imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211"

Transcripción

1 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España

2 Garantías y responsabilidades Imegen le garantiza que todos sus productos están libres de defectos, tanto en los materiales empleados como en su proceso de su fabricación. Esta garantía se hace extensible hasta la fecha de caducidad, siempre que se observen las condiciones de conservación especificadas en este manual. Nuestros productos están diseñados para uso en investigación. El usuario de los productos es responsable de validar la utilidad de los protocolo propuestos por Imegen. Dichos protocolos se consideran únicamente una guía. Imegen no le ofrece ninguna otra garantía, expresa o implícita, que se extienda más allá del funcionamiento correcto de los componentes de este set. La única obligación de Imegen, respecto de las garantías precedentes, será la de reemplazar los productos, o bien devolver el precio de la compra de los mismos, a voluntad del cliente, siempre y cuando se pruebe la existencia de un defecto en los materiales, o bien en la elaboración de sus productos. Imegen no será responsable de ningún daño, directo o indirecto, que resulte en pérdidas económicas o en daños que pudieran producirse por el uso de este producto por parte del comprador o usuario. Todos los productos comercializados por el Imegen son sometidos a un riguroso control de calidad. El kit imegen Alfa-1-AT ha superado todas las pruebas de validación internas, que garantizan la fiabilidad y reproducibilidad de cada ensayo. Para cualquier consulta sobre las aplicaciones de este producto o sobre sus protocolos, puede contactar con nuestro Departamento Técnico: Teléfono: Rev. Julio /10

3 Índice Información del producto Descripción del kit Contenido del kit y almacenamiento.. 4 PCR a tiempo real... 5 Preparación de las reacciones de amplificación.. 5 Configuración del programa de la PCR a tiempo real 6 Análisis de los resultados Rev. Julio /10

4 1 Información del producto Descripción del kit El gen SERPINA1, localizado en la región cromosómica 14q32.1, codifica la alfa-1- antitripsina (AAT), también conocida como inhibidor de la proteasa (PI). La acción inhibidora más importante de AAT es frente a la elastasa de los neutrófilos, una proteasa que degrada la elastina de las paredes alveolares, así como otras proteínas estructurales de una variedad de tejidos. La deficiencia en AAT se asocia principalmente al riesgo de efisema y daño hepático. El kit imegen -Alfa-1-AT permite determinar el genotipo de dos mutaciones del gen del SERPINA1 que dan lugar a deficiencia en AAT: Glu342Lys (PI-Z) y Glu264Val (PI-S). Contenido del kit El kit contiene los siguientes reactivos necesarios para llevar a cabo las reacciones de PCR a tiempo real: Oligonucleótidos de amplificación de dos sistemas de PCR: PI-S y PI-Z. Por cada sistema de PCR se incluyen dos sondas marcadas con los fluoróforos FAM TM y VIC que permiten diferenciar entre el alelo normal y el alelo mutado. Un control positivo (Control Alfa-1-AT) para los 4 alelos analizados en este kit. El kit incluye reactivos suficientes para la realización de 48 determinaciones por cada uno de los sistemas de PCR. Reactivos Viales Conservación Master-Mix PI-S 2 x 24 reacciones -20ºC Master-Mix PI-Z 2 x 24 reacciones -20ºC Control Alfa-1-AT 1 x 200 μl -20ºC Tabla 1. Componentes del kit y temperatura de conservación Este kit ha sido probado y es compatible con las siguientes plataformas de Realtime PCR: LightCycler 480 o capilar (Roche), 7500 FAST y StepOne Real-Time PCR System (Thermo Scientific). Rev. Julio /10

5 2 PCR a tiempo real Preparación de las reacciones de amplificación Para el análisis de las dos mutaciones que se analizan con el kit imegen -Alfa-1-AT, se requiere la preparación de dos mixes diferentes de PCR. Cada mix de PCR estará formado por: Máster-Mix PI-S ó Master Mix PI-Z Máster-Mix PCR 2x (no incluido en el kit) Protocolo 1. Descongelar el Master-Mix PI-Z, Master-Mix PI-S, el control Alfa-1-AT y el ADN de las muestras. Dar un vórtex a cada uno de los reactivos y mantener en frío. 2. En tubos de 1,5 ml, uno para el análisis de cada mutación, añadir las cantidades necesarias de los reactivos de las tablas 2 ó 3 según el equipo de Real Time PCR que se vaya a emplear y en función del número de reacciones totales. Se recomienda realizar los cálculos añadiendo reactivos suficientes para analizar una reacción más, o bien añadir un 10% más de cada uno de los reactivos FAST y StepOne Real-Time PCR System (Thermo Scientific) Reactivos Máster-Mix PI-S o PI-Z Máster-Mix PCR 2x Volumen por reacción 7.5 L 12.5 L Tabla 2. Cantidad necesaria de reactivos por reacción empleando un 7500 FAST o StepOne LightCycler 480 o capilar (Roche) Reactivos Máster-Mix PI-S o PI-Z LightCycler FastStart DNA Master HybProbe MgCl 2 (25 mm) Agua Volumen por reacción 4 L 1 L 1 L 9 L Tabla 3 Cantidad necesaria de reactivos por reacción empleando un LightCycler 480 o capilar 3. Dar vórtex a los mix de PCR y distribuir 20 l en los pocillos de PCR, o bien 15 µl en los tubos capilares correspondientes. Rev. Julio /10

6 4. Añadir 5 l de ADN obtenido a partir de cada una de las muestras que se desea analizar a una concentración de 10 ng/µl y 5 l del control positivo, o de agua libre de nucleasas (control negativo) a los pocillos o capilares correspondientes. Configuración del programa de la PCR a tiempo real En función del equipo que se vaya a emplear para llevar a cabo la PCR a tiempo real, se deberán de seguir las siguientes instrucciones para configurar el programa de amplificación: 7500 Fast o StepOne Real-Time PCR system (Thermo Scientific) Tipo de experimento: Genotyping Velocidad de rampa: standard Volumen de reacción: 25 µl Referencia basal ROX TM : incluída Fluoróforos de las sondas TaqMan : Sonda Receptor Genotipado Emisor o Quencher PIS-A-P VIC Normal MGB PIS-T-P FAM TM Mutante MGB PIZ-G-P VIC Normal MGB PIZ-A-P FAM TM Mutante MGB Tabla 4. Información de las sondas Programa óptimo: Campos Número de ciclos Etapa 1 Activación enzimática 1 ciclo inicial Desnaturalización Etapa 2 PCR 50 ciclos Unión de oligonucleótidos/ extensión Temperatura 95ºC 95ºC 60ºC Tiempo 10 minutos 15 segundos 1 minuto* Tabla 5. Programa de PCR óptimo para el 7500 Fast o StepOne *Detección de la fluorescencia Rev. Julio /10

7 LightCycler 480 (Roche) Programa Óptimo: Etapa 1 Campos Activación enzimática Etapa 2 PCR Etapa 3 Número de ciclos 1 ciclo inicial Desnaturalización 50 ciclos Unión de oligonucleótidos Extensión 1 ciclo final Temperatura 95ºC 95ºC 60ºC 72ºC 40ªC Tiempo 10 minutos 5 segundos 10 segundos 15 segundos* 20 segundos Tabla 6. Programa del termociclador LightCycler 480 *Detección de la fluorescencia LightCycler Capilar (Roche) Samples>Selected Channels: Seleccionar 530 y 560 Programa Óptimo: Rev. Julio /10

8 3 Análisis de los resultados Para un correcto análisis de los resultados se recomienda seguir las siguientes indicaciones: Comprobar que en los controles negativos no hay amplificación. En caso de detectarse amplificación se recomienda repetir el ensayo para descartar que se haya producido una contaminación accidental. Comprobar que para el control Alfa-1-AT, tanto en el sistema PI-S como para el sistema PI-Z, hay señal de amplificación en los canales FAM y VIC. Para analizar las muestras hay que emplear un software específico. Si se realiza un análisis manual según el incremento de fluorescencia en cada uno de los canales se debe tener en cuenta las siguientes observaciones: 7500 Fast o StepOne Real-Time PCR system (Thermo Scientific) a. Sistema PI-S: Homocigoto normal: se observa amplificación en el canal VIC y una señal de amplificación residual en el canal FAM Homocigoto normal Heterocigoto: se observa una mayor amplificación en el canal FAM que en el canal VIC Heterocigoto Homocigoto mutante: se observa una mayor amplificación en el canal FAM Homocigoto mutante Rev. Julio /10

9 b. Sistema PI-Z: Homocigoto normal: se observa una mayor amplificación en el canal VIC que en el canal FAM Homocigoto normal Heterocigoto: se observa una mayor amplificación en el canal FAM que en el canal VIC Heterocigoto Homocigoto mutante: se observa una mayor amplificación en el canal FAM Homocigoto mutante El siguiente gráfico muestra un ejemplo de discriminación alélica en el sistema PI-Z. Tabla 7. Gráfico de Discriminación alélica en el sistema PI-Z Rev. Julio /10

10 LightCycler 480 y Capilar (Roche) a. Sistema PI-S: Nucleótido (c.863a>t) Genotipo Color Canal 530 (FAM) Resultados Canal 560 (VIC) A / A Homocigoto normal Verde A / T Heterocigoto Azul T / T Homocigoto mutante Rosa Tabla 8. Resultados esperados para el sistema de PCR PI-S en los diferentes canales (530 y 560) b. Sistema PI-Z: Nucleótido (c.1096g>a) Genotipo Canal 530 (FAM) Resultados Canal 560 (VIC) G / G Homocigoto normal CP: amplificación en el canal FAM; Muestra homocigota normal: Ausencia de amplificación en el canal FAM*. CP: amplificación en el canal VIC; Muestra homocigota normal: amplificación en VIC G / A Heterocigoto CP: amplificación en el canal FAM CP: amplificación en el canal VIC A / A Homocigoto mutante CP: amplificación en el canal FAM Muestra homocigota mutante: Amplificación en el canal FAM CP: amplificación en el canal VIC Muestra homocigota mutante: Ausencia de amplificación en el canal VIC Tabla 9. Resultados esperados para el sistema de PCR PI-Z en los diferentes canales (530 y 560) *Se observa amplificación residual de VIC en el canal FAM Rev. Julio /10

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS

PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems INDICE I. Introducción II. Objetivo General del Manual III. Políticas de

Más detalles

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx)

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

PROCEDIMIENTO DETECCION NOROVIRUS RT-qPCR EN EXTRACTO VIRAL PROVENIENTE DE MOLUSCOS BIVALVOS. PRT-712.07.01-097 Página 1 de 7

PROCEDIMIENTO DETECCION NOROVIRUS RT-qPCR EN EXTRACTO VIRAL PROVENIENTE DE MOLUSCOS BIVALVOS. PRT-712.07.01-097 Página 1 de 7 PRT-712.07.01-097 Página 1 de 7 1. OBJETIVO Realizar la detección molecular de genes de Norovirus en muestras de moluscos bivalvos. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a concentrados

Más detalles

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271.

SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. Technical Manual SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. IMPRESO EN ESTADOS UNIDOS Nro. de pieza: TMD037 SwabSolution Kit Toda la bibliografía técnica está disponible en Internet,

Más detalles

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271.

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 28 de abril de 2009 Revisión 1 (30 de abril e 2009) El Centro Colaborador para la Influenza de la

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Applied Biosystems StepOne Real-Time PCR System. Guía de reactivos

Applied Biosystems StepOne Real-Time PCR System. Guía de reactivos Applied Biosystems StepOne Real-Time PCR System Guía de reactivos Applied Biosystems StepOne Real-Time PCR System Guía de reactivos Copyright 2006, 2010 Applied Biosystems. All rights reserved. Information

Más detalles

Manual de uso del kit therascreen EGFR Plasma RGQ PCR

Manual de uso del kit therascreen EGFR Plasma RGQ PCR Diciembre de 2014 Manual de uso del kit therascreen EGFR Plasma RGQ PCR Versión 1 24 Para uso en diagnóstico in vitro Para uso con equipos Rotor-Gene Q MDx 870311 QIAGEN Manchester Ltd, Skelton House,

Más detalles

Caracterización por Real-Time PCR: algunas aplicaciones en genética animal. Dr. Ruben Pérez

Caracterización por Real-Time PCR: algunas aplicaciones en genética animal. Dr. Ruben Pérez Caracterización por Real-Time PCR: algunas aplicaciones en genética animal Dr. Ruben Pérez CARACTERIZACIÓN POR REAL-TIME PCR DIAGNÓSTICO: PRESENCIA/AUSENCIA AMPLICÓN Real Time PCR CARACTERIZACIÓN DEL AMPLICÓN

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

High Resolution Melting (HRM)

High Resolution Melting (HRM) High Resolution Melting (HRM) El análisis de las Curvas de Melting en conjunción con el Real Time PCR fue introducido en 1997 (Ririe et al., Anal Biochem 1997; 245: 154 60; Lay et al., Clin Chem 1997;43:2262

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07 PCR A TIEMPO REAL María Maiques R4-Bioquímica Clínica 25-Abril-07 VEAMOS Herramientas para detectar mutaciones Moléculas fluorescentes y tecnología FRET PCR a tiempo real: equipos y métodos de detección

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL. Guía de interpretación de resultados

SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL. Guía de interpretación de resultados SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL Guía de interpretación de resultados Sistemas de detección de patógenos por PCR a tiempo real Microbial ofrece sistemas para la detección de patógenos

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

RapidFinder STEC Detection Workflow

RapidFinder STEC Detection Workflow QUICK REFERENCE RapidFinder STEC Detection Workflow Aislamiento automático de ADN y detección de la PCR en tiempo real de E. coli O157:H7 y cepas "Big 6" de STEC no O157 Número de catálogo 4480466, 4428176,

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

Bacterióloga contratista

Bacterióloga contratista Elaborado por: Miguel Angel Diaz Osório Bacteriólogo M.Sc. Fecha: 2011/06/15 1. OBJETIVO PROCESO REDES EN SALUD PUBLICA Método de ensayo para la identificación de siete serotipos de Salmonella por PCR

Más detalles

Información de la OMS para diagnóstico de laboratorio del nuevo virus de la Influenza A (H1N1) en seres humanos

Información de la OMS para diagnóstico de laboratorio del nuevo virus de la Influenza A (H1N1) en seres humanos Información de la OMS para diagnóstico de laboratorio del nuevo virus de la Influenza A (H1N1) en seres humanos SeenfatizalarecomendaciónquetodaslasmuestrasdeinfluenzatipoAnosubtificables seanenviadasdeinmediatoparaeldiagnósticoylacaracterizaciónadicionalaunode

Más detalles

Kit de diagnóstico in vitro LightMix Poliomavirus JC y BK

Kit de diagnóstico in vitro LightMix Poliomavirus JC y BK Kit de diagnóstico in vitro LightMix Poliomavirus JC y BK N. cat.: 40-0206-32 Detección del ADN genómico de los virus JC y BK para ser utilizado con los Instrumentos LightCycler de Roche Diagnostics Reactivos

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente M.Sc. Viviana Fino - DuPont N&H ACHIPIA 2015 8 de octubre de 2015 Santiago, Chile Necesidades de la Industria

Más detalles

(PROCEDIMIENTO NEGOCIADO)

(PROCEDIMIENTO NEGOCIADO) INFORME DE ADJUDICACIÓN DE LAS OFERTAS PRESENTADAS EN EL EXPEDIENTE 039/10: ADQUISICIÓN DE UN EQUIPO DE PCR A TIEMPO REAL PARA EL CENTRO SINGULAR DE INVESTIGACIÓN EN MEDICINA MOLECULAR Y ENFERMEDADES CRÓNICAS

Más detalles

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408.

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. Technical Manual PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. IMPRESO EN ESTADOS UNIDOS PowerPlex Fusion System Toda la bibliografía técnica está disponible en Internet,

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

Abbott RealTime HIV-1

Abbott RealTime HIV-1 6L18 51-605130/R1 Abbott RealTime HIV-1 Nota: consulte las modificaciones marcadas es 6L18 51-605130/R1 Símbolos utilizados Fabricante referencia lote Producto sanitario para diagnóstico in vitro Control

Más detalles

CENTRO NACIONAL DE ALIMENTACIÓN

CENTRO NACIONAL DE ALIMENTACIÓN CENTRO NACIONAL DE ALIMENTACIÓN Presencia de maíz MG en productos alimenticios de diversa procedencia Servicio de Biotecnología Josefina Gangoso Herreras Maíces MG autorizados UE 12 eventos individuales

Más detalles

La Biología Molecular Aplicada a la detección de patógenos en alimentos

La Biología Molecular Aplicada a la detección de patógenos en alimentos La Biología Molecular Aplicada a la detección de patógenos en alimentos La detección fiable y rápida de microorganismos patógenos en el mercado alimentario es de especial importancia no sólo por sus efectos

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 REF/ PROYECTO: PROMIS 2012 NÚMERO DE LOTES: UNICO Este pliego contempla la adquisición de un sistema

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Extracción y purificación de los ácidos nucleicos

Extracción y purificación de los ácidos nucleicos Extracción y purificación de los ácidos nucleicos Todos los tipos de macromoléculas biológicas tienen una característica en común que va a permitir el desarrollo de un método de separación especifico para

Más detalles

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

VALIDACIÓN Y CONTROL DE CALIDAD DE LOS MÉTODOS DE REACCIÓN EN CADENA DE LA POLIMERASA UTILIZADOS PARA EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS

VALIDACIÓN Y CONTROL DE CALIDAD DE LOS MÉTODOS DE REACCIÓN EN CADENA DE LA POLIMERASA UTILIZADOS PARA EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS CAPÍTULO 1.1.3 VALIDACIÓN Y CONTROL DE CALIDAD DE LOS MÉTODOS DE REACCIÓN EN CADENA DE LA POLIMERASA UTILIZADOS PARA EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS RESUMEN El diagnóstico de las enfermedades

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

Técnica de CGH-array. María Rodríguez-Rivera

Técnica de CGH-array. María Rodríguez-Rivera Técnica de CGH-array María Rodríguez-Rivera Laboratori de Citogenètica Molecular. Servei de Patologia. Hospital del Mar. Programa de Càncer-IMIM. Barcelona Índice Introducción a los microarrays Arrays

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Sistema PowerPlex 18D System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC1802 Y DC1808.

Sistema PowerPlex 18D System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC1802 Y DC1808. Technical Manual Sistema PowerPlex 18D System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC1802 Y DC1808. IMPRESO EN ESTADOS UNIDOS Sistema PowerPlex 18D System Toda la bibliografía técnica está disponible

Más detalles

Manual del kit Investigator Quantiplex HYres

Manual del kit Investigator Quantiplex HYres Agosto 2012 Manual del kit Investigator Quantiplex HYres Para la cuantificación de ADN humano y masculino en muestras forenses Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN es

Más detalles

Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler

Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler Ficha Técnica del LightCycler Selección de las Secuencias de las Sondas de Hibridización para ser utilizadas en el LightCycler Por Olfert Landt y Andreas Nitsche, TIB MOLBIOL, Berlín Traducción: Adriana

Más detalles

INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD

INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD T. 976 22 11 33 WWW.BIOSALUD.ORG RESIDENCIAL PARAÍSO, 9 50006 ZARAGOZA -SPAIN- INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD Han sido remitidas al Centro de Análisis

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA 1. DESCRIPCIÓN DEL SERVICIO El servicio de Secuenciación Masiva tiene como finalidad el proporcionar asesoramiento y soporte técnico a los grupos de investigación interesados en realizar proyectos de ultrasecuenciación.

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

Tecnología HaloPlex by Genycell Biotech España

Tecnología HaloPlex by Genycell Biotech España Paneles de genes custom-made Tecnología HaloPlex by Genycell Biotech España SERVICIO NGS CLÍNICA HALO: OVERVIEW 1. DISEÑO DEL PANEL DE GENES Y DEL KIT DE CAPTURA 2. PREPARACIÓN DE LA MUESTRA EN EL LABORATORIO

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

DEFICIENCIA DE ALFA-1- ANTITRIPSINA

DEFICIENCIA DE ALFA-1- ANTITRIPSINA DEFICIENCIA DE ALFA-1- ANTITRIPSINA UN MODELO DE ENFERMEDAD CONFORMACIONAL Maria Eugenia Ibañez Hospital Italiano de Buenos Aires Laboratorio Central Las serpinas-inhibidores de proteasas Muchos procesos

Más detalles

Historia. Hibridación in situ Fluorescente

Historia. Hibridación in situ Fluorescente Fluorescent in situ Hybridization Historia Hibridación in situ Desarrollada por Pardue & Gall (1969) -Muy pocas secuencias de DNA disponibles -Radioisótopos Alto entrenamiento Seguridad Tiempo Hibridación

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

FUNDAMENTOS DE LA TÉCNICA PCR

FUNDAMENTOS DE LA TÉCNICA PCR FUNDAMENTOS DE LA TÉCNICA PCR 1 2 PCR Qué es? REACCIÓN EN CADENA DE LA POLIMERASA Técnica que nos permite amplificar selectivamente un segmento específico de DNA, hasta obtener una cantidad suficiente

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Selección de pacientes

Selección de pacientes 2 Selección de pacientes MENSAJES CLAVE Aproximadamente entre el 20% y el 30% de las pacientes con cáncer de mama presentan tumores HER2 positivos. Hasta un 24% de los tumores con receptores de estrógenos

Más detalles

BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA

BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA BIOLOGÍA GENERAL Y METODOLOGÍA DE LAS CIENCIAS TRABAJO PRÁCTICO Nº 2 GENÉTICA Objetivos: Diferenciar los niveles de organización y compactación del material genético. Comprender los principios básicos

Más detalles

1. OBJETO DEL CONTRATO

1. OBJETO DEL CONTRATO PLIEGO DE PRESCRIPCIONES TECNICAS PARA LA CONTRATACIÓN DEL SUMINISTRO DE DIVERSO MATERIAL CON DESTINO PARA EL CENTRO DE INVESTIGACIÓN BIOMÉDICA EN RED DE SALUD MENTAL (CIBERSAM) En este documento se detallarán

Más detalles

PCR a tiempo real. Análisis de patógenos en alimentos. APPLUS+ Laboratorio de Genética 20.11.2007

PCR a tiempo real. Análisis de patógenos en alimentos. APPLUS+ Laboratorio de Genética 20.11.2007 PCR a tiempo real. Análisis de patógenos en alimentos APPLUS+ Laboratorio de Genética 20.11.2007 Índice 0_ Applus + 1_ Roche 2_ Real Time PCR 3_ LightCycler 480 4_ Detección de patógenos Applus+ 00 Applus+

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA

Instituto de Biomedicina y Biotecnología de Cantabria (IBBTEC) SERVICIO DE SECUENCIACIÓN MASIVA 1. DESCRIPCIÓN DEL SERVICIO El servicio de Secuenciación Masiva tiene como finalidad el proporcionar asesoramiento y soporte técnico a los grupos de investigación interesados en realizar proyectos de ultrasecuenciación.

Más detalles

Instrucciones de Uso GenDx SBTexcellerator

Instrucciones de Uso GenDx SBTexcellerator Octavo Edición Julio de 2011 Instrucciones de Uso GenDx SBTexcellerator Para Tipificación Basada en Secuenciación de HLA de alta resolución Genome Diagnostics B.V. Teléfono: +31 302 523 799 Correo electrónico:

Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas)

DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Soluciones validadas que aumentan la eficiencia en la rutina de trabajo de tu laboratorio

Soluciones validadas que aumentan la eficiencia en la rutina de trabajo de tu laboratorio Cristina Gómez, X workshop MRAMA iq-check TM Real Time PCR y medios cromogénicos RAPID Soluciones validadas que aumentan la eficiencia en la rutina de trabajo de tu laboratorio BIO-RAD la compañía Fundada

Más detalles

CYP 2C9 A1075C CYP2C9*3

CYP 2C9 A1075C CYP2C9*3 CYP 2C9 A1075C Sistema para la detección de la mutación A1075C en el gene del citocromo P450 2C9. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy

Más detalles

Microbial. Kits para la detección molecular de bacterias patógenas

Microbial. Kits para la detección molecular de bacterias patógenas Kits de detección rápida de bacterias patógenas para el laboratorio de Microbiología Salmofast Legiofast Listerfast 1 Publicaciones científicas PCR 2 Agua Alimentos Artículos científicos Año Ventas equipos

Más detalles

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS S. Microbiología Hospital General Universitario de Elche Abril 2009 HEPATITIS A INTRODUCCION La principal característica diferencial

Más detalles

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Tel. 91 710 00 74 Fax 93 843 78 84 e-mail: info@biotools.eu www.biotools.eu BIOPAP Kit Kit para la detección

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

1) a) En la figura señale, englobando con un trazo continuo, lo siguiente: CÁTEDRA: BIOQUÍMICA Carreras: Farmacia Profesorado en Química Licenciatura en Química Licenciatura en Alimentos ÁCIDOS NUCLEICOS 1) a) En la figura señale, englobando con un trazo continuo, lo siguiente:

Más detalles

(aislado directamente de células o tejidos) de otros tipos de ADN, como el

(aislado directamente de células o tejidos) de otros tipos de ADN, como el Glosario admixtura: se refiere al estado de estar mezclado (del inglés admixture). Ocurre cuando se entrecruzan individuos de dos o más poblaciones que se encontraban previamente separadas y el resultado

Más detalles