Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012"

Transcripción

1 Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012 NOMBRE DE LA INVESTIGACIÓN ANÁLISIS DE DIVERSIDAD GENÉTICA DE UNA COLECCIÓN DE AGUAJE DE Mauritia flexuosa (Aracaceae: Lepidocaryeae) MEDIANTE MARCADORES MICROSATELITES Olivera, J. E. 1, M.S. Gonzales 1. K. Mejía 2,JC, Pintaud 3, R. Ramirez Lab. Genética Molecular. Centro de Investigación de Bioquímica y Nutrición Alberto Guzmán Barrón. Facultad de Medicina San Fernando. UNMSM. 2. Instituto de Investigaciones de la Amazonía Peruana. 3. Institud de recherche pour dévelopment. 4. Lab. Filografia y Sistematica, Facultad Ciencias Biológicas. UNMSM

2 FAMILIA: Arecaceae SUBFAMILIA:Calamoideae TRIBU: Lepidocaryeae SUBTRIBU: Mauritiinae GENEROS: Lepidocaryum, Mauritia, Mauritiella Lepidocaryum tenue Mauritia carana Mauritia flexuosa Mauritiella acuelata Mauritiella armata Mauritiella macroclada Fuente: Fuente: Fuente: J Olivera Fuente: Fuente: Fuente: ional.org

3 DISTRIBUCION Fuente: Mauritia flexuosa Bolivia, Brasil (Norte, noreste, sureste y oeste-central ), Colombia, Ecuador, Guyana Francesa, Guyana, Surinam, Trinidad-Tobago, Venezuela, Perú.

4 Autores: Dennis del Castillo Torres, Erasmo Otárola Acevedo, Luis Freitas Alvarado. Año publicación 2006 Autor(es): Ernesto Gonzales Davila Año de Publicación: 2009

5

6 OBJETIVO GENERAL valuar la diversidad genética de 20 individuos de Mauritia flexuosa (10 hembras y 10 machos de la colección del banco de germoplasma Alpahuayo-IIAP) mediante la selección de 6 pares de cebadores microsatélite. MATERIALES, METODOS Y RESULTADOS Se enviaron de Iquitos a Lima, hojas verdes de 20 muestras de aguaje, en frascos de centrifuga de 50 ml,. con deshumedecedor comercial ( bola seca ). Las hojas fueron trituradas en mortero con nitrógeno liquido, y el polvo guardado en tubos de 1.5 ml en congelación. Luego se procedió a la extracción de ADN total por el método CTAB (Doyle & Doyle, 1990). Las hojas fueron trituradas en mortero con nitrógeno liquido, y el polvo guardado en tubos de 1.5 ml en congelación. Luego se procedió a la extracción de ADN total por el método CTAB (Doyle & Doyle, 1990). Se realizaron corridas en agarosa al 1% con SYBR Safe DNA Gel Stain para ver la calidad del ADN; y el material se cuantifico en un en un espectrofotómetro NanoDrop. El PCR (reacción en cadena de la polimersa se ejecuto siguiendo las recomendaciones del articulo de Ferderman y col, 2012)

7 Deshumedecedor usado para traer las hojas de aguaje, de Iquitos a Lima. Corrida de ADN en un gel de agarosa por electroforesis horizontal Pocillos: Calidad del ADN extraído, por el método CTAB Pocillos:

8 Códi go Tm N Alelo s Tamaño pb Secuencia repetitiva Iniciador izquierdo Iniciador derecho Mf13 57 C (CT)14 TTACAAGCGACCCCTCGTC CGTCGAATAGGGTTTCAGTGG Mf17 54 C (GA)18 GACAGCTTGTCATCCTCGC TTCCATCCCAGTTCTCCCC Mf19 57 C (CT)10 AGCCACGTGACACTCTACC CTATAGGACCGGCCACCTG Mf28 57 C (GA)9(GC)( TCCCACACTCTCTTGCCAC TGAGGGCTGCGTTATGGTC GA)11 Mf30 57 C (CT)14 GAGGGGAGCTTCCTTGCTG ATTGGCGAAGGTCCAGGG Mf33 57 C (CT)10 TGCCGCATTTAGGCTTTGG GGCCGGCGATTTATAACGG Fuente: Ferdeman, S., Ch. Hyseni, W. Clement, A. Caccone. Conserv. Genet. Res (2) INGREDIENTES DEL PCR Ingredientes Concentración final Agua - Buffer 1X dntp 0.2 mm Foward 0.2 um Reverse 0.2 um MgCl2 1.5 mm Taq polimerasa 0.5 U/ul ADN ng

9 Carril: Carril: mf13 RANGO PESO MOLECULAR: pb)

10 Carril: MW mf30 RANGO PESO MOLECULAR: pb) 150 MW mf33 RANGO PESO MOLECULAR: pb)

11 Numero de alelos detectados por locus microsatélite Marcador N Alelos Referencia Mf Mf Mf Mf Total Promedio 3.33 DS 2

12 Índices de diversidad para cada locus de microsatélite Locus PIC Ho Hs Fst Fis Fit Mf Mf Mf Mf Promedio DS

13

14 CONCLUSIONES 1. Se han evaluado 4 marcadores micro satélite de seis escogidos, del articulo de Federman y col (2012). 2. Se observa una variación alelica de 3.3 alelos por locus, bajo a lo esperado en el articulo de Federman para los 4 alelos evaluados (4.83). 3. Hay una alta heterocigocidad en los individuos evaluados (4.33 en promedio), 4. Sin embargo, se pueden diferenciar dos grupos muy similares entre si, con poca distancia genética entre ellos. 5. Esto ultimo se corrobora con bajo valor Fst (0.015) indicando poca diferenciación genética entre individuos. 6. Existe poca endogamia (Fit=0.086).

15 ESTE TRABAJO ES PARTE DE UN ESTUDIO DOCTORAL DE LA SUBTRIBU MAURITIINAE, Y ESTA EN EL MARCO DEL PROYECTO PALMS (www.fp7- palms.org) AGRADECIMIENTOS Dra. BETTY MILLAN, Líder del Proyecto PALMS en el Perú MUCHAS GRACIAS POR SU ATENCION

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares MSc. Juan Agapito Panta Laboratorio de Genómica y Biología Molecular Instituto Peruano de Energía Nuclear

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

MANUAL DE PRÁCTICAS !!! Heber!Torres! !!!!!!!!!!!!!!!!!!!!!!!!!!!

MANUAL DE PRÁCTICAS !!! Heber!Torres! !!!!!!!!!!!!!!!!!!!!!!!!!!! MANUAL DE PRÁCTICAS igem-cideb_uanl HeberTorres Índice de Contenidos Presentación... 1 Reglas Generales y Recomendaciones... 3 Prácticas de Laboratorio de Biología Sintética para igem-cideb_uanl... 5

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD. Molecular

COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD. Molecular COMPLEJO MAYOR DE HISTOCOMPATIBILIDAD Dra.. Flora Calzadilla Lugo Laboratorio de Genética Molecular POLIMORFISMO GENETICO Presencia en una población de múltiples un gen y que debe estar presente en el

Más detalles

ANEXO CUADRO COMPARATIVO

ANEXO CUADRO COMPARATIVO DNI64 /9/ :: Nombre del Organismo Contratante PROCEDIMIENTO DEL SELECCION ADM. NAC. DE LAB. E INST. DE SALUD DR. MALBRÁN Tipo: CONTRATACION DIRECTA Número: 4 Ejercicio: Clase: Modalidad: SIN CLASE SIN

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Comprobando la calidad del DNA genómico mediante electroforesis en gel

Comprobando la calidad del DNA genómico mediante electroforesis en gel Comprobando la calidad del DNA genómico mediante electroforesis en gel GELES 1 Y 2 Agarosa 0.8 %, electroforesis a 1 V/cm Muestras: Se ha cargado muestras de DNA genómico no digerido, antes (líneas impares)

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006

IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006 IV Curso Avanzado WHO GSS 2006 Buenos Aires 15 al 24 de mayo de 2006 REACCION EN CADENA DE LA POLIMERASA (PCR) EN EL DIAGNOSTICO DE Campylobacter jejuni/coli Viernes 19 de mayo María Rosa Viñas Servicio

Más detalles

INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD

INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD T. 976 22 11 33 WWW.BIOSALUD.ORG RESIDENCIAL PARAÍSO, 9 50006 ZARAGOZA -SPAIN- INFORME DE RESULTADOS-PRUEBA DE PATERNIDAD Han sido remitidas al Centro de Análisis

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

Marcadores moleculares (MM)

Marcadores moleculares (MM) Marcadores moleculares (MM) Un marcador genético o marcador molecular es un segmento de ADN situado en un lugar específico del genoma (locus) y cuya herencia genética se puede rastrear. Puede ser un gen

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

CURSO ACADÉMICO 2012-2013

CURSO ACADÉMICO 2012-2013 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2012-2013 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, ecología y Genética Área de conocimiento: Genética Ciclo:2º Curso: 4º Tipo:

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

DIRECCIÓN GENERAL DE SANIDAD VEGETAL CENTRO NACIONAL DE REFERENCIA FITOSANITARIA SUBDIRECCIÓN DE DIAGNÓSTICO

DIRECCIÓN GENERAL DE SANIDAD VEGETAL CENTRO NACIONAL DE REFERENCIA FITOSANITARIA SUBDIRECCIÓN DE DIAGNÓSTICO DIRECCIÓN GENERAL DE SANIDAD VEGETAL CENTRO NACIONAL DE REFERENCIA FITOSANITARIA SUBDIRECCIÓN DE DIAGNÓSTICO PROTOCOLO DE DIAGNÓSTICO Pepper mild mottle virus 04/Noviembre/ 2015 TEMARIO 1 Infección por.

Más detalles

TESINA PARA OPTAR POR EL GRADO DE LICENCIADO EN CIENCIAS BIOLÓGICAS

TESINA PARA OPTAR POR EL GRADO DE LICENCIADO EN CIENCIAS BIOLÓGICAS TESINA PARA OPTAR POR EL GRADO DE LICENCIADO EN CIENCIAS BIOLÓGICAS Evaluación de la distribución en una población uruguaya de los polimorfismos MTHFR C677T, RFC G80A y el número de repetidos en tándem

Más detalles

Avances tecnológicos hacia la trazabilidad de la madera

Avances tecnológicos hacia la trazabilidad de la madera Avances tecnológicos hacia la trazabilidad de la madera Rolando Navarro Gómez Presidente Ejecutivo (e) OSINFOR Leticia, noviembre 2014 Usemos responsablemente nuestros bosques Intervención del OSINFOR

Más detalles

OBTENCIÓN DE MUTANTES

OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

CAPÍTULO 3: ANÁLISIS DE MARCADORES MICROSATÉLITES SELECCIÓN DE MARCADORES

CAPÍTULO 3: ANÁLISIS DE MARCADORES MICROSATÉLITES SELECCIÓN DE MARCADORES CAPÍTULO 3: ANÁLISIS DE MARCADORES MICROSATÉLITES SELECCIÓN DE MARCADORES Todo nuestro trabajo basado en el análisis de microsatélites se realizó con un panel de 8 de los 29 microsatélites descritos en

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Instituto de Innovación en Biotecnología e Industria

Instituto de Innovación en Biotecnología e Industria Instituto de Innovación en Biotecnología e Industria Centro de Biotecnología Vegetal (CEBIVE) Marcadores moleculares para caracterizar cultivares de aguacates criollos (Persea americana) del tipo antillano,

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD PROGRAMA

PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD PROGRAMA PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD Curso: 25 Hrs. Asistentes: 25 Costo: $15,000 (Quince Mil Pesos 00/100 M.N) OBJETIVO: Conocer algunos conceptos básicos

Más detalles

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez

Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez Detección de la secuencia Alu mediante la técnica Reacción en Cadena de la Polimerasa (PCR ) N. Rodríguez 1 Objetivos Entender la técnica: Reacción de Polimerasa en Cadena (PCR por sus siglas en inglés)

Más detalles

UNIÓN INTERNACIONAL PARA LA PROTECCIÓN DE LAS OBTENCIONES VEGETALES

UNIÓN INTERNACIONAL PARA LA PROTECCIÓN DE LAS OBTENCIONES VEGETALES S Directrices del BMT (proj.5) ORIGINAL: Inglés FECHA: 25 de febrero de 2006 UNIÓN INTERNACIONAL PARA LA PROTECCIÓN DE LAS OBTENCIONES VEGETALES GINEBRA PROYECTO DIRECTRICES PARA LOS PERFILES DE ADN: SELECCIÓN

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Instrucciones de Uso GenDx SBTexcellerator

Instrucciones de Uso GenDx SBTexcellerator Octavo Edición Julio de 2011 Instrucciones de Uso GenDx SBTexcellerator Para Tipificación Basada en Secuenciación de HLA de alta resolución Genome Diagnostics B.V. Teléfono: +31 302 523 799 Correo electrónico:

Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

UNIVERSIDAD DE LA REPÚBLICA FACULTAD DE VETERINARIA PROGRAMA DEL CURSO PLAN 1998

UNIVERSIDAD DE LA REPÚBLICA FACULTAD DE VETERINARIA PROGRAMA DEL CURSO PLAN 1998 UNIVERSIDAD DE LA REPÚBLICA FACULTAD DE VETERINARIA PROGRAMA DEL CURSO PLAN 1998 NOMBRE DEL CURSO: GENÉTICA GENERAL CÓDIGO: 98107 INSTITUTO: Producción Animal DEPARTAMENTO: Genética y Mejora Animal ÁREA:

Más detalles

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR.

3/22/2010. Iván Ferrer Rodríguez, PhD Catedrático. En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Iván Ferrer Rodríguez, PhD Catedrático En el 1983, Kary Mullis dio a conocer la Técnica de reacción en cadena de la Polimerasa o PCR. Síntesis "in vitro" de secuencias específicas de ADN son amplificadas.

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA

UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO FACULTAD DE MEDICINA VETERINARIA Y ZOOTECNIA. Estudio comparativo del diagnóstico del virus del PRRS por RT-PCR, PCR anidada y RT-PCR en tiempo real. Zoalli Angélica

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

FORMATO 1. ASIGNATURA

FORMATO 1. ASIGNATURA FORMATO 1. ASIGNATURA Nombre de la asignatura: MCBA-0707-ITEL Técnicas Biotecnológicas de Diagnóstico Línea de investigación o trabajo: Biotecnología en Ciencia Animal - Horas prácticas - Horas trabajo

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Reacción en cadena de la Polimerasa (PCR)

Reacción en cadena de la Polimerasa (PCR) Explicación de TP Nº 2 Reacción en cadena de la Polimerasa (PCR) Química Biológica Patológica Dra. Mariana L. Ferramola Dra. Gabriela Lacoste 2015 Definición de PCR Es la amplificación enzimática de un

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

FACULTAD REGIONAL ROSARIO

FACULTAD REGIONAL ROSARIO FACULTAD REGIONAL ROSARIO CATEDRA BIOTECNOLOGIA ROFESOR: Ing. Eduardo Santambrosio JTP: Ing. Marta Ortega AUX 1ª : Ing. Pablo Garibaldi PCR (Polymerase chain reaction) Reacción en cadena de la polimerasa

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Detección Mediante PCR de Fusarium oxysporum f. sp. lycopersici raza 3 en el Cultivo de Tomate en República Dominicana.

Detección Mediante PCR de Fusarium oxysporum f. sp. lycopersici raza 3 en el Cultivo de Tomate en República Dominicana. Detección Mediante PCR de Fusarium oxysporum f. sp. lycopersici raza 3 en el Cultivo de Tomate en República Dominicana. Rosa María Méndez Bautista, M.Sc * Juan.T. Camejo MSc. y Deisy Pérez PhD. * Fitopatóloga

Más detalles

UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU

UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU UNIDAD DE SECUENCIACIÓN HOSPITAL UNIVERSITARIO SANT JOAN DE DEU La Unidad de secuenciación del Hospital Universitario Sant Joan de Déu, es una unidad de reciente creación que nace con el objetivo de prestar

Más detalles

Obtención de ADN de cactáceas: comparación de dos métodos de extracción en Ferocactus histrix

Obtención de ADN de cactáceas: comparación de dos métodos de extracción en Ferocactus histrix Obtención de ADN de cactáceas: comparación de dos métodos de extracción en Ferocactus histrix Brenda Díaz Cárdenas 1, Liliana Gómez Flores Ramos 1, Verónica Carolina Rosas-Espinoza 2, Laura Izascum Pérez

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

MEMORIA DE PRÁCTICAS

MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

DESARROLLO DE UN BANCO DE ADN DEL GENERO NICOTIANA

DESARROLLO DE UN BANCO DE ADN DEL GENERO NICOTIANA DESARROLLO DE UN BANCO DE ADN DEL GENERO NICOTIANA Yosvanis Acanda Artigas, Humberto García Cruz, Anabel Díaz Ramos Javier Jiménez Rico Instituto de Investigaciones del Tabaco. Carretera Tumbadero, km

Más detalles

11.1- Descripción breve de los laboratorios especializados del Posgrado en Ciencias (Ciencias Biológicas).

11.1- Descripción breve de los laboratorios especializados del Posgrado en Ciencias (Ciencias Biológicas). 11.1- Descripción breve de los laboratorios especializados del Posgrado en Ciencias (Ciencias Biológicas). UNIDAD DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR DE PLANTAS ESPACIOS Y EQUIPOS COMUNES La Unidad de Bioquímica

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

Mejoramiento del diagnóstico molecular de la distrofia miotónica tipo 1 mediante el estudio del mosaicismo somático

Mejoramiento del diagnóstico molecular de la distrofia miotónica tipo 1 mediante el estudio del mosaicismo somático Mejoramiento del diagnóstico molecular de la distrofia miotónica tipo 1 mediante el estudio del mosaicismo somático Investigadora principal desde julio 2007 hasta marzo del 2009 Patricia Eugenia Cuenca

Más detalles

ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR

ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR ESTUDIO DE POLIMORFISMOS ALU HUMANOS POR PCR Ref. PCRALU 1. OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena

Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares.

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. INTRODUCCIÓN La determinación morfológica y morfométrica de nematodos fitopatógenos en los laboratorios

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

Aprobados por el Consejo Interno el 9 de marzo de 2010

Aprobados por el Consejo Interno el 9 de marzo de 2010 Lineamientos para el uso del Laboratorio de Código de Barras de ADN (Sistemática Molecular 1) en el Departamento de Zoología, Instituto de Biología de la UNAM Aprobados por el Consejo Interno el 9 de marzo

Más detalles

Tema 12. Estructura genética de las poblaciones. Genética CC.MM.

Tema 12. Estructura genética de las poblaciones. Genética CC.MM. Tema 12. Estructura genética de las poblaciones Genética CC.MM. Contenidos Estructura genética de las poblaciones Cuantificación de la variabilidad genética en las poblaciones Equilibrio Hardy-Weinberg

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles