TaqMan GMO Screening Kit. Part No:

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "TaqMan GMO Screening Kit. Part No: 4466334"


1 TaqMan GMO Screening Kit Part No:

2 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor extensión de cultivo a nivel mundial. Estas especies y sus derivados (almidón de maíz, proteína de soja, etc.) constituyen los ingredientes de más del 60% de los alimentos que consumimos. La Unión Europea ha establecido un marco legal que regula el empleo, la liberación al medio ambiente y sobre todo, el etiquetado de los productos alimenticios que contienen estos organismos. El TaqMan GMO Screening kit, permite analizar la presencia de ADN transgénico mediante la detección de tres regiones reguladoras presentes en los organismos modificados genéticamente aprobados por la UE. Este kit emplea tecnología Real-Time PCR y contiene todos los reactivos necesarios para llevar a cabo la detección de OMG en ADN obtenido a partir de cualquier alimento o pienso. Además, el kit contiene un Control Positivo Interno (IPC) que permite identificar la presencia de inhibición durante el proceso de PCR. Rev /12

3 2. Descripción del kit El TaqMan GMO Screening kit permite detectar todos los eventos transgénicos aprobados en la Unión Europea, así como la mayoría de los eventos descritos en las bases de datos mundiales. El promotor 35S obtenido a partir del virus de mosaico de la coliflor (CaMV) y el terminador NOS procedente de Agrobacterium tumefaciens, son los elementos reguladores que se han analizado tradicionalmente para el cribado de material transgénico en alimentos. Actualmente, estos elementos reguladores no cubren eventos transgénicos tan importantes como la soja MON89788, la remolacha H7-1 o la colza GT73. Con el objetivo de disponer del mayor espectro de detección, el TaqMan GMO Screening kit, incluye el promotor 34S del Figwort Mosaic Virus (FMV), además de las regiones reguladoras P35S y TNOS Los elementos reguladores presentes en los OMG se encuentran de forma natural en los organismos de los que proceden (CaMV, A. tumefaciens y FMV). Por este motivo, el empleo de regiones reguladoras suscita controversia a la hora de interpretar un resultado positivo. TaqMan GMO Screening kit, incorpora la detección simultanea de una región genómica exclusiva de estos tres organismos que permite discriminar de forma inequívoca si un resultado positivo se debe a la presencia de material modificado genéticamente o se debe a la presencia natural de estos organismos. Para llevar a cabo el análisis de cada muestra, se realizan cuatro reacciones de PCR a tiempo real. En cada una de estas reacciones se amplifican dos regiones independientes mediante una única reacción de PCR multiplex, empleando dos canales del termociclador (FAM y VIC). A continuación se describen las reacciones de amplificación: P35S/CaMV: En esta reacción hay dos sondas tipo TaqMan una esta marcada con el fluoróforo FAM y detecta amplificados del elemento regulador P35S del virus CaMV y la otra sonda esta marcada con VIC para detectar un amplificado espécifico del virus CaMV. TNOS/A. tumefaciens: La reacción incluye dos sondas TaqMan. Una de ellas está marcada con el fluoróforo FAM y detecta amplificados del elemento regulador TNOS procedente de A. tumefacines. La otra sonda esta marcada con VIC y detecta amplificados procedentes de una región genómica exclusiva de esta bacteria. Rev /12

4 P34S/FMV: La reacción incluye dos sondas TaqMan. Una de ellas está marcada con el fluoróforo FAM y detecta amplificados del elemento regulador P34S procedente del virus FMV. La otra sonda esta marcada con VIC y detecta amplificados procedentes de una región genómica exclusiva de este virus. Vegetal/IPC: La reacción incluye dos sondas TaqMan. Una de ellas está marcada con el fluoróforo FAM y detecta ADN vegetal. La otra sonda esta marcada con VIC y detecta un Control Positivo Interno, que utilizaremos para descartar la presencia de inhibidores en la muestra. Se ha verificado que el límite de detección de la PCR es de 5 copias de ADN por reacción para todas las regiones analizadas con este kit. Este kit permite detectar estándares certificados que contengan un porcentaje igual o inferior al 0,1% de diferentes eventos y especies vegetales transgénicas. 3. Componentes y almacenamiento del kit Este kit contiene los reactivos necesarios para la realización de 48 determinaciones de cada una de las regiones analizadas (ver apartado anterior): REACTIVOS Identificación Cantidad Conservación P35S Disco rojo 400 μl -20ºC TNOS Disco azul 400 μl -20ºC P34S-FMV Disco amarillo 400 μl -20ºC Vegetal Disco verde 400 μl -20ºC General Disco blanco 3 x 880 μl 4ºC Control Positivo Tapón naranja 100 μl -20ºC Rev /12

5 4. Listado de equipamiento necesario La siguiente tabla muestra el equipamiento necesario para utilizar el TaqMan GMO Screening Kit: EQUIPAMIENTO NECESARIO 1 Termociclador Real-time PCR con canales de detección para los fluoróforos FAM (520 nm) y VIC (550 nm) 2 Juego de micropipetas (10, 20 y 200 ul) 3 Centrífuga de sobremesa con adaptadores para placas de 96 y/o tubos 4 Vortex 5. Listado de material fungible necesario La siguiente tabla muestra el material fungible necesario para utilizar el TaqMan GMO Screening Kit: MATERIALES 1 2 Placas de PCR ópticas aptas para el termociclador empleado o tubos ópticos de 0,2 ml Films ópticos para cubrir las placas de PCR o tapas ópticas para los tubos empleados 3 Puntas con filtro desechables para micropipetas 4 Tubos estériles de 1,5 ml 5 Guantes de látex sin talco Rev /12

6 6. Preparación de las reacciones de amplificación El TaqMan GMO Screening kit está diseñado para realizar cuatro reacciones por cada muestra que se desea analizar (P35S, TNOS, P34S-FMV y Vegetal). Para estimar la cantidad de reactivos necesaria, se debe tener en cuenta el número de muestras y controles a analizar simultáneamente. Recomendamos realizar los cálculos, considerando una reacción más, o bien, incrementando un 10% el volumen de cada reactivo. Se prepararán 4 masters de PCR distintos; uno para cada región analizada. A continuación se muestra el protocolo recomendado para la preparación de las reacciones de amplificación: 1. Descongelar los (consultar página 5), el Control Positivo y los ADNs de las muestras (en caso de que se conserven congelados). 2. Dar un vórtex a cada uno de los reactivos y mantener en frío. 3. En un tubo de 1,5 ml, añadir 7,5 μl del por cada una de las reacciones. 4. Añadir 12,5 μl del General a cada una de las reacciones. Dar un vórtex y pipetear 20 μl en cada pocillo o tubo. 5. Añadir 5 μl del ADN (10-25 ng/μl) de las muestras en los pocillos correspondientes. 6. Añadir 5 μl del Control Positivo y de los controles negativos en los pocillos correspondientes. 7. Tapar la placa con film óptico y dar un spin. Rev /12

7 7. Programa de amplificación Someter las reacciones de amplificación al siguiente programa de amplificación: Temperatura Tiempo Ciclos 95ºC 10 minutos 1 95ºC 15 segundos 60ºC 1 minuto 50 Nota: Este programa ha sido validado en un equipo StepOne Real-Time PCR System de Applied Biosystems. Si se emplea en otra marca o modelo de termociclador, es posible que se deba ajustar el programa de amplificación. Póngase en contacto con nuestro servicio técnico si necesita recibir asesoramiento. Rev /12

8 8. Análisis de los resultados Antes de analizar los resultados de las muestras, se debe comprobar que el resultado obtenido en los diferentes controles es el esperado: Control Positivo: El resultado debe ser siempre positivo en todas las reacciones de amplificación, tanto en el canal de FAM como en de VIC. Controles negativos: Únicamente se debe detectar amplificación en el canal de VIC de la reacción realizada con el Vegetal. En este canal se detecta un control interno positivo (IPC) que determina la ausencia de inhibición en la muestra. Vegetal/IPC Se deberá comprobar en todas las muestras que el IPC (VIC) es positivo, y que el Ct en el que se detecta es similar al del Control Positivo. Un resultado negativo en el IPC indica la presencia de inhibidores en la muestra. Se debe tener en cuenta que es posible que el resultado del IPC sea negativo en muestras donde se detecta en una gran cantidad de ADN vegetal (FAM), debido a que los reactivos de la PCR se agotan antes de iniciarse la amplificación del IPC. P35S/CaMV La amplificación de P35S (FAM) junto con la ausencia de amplificación del CaMV (VIC) indica la presencia de material transgénico en la muestra. Si se detecta amplificación tanto para P35S como para CaMV indica que en la muestra esta presente el virus CaMV y, en este caso, no se puede determinar si la muestra contiene material transgénico ya que no es posible discriminar si el promotor 35S procede del CaMV, presente de forma natural en la muestra, o bien, procede del material modificado genéticamente. TNOS/A. tumefaciens La amplificación de TNOS (FAM) junto con la ausencia de amplificación de A. tumefaciens (VIC) indica la presencia de material transgénico en la muestra. Si se detecta amplificación tanto para TNOS como para A. tumefaciens indica que en la muestra esta presente bacteria Agrobacterium tumefaciens y, en este caso, no se puede determinar si la muestra contiene material transgénico ya que no es posible discriminar si el terminador NOS procede de la bacteria, presente de forma natural en la muestra, o bien, procede del material modificado genéticamente. Rev /12

9 P34S/FMV La amplificación de P34S (FAM) junto con la ausencia de amplificación del virus FMV (VIC) indica la presencia de material transgénico en la muestra. Si se detecta amplificación tanto para P34S como para FMV indica que en la muestra está presente el virus y, en este caso, no se puede determinar si la muestra contiene material transgénico ya que no es posible discriminar si P34S procede del virus, presente de forma natural en la muestra, o bien, procede del material modificado genéticamente. En las muestras donde no hay amplificación en las reacciones de P35S, TNOS y P34S (FMV) se puede concluir que no se ha detectado la presencia de material transgénico. En la siguiente tabla se representan gráficamente los resultados que se pueden obtener a partir del análisis de una muestra, así como la interpretación que se debe hacer a partir del resultado obtenido: Vegetal P35S TNOS P34S-FMV Veg. IPC P35S CaMV TNOS A. tum P34S FMV INTERPRETACIÓN No se ha detectado material transgénico. Se ha detectado material transgénico que contiene P35S Se ha detectado material transgénico que contiene TNOS Se ha detectado material transgénico que contiene P34S Se ha detectado la presencia de CaMV Se ha detectado la presencia de A. tumefaciens Se ha detectado la presencia de FMV Presencia de inhibidores de la PCR en la muestra * Muestra sin ADN vegetal Muestra con una gran cantidad de ADN vegetal * Si se detecta la presencia de inhibidores en la muestra, le aconsejamos que verifique si se ha puesto un exceso de ADN en la reacción (la cantidad máxima aconsejable es de 250 ng). Si la cantidad de ADN es correcta, le aconsejamos repetir la extracción del ADN empleando un nuevo protocolo (contacte con nuestro departamento técnico si precisa asesoramiento). Rev /12

10 En la siguiente tabla se representan gráficamente los resultados que se pueden obtener a partir del análisis de diferentes controles del ensayo, así como la interpretación que se debe hacer a partir del resultado obtenido: Vegetal P35S TNOS P34S-FMV Veg IPC P35S CaMV TNOS A. tum P34S FMV Control Positivo INTERPRETACIÓN Resultado esperado Control Negativo de Extracción 1 Fallo en la amplificación Resultado esperado /- - +/- - +/- - Control Negativo de PCR 2 Contaminación de la extracción con material vegetal 3 Contaminación con material transgénico Resultado esperado /- - +/- - +/ Recomendaciones: 4 Contaminación de la extracción con ADN vegetal 5 Contaminación con ADN de material transgénico 6 Contaminación, posiblemente con el Control Positivo 1 Revise el programa de amplificación y la configuración de la captura de fluorescencia. El fallo en la amplificación puede deberse a un problema técnico de configuración. 2-3 La contaminación puede deberse a algún error cometido en el proceso de manipulación de las muestras, contaminación de los reactivos o contaminación ambiental. Revise el protocolo de extracción de ADN, limpie a fondo el laboratorio donde se lleva a cabo el proceso de extracción de ADN y extreme las precauciones para evitar cualquier contaminación durante el proceso de homogeneización de las muestras. Si lo considera necesario, utilice nuevas alícuotas de los reactivos empleados en la extracción de ADN. 4-5 La contaminación de las reacciones de PCR puede a algún error cometido en el proceso de manipulación de las muestras, contaminación de los reactivos empleados o contaminación ambiental. Limpie a fondo el laboratorio donde se lleva a cabo el proceso de PCR y sus equipos. Si lo considera necesario, utilice nuevas alícuotas de los reactivos empleados en la PCR. 6 Prepare la reacción de PCR que contiene el Control Positivo en último lugar para evitar contaminaciones cruzadas. Limpie a fondo el laboratorio donde se lleva a cabo el proceso de PCR y sus equipos. Si lo considera necesario, utilice nuevas alícuotas de los reactivos empleados en la PCR. Rev /12

11 9. Control de calidad Todos los productos comercializados por el Instituto de Medicina Genómica son sometidos a un riguroso control de calidad. El TaqMan GMO Screening kit ha superado todas las pruebas de validación internas, que garantizan la fiabilidad y reproducibilidad de cada ensayo. Puede consultar el Certificado de Análisis correspondiente a su kit, introduciendo el número de lote del producto en la sección de Kits de Análisis de la web Garantías y responsabilidades El Instituto de Medicina Genómica le garantiza que todos sus productos están libres de defectos, tanto en los materiales empleados como en su proceso de su fabricación. Esta garantía se hace extensible a un período de un año desde la fecha de envío del producto, siempre que se observen las condiciones de conservación especificadas en este Manual. Nuestros productos están diseñados para uso en investigación. El usuario de los productos es responsable de validar la utilidad de los protocolo propuestos por el Instituto de Medicina Genómica. Dichos protocolos se consideran únicamente una guía. El Instituto de Medicina Genómica no le ofrece ninguna otra garantía, expresa o implícita, que se extienda más allá del funcionamiento correcto de los componentes de este set. La única obligación del Instituto de Medicina Genómica, respecto de las garantías precedentes, será la de reemplazar los productos, o bien devolver el precio de la compra de los mismos, a voluntad del cliente, siempre y cuando se pruebe la existencia de un defecto en los materiales, o bien en la elaboración de sus productos. El Instituto de Medicina Genómica no será responsable de ningún daño, directo o indirecto, que resulte en pérdidas económicas o en daños que pudieran producirse por el uso de este producto por parte del comprador o usuario. 13. Servicio de atención al cliente Para cualquier consulta sobre las aplicaciones de este producto o sobre sus protocolos, puede contactar con nuestro Departamento Técnico: Teléfono: Mail: Rev /12


TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles



Más detalles


PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles


CENTRO NACIONAL DE ALIMENTACIÓN CENTRO NACIONAL DE ALIMENTACIÓN Presencia de maíz MG en productos alimenticios de diversa procedencia Servicio de Biotecnología Josefina Gangoso Herreras Maíces MG autorizados UE 12 eventos individuales

Más detalles



Más detalles



Más detalles



Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles


SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL. Guía de interpretación de resultados SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL Guía de interpretación de resultados Sistemas de detección de patógenos por PCR a tiempo real Microbial ofrece sistemas para la detección de patógenos

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles


PROCEDIMIENTO DETECCION NOROVIRUS RT-qPCR EN EXTRACTO VIRAL PROVENIENTE DE MOLUSCOS BIVALVOS. PRT-712.07.01-097 Página 1 de 7 PRT-712.07.01-097 Página 1 de 7 1. OBJETIVO Realizar la detección molecular de genes de Norovirus en muestras de moluscos bivalvos. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a concentrados

Más detalles


EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1

Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 Protocolo del CDC para el RT-PCR en tiempo real para el nuevo subtipo del virus de influenza A(H1N1) 1 28 de abril de 2009 Revisión 1 (30 de abril e 2009) El Centro Colaborador para la Influenza de la

Más detalles



Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles


DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Abbott RealTime HIV-1

Abbott RealTime HIV-1 6L18 51-605130/R1 Abbott RealTime HIV-1 Nota: consulte las modificaciones marcadas es 6L18 51-605130/R1 Símbolos utilizados Fabricante referencia lote Producto sanitario para diagnóstico in vitro Control

Más detalles


PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. Technical Manual PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. IMPRESO EN ESTADOS UNIDOS PowerPlex Fusion System Toda la bibliografía técnica está disponible en Internet,

Más detalles

Ministerio del Ambiente 1

Ministerio del Ambiente 1 Módulo Didáctico: Recursos Genéticos y Bioseguridad BASES TÉCNICAS PARA LA SEGURIDAD DE BIOTECOLOGÍA Cajamarca, 19 21 junio de 2012 Blgo. David Castro Garro Especialista en Biotecnología Ministerio del

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles


ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles



Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles


SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. Technical Manual SwabSolution Kit INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC8271. IMPRESO EN ESTADOS UNIDOS Nro. de pieza: TMD037 SwabSolution Kit Toda la bibliografía técnica está disponible en Internet,

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Bacterióloga contratista

Bacterióloga contratista Elaborado por: Miguel Angel Diaz Osório Bacteriólogo M.Sc. Fecha: 2011/06/15 1. OBJETIVO PROCESO REDES EN SALUD PUBLICA Método de ensayo para la identificación de siete serotipos de Salmonella por PCR

Más detalles

Instrucciones de Uso GenDx SBTexcellerator

Instrucciones de Uso GenDx SBTexcellerator Octavo Edición Julio de 2011 Instrucciones de Uso GenDx SBTexcellerator Para Tipificación Basada en Secuenciación de HLA de alta resolución Genome Diagnostics B.V. Teléfono: +31 302 523 799 Correo electrónico:

Más detalles


Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles



Más detalles

Alimentación & Bebidas con Eppendorf

Alimentación & Bebidas con Eppendorf Alimentación & Bebidas con Eppendorf 27 de Noviembre, 2014 > Eppendorf Un resumen > Alimentos & Bebidas con Eppendorf > Importancia de los consumibles en el análisis alimentario > Ventajas de la automarización

Más detalles


INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles



Más detalles

Manual de uso del kit therascreen EGFR Plasma RGQ PCR

Manual de uso del kit therascreen EGFR Plasma RGQ PCR Diciembre de 2014 Manual de uso del kit therascreen EGFR Plasma RGQ PCR Versión 1 24 Para uso en diagnóstico in vitro Para uso con equipos Rotor-Gene Q MDx 870311 QIAGEN Manchester Ltd, Skelton House,

Más detalles


DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: EQUIPO AUTOMÁTICO PARA LA DETECCIÓN DE PATÓGENOS minividas-vidas DEFINICIÓN Y CARACTERÍSTICAS DE LA TÉCNICA: Sistema automático de inmunodetección rápida de patógenos basado en la técnica ELFA (Enzyme

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles


CENTRO NACIONAL DE ALIMENTACIÓN CENTRO NACIONAL DE ALIMENTACIÓN DETECCIÓN DE ALÉRGENOS EN ALIMENTOS Mª Isabel Prieto Santos Servicio de Biotecnología Jornada: Reglamento sobre Información Alimentaria al Consumidor: Compartir experiencias

Más detalles



Más detalles


1. OBJETO. 3.1. DOCUMENTOS UTILIZADOS EN LA ELABORACIÓN. 3.2. DOCUMENTOS (PNTs) A UTILIZAR CONJUNTAMENTE. 5.1. MATERIALES Y REACTIVOS. Página 1 de 5 CENTRO DE INVESTIGACION EN SANIDAD ANIMAL (CISA-INIA) Laboratorio de Referencia de la UE de PPA (EURL-ASF) Centro de Investigación en Sanidad Animal CISA-INIA, Valdeolmos 28130, Madrid, Spain.

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

La Biología Molecular Aplicada a la detección de patógenos en alimentos

La Biología Molecular Aplicada a la detección de patógenos en alimentos La Biología Molecular Aplicada a la detección de patógenos en alimentos La detección fiable y rápida de microorganismos patógenos en el mercado alimentario es de especial importancia no sólo por sus efectos

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

Grupo de trabajo sobre control e inspección de los medicamentos

Grupo de trabajo sobre control e inspección de los medicamentos COMISIÓN EUROPEA DIRECCIÓN GENERAL DE EMPRESA Productos farmacéuticos y cosméticos Bruselas, 31 de marzo de 2000 ENTR/III/5717/99-ES g\common\legal-legislation\75-319 nd81-851\91-356\eudralexvol4\blood\jan

Más detalles


DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles


AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles


APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios:

Cómo funciona la prueba de ELISA SYSTEMS de residuos de alergenos alimentarios: En muchos países, entre ellos Australia, Canadá, la Unión Europea, Corea, Japón, Nueva Zelanda, EEUU, existen leyes y sistemas de control para regular el etiquetado relativo a alergenos alimentarios. Las

Más detalles

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Tel. 91 710 00 74 Fax 93 843 78 84 e-mail: info@biotools.eu www.biotools.eu BIOPAP Kit Kit para la detección

Más detalles

PCR a tiempo real. Análisis de patógenos en alimentos. APPLUS+ Laboratorio de Genética 20.11.2007

PCR a tiempo real. Análisis de patógenos en alimentos. APPLUS+ Laboratorio de Genética 20.11.2007 PCR a tiempo real. Análisis de patógenos en alimentos APPLUS+ Laboratorio de Genética 20.11.2007 Índice 0_ Applus + 1_ Roche 2_ Real Time PCR 3_ LightCycler 480 4_ Detección de patógenos Applus+ 00 Applus+

Más detalles

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente

Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente Avances Tecnológicos en PCR para la Detección Rápida de Patógenos en Alimentos y Medio Ambiente M.Sc. Viviana Fino - DuPont N&H ACHIPIA 2015 8 de octubre de 2015 Santiago, Chile Necesidades de la Industria

Más detalles


PET-RPLA KIT para DETECCIÓN de TOXINAS. Código: TD0930 PET-RPLA KIT para DETECCIÓN de TOXINAS Código: TD0930 Kit para detección de enterotoxina tipo A de Clostridium perfringens en muestras fecales o en filtrados de cultivos por aglutinación pasiva de látex

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles



Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Guía de Normas de Correcta Fabricación de Medicamentos de Uso Humano y Veterinario. Capítulo 6. Control de Calidad

Guía de Normas de Correcta Fabricación de Medicamentos de Uso Humano y Veterinario. Capítulo 6. Control de Calidad DEPARTAMENTO DE INSPECCIÓN Y CONTROL DE MEDICAMENTOS Guía de Normas de Correcta Fabricación de Medicamentos de Uso Humano y Veterinario Capítulo 6 Control de Calidad Bases legales para la publicación de

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

CHECK LIST DE HIGIENE EXTERNO Registro nº: 1.1 Verificación del control del agua (ver resultado). X Comunidad Autónoma de Madrid

CHECK LIST DE HIGIENE EXTERNO Registro nº: 1.1 Verificación del control del agua (ver resultado). X Comunidad Autónoma de Madrid CHECK LIST DE HIGIENE ETERNO 1 - PREREQUISITOS O PLANES GENERALES DE HIGIENE 1.1 Verificación del control del agua (ver resultado). Comunidad Autónoma de Madrid 1.2 El centro está limpio. Se conoce y se

Más detalles

Buenas Prácticas De Fabricación Para Medicamentos. Food and Drug Administration 21 CFR Ch.1 Parts 210 & 211 (CGMP s)

Buenas Prácticas De Fabricación Para Medicamentos. Food and Drug Administration 21 CFR Ch.1 Parts 210 & 211 (CGMP s) Buenas Prácticas De Fabricación Para Medicamentos Food and Drug Administration 21 CFR Ch.1 Parts 210 & 211 (CGMP s) Alcance. Métodos, servicios y controles durante la fabricación, el tratamiento, el empaque

Más detalles



Más detalles


MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles


GUÍA DE FALLAS DE DETECTORES DE RADIACIÓN ENFRIADOS GUÍA DE FALLAS DE DETECTORES DE RADIACIÓN ENFRIADOS El diagnóstico de las fallas más comunes encontradas en es de radiación enfriados se puede realizar más fácilmente si se sigue la tabla siguiente en

Más detalles

Tecnología HaloPlex by Genycell Biotech España

Tecnología HaloPlex by Genycell Biotech España Paneles de genes custom-made Tecnología HaloPlex by Genycell Biotech España SERVICIO NGS CLÍNICA HALO: OVERVIEW 1. DISEÑO DEL PANEL DE GENES Y DEL KIT DE CAPTURA 2. PREPARACIÓN DE LA MUESTRA EN EL LABORATORIO

Más detalles



Más detalles


Sistema PowerPlex 18D System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC1802 Y DC1808. Technical Manual Sistema PowerPlex 18D System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC1802 Y DC1808. IMPRESO EN ESTADOS UNIDOS Sistema PowerPlex 18D System Toda la bibliografía técnica está disponible

Más detalles



Más detalles


ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Página 1 de 9 ELISA IgM PARA DIAGNOSTICO DE LEPTOSPIRA Elaborado por: CNSP Blgo. Manuel Céspedes Zambrano Revisado por: CNSP TM. Julia I. Espinoza Soto CNSP MV Gladys Malásquez Mendoza Aprobado por: RD

Más detalles



Más detalles

Guía de referencia del ensayo de secuenciación clínica de la fibrosis quística MiSeqDx

Guía de referencia del ensayo de secuenciación clínica de la fibrosis quística MiSeqDx Guía de referencia del ensayo de secuenciación clínica de la fibrosis quística MiSeqDx PARA USO DIAGNÓSTICO IN VITRO Introducción 3 Primeros pasos 7 Flujo de trabajo del ensayo 21 Preparación de la hoja

Más detalles


ALIMENTS MODIFICATS GENÈTICAMENT, ON SOM? ALIMENTS MODIFICATS GENÈTICAMENT, ON SOM? Teresa Esteve Nuez Servei d Anàlisis Biològiques Quantitatives (SABQ) Institut de Biología Molecular de Barcelona S.A.B.Q. IBMB-CSIC CONTENIDOS SEMINARIO S.A.B.Q.

Más detalles

foodproof RoboPrep + Series Automatización completa de la extracción de ADN y preparación de la PCR

foodproof RoboPrep + Series Automatización completa de la extracción de ADN y preparación de la PCR foodproof RoboPrep + Series Automatización completa de la extracción de ADN y preparación de la PCR TISELAB: QUIÉNES SOMOS Tiselab es una empresa proveedora de industria farmacéutica y alimentaria. Tenemos

Más detalles

Prueba ABtest. Para la cuantificación del pool beta-amiloide en sangre TOTAL

Prueba ABtest. Para la cuantificación del pool beta-amiloide en sangre TOTAL Prueba Para la cuantificación del pool beta-amiloide en sangre TOTAL Introducción Es esencial un diagnóstico temprano. En la práctica clínica actual el diagnóstico de la enfermedad de Alzheimer se realiza

Más detalles


CLASIFICACIÓN Y GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS CLASIFICACIÓN Y GESTIÓN DE RESIDUOS TÓXICOS Y PELIGROSOS La clasificación y gestión de los residuos tóxicos y peligrosos generados en CABIMER se realiza de acuerdo con la normativa vigente (Ley 10/1998,

Más detalles


2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

es Abbott HBV Sequencing Abbott HBV Sequencing 49-8679/R01 B3N033 3N03-90 Símbolos utilizados NOMBRE Abbott HBV Sequencing

es Abbott HBV Sequencing Abbott HBV Sequencing 49-8679/R01 B3N033 3N03-90 Símbolos utilizados NOMBRE Abbott HBV Sequencing Abbott HBV Sequencing Símbolos utilizados Fabricante Número de referencia Número de lote Producto sanitario para diagnóstico in vitro ATENCIÓN: maneje los materiales de origen humano como potencialmente

Más detalles

Cultivo in vitro Plantas. Servicio de cultivo de plantas

Cultivo in vitro Plantas. Servicio de cultivo de plantas 1 Servicio de cultivo de plantas 1 2 I. Información general del Servicio de Cultivo de Plantas. Aplicaciones Las técnicas de cultivo in vitro de tejidos vegetales proporcionan los medios para producir

Más detalles


DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

RapidFinder STEC Detection Workflow

RapidFinder STEC Detection Workflow QUICK REFERENCE RapidFinder STEC Detection Workflow Aislamiento automático de ADN y detección de la PCR en tiempo real de E. coli O157:H7 y cepas "Big 6" de STEC no O157 Número de catálogo 4480466, 4428176,

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles


NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA Este laboratorio será acreditado en conjunto con el Laboratorio de Embriología cuando aquel funciones dentro del Centro. Cuando el laboratorio

Más detalles



Más detalles



Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles


EUROTUBO DELTALAB 4. PLACAS Y ASAS 81 82 Placa Petri 90 x 14 mm Fabricadas en poliestireno. Con tres vientos. Presentadas en bolsas cerradas por calor de 20 unidades. Código 200200 aséptico. Código 200209 estéril por radiación. Aptas para

Más detalles


5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Capítulo 3: Locales y equipos Capítulo 5: Operaciones

Capítulo 3: Locales y equipos Capítulo 5: Operaciones Capítulo 3: Locales y equipos Capítulo 5: Operaciones Jornada Informativa sobre las nuevas Buenas Practicas de Distribución Madrid 18-06-2013 Ana Viñuales Loriente Departamento de Salud Gobierno de Navarra

Más detalles