Curso 7.012) Soluciones de la serie de ejercicios 3 (Curso 7.012) Stardate Diario personal del Médico militar del USS Hackerprise Al regresar de una misión en Europa, su compañero de tripulación, Noslen,

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

(aislado directamente de células o tejidos) de otros tipos de ADN, como el

(aislado directamente de células o tejidos) de otros tipos de ADN, como el Glosario admixtura: se refiere al estado de estar mezclado (del inglés admixture). Ocurre cuando se entrecruzan individuos de dos o más poblaciones que se encontraban previamente separadas y el resultado

Más detalles



Más detalles

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él.

ADN ARN Proteínas. La información genética es portada por el ADN y se hereda con él. Todos los organismos contienen información que les permite coordinar sus procesos. Esta información, a fin de poder ser transferida a la descendencia, esta asentada en una molécula capaz de replicarse,

Más detalles


MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA MEMORIA DE PRÁCTICAS SILVIA PÉREZ SOLANA DATOS DE LA EMPRESA Instituto de Biotecnología y Biomedicina de Cantabria (CSIC-UC- SODERCAN), Avda. Herrera Oria s/n. Santander. El tutor CSIC fue Raúl Fernández

Más detalles

ELECTROFORESIS. Agarosa. Poliacrilamida

ELECTROFORESIS. Agarosa. Poliacrilamida ELECTROFORESIS DE ADN ELECTROFORESIS Agarosa Poliacrilamida Finalidad de la electroforesis Separar Identificar Purificar 1 2 3 4 5 Tinción del ADN Bromuro de etidio Absorbancia a 302 y 366 y emisión a

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Qué es un gen? EXPRESION GÉNICA 01/05/2013

Qué es un gen? EXPRESION GÉNICA 01/05/2013 Qué es un gen? Es una secuencia de nucleótidos en la molécula de ADN, equivalente a una unidad de transcripción. Contiene la información, a partir de la cual se sintetiza un polipéptido, una enzima, un

Más detalles

Ingeniería Genética II

Ingeniería Genética II Ingeniería Genética II Expresión de proteínas recombinantes Vectores de expresión Características adicionales: - Promotor regulable - Terminador de la transcripción - Sitio de reconocimiento por el ribosoma

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles


5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Investigación en genes

Investigación en genes Investigación en genes Conocer el genóma de los organismos Modificar la dotación génica natural Tecnología a del ADN recombinante Conocimientos básicos que posibilitaron el desarrollo de la Tecnología

Más detalles



Más detalles


DATOS DE LA ASIGNATURA DATOS DE LA ASIGNATURA Denominación: Ingeniería Genética Aplicada Código: 58127 Clase: Optativa Curso: 2º Carácter: Cuatrimestral Cuatrimestre: 2º Créditos LRU: 6 Teóricos: 4.5 Prácticos: 1.5 Créditos

Más detalles

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN?

1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? ACTIVIDADES TEMA 4 - BIOTECNOLOGÍA 1. Cuáles son las diferencias en los componentes químicos del ADN y ARN? Las cadenas de ADN están formadas por fosfato y desoxirribosa y la del ARN por fosfato y ribosa.

Más detalles

Tecnología del ADN recombinante y sus aplicaciones en la Medicina. Los instrumentos básicos de la investigación de genes.

Tecnología del ADN recombinante y sus aplicaciones en la Medicina. Los instrumentos básicos de la investigación de genes. Tecnología del ADN recombinante y sus aplicaciones en la Medicina. Objetivos de aprendizaje -Conocer y familiarizarse con los principios básicos de la biología molecular. -Aprender fundamentos de las técnicas

Más detalles



Más detalles


INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles


REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA Tema 4 REVOLUCIÓN GENÉTICA Y BIOTECNOLOGÍA 1. ADN y ARN pág 92-93 -Composición química y conceptos: ADN, ARN, nucleótidos, bases nitrogenadas, ácido fosfórico. -Estructura: doble hélice, cadenas complementarias.

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ Northern blot Marcación no radioactiva: Digoxigenina: se usa uno de los dntps marcado con digoxigenina Detección: Anticuerpo conjugado con enzima (ALP) o fluorocromo Biotina: se usa uno de los dntps

Más detalles

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN

MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN MÉTODOS CROMATOGRÁFICOS: 1. Exclusión molecular 2. Intercambio iónico 3. Afinidad SSN Propiedades de una proteína que son útiles para su purificación por cromatografía Peso molecular Carga iónica Hidrofobicidad

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles