Tamaño: px
Comenzar la demostración a partir de la página:



1 BASES DE DATOS DE INTERÉS EN BIOQUÍMICA Las técnicas de alto rendimiento desarrolladas en las últimas décadas han permitido la adquisición masiva de información de biología molecular que se depositan en bases de datos de crecimiento exponencial, la bioinformática se ocupa de su gestión, análisis e interpretación de los datos experimentales. Las principales bases de datos son: 1. NCBI (National Center for Biotechnology Information) ( 2. Ensembl (The Wellcome Trust Sanger Institute y European Bioinformatics Institute) ( Antes de entrar a explicar todas las aplicaciones y opciones de búsqueda que podemos encontrar en la página del NCBI es interesante mencionar que se pueden consultar los tutoriales que están disponibles en la propia página web. Para acceder a ellos basta con pinchar en el enlace EDUCATION:


3 TTTTGTGATTCCAATTCTTTGTAATTGTCTTCAGAGCAGCCCTACTAGCACATACCGCGTGGTGTTTGTA TTTCTGTGAACACACAGCCAGTCCGTTTCTAGGCTTTGTTTCTCTGTGTGCTTAGTTTTAAAGACAACTT TGAAGTAAACAATGAAATAAAAGATGTCACTAAAACCTCTGA No tenemos ni idea de que se trata, ni siquiera sabemos si se trata de un fragmento de secuencia génomica, o si es un mensajero, y si es un mensajero no sabemos si está completo o sólo hemos obtenido una secuencia parcial. Cómo podemos obtener información acerca del origen de esta secuencia? En una primera aproximación podríamos hacer un BLASTn, este programa compara la secuencia que nosotros le introducimos con todas las secuencias que hay depositadas en la base de datos. Desde la página principal del NCBI pincharíamos en BLAST: Aparecerá la siguiente ventana, donde deberemos pinchar en nucleotide blast: Tras pinchar en el enlace podremos pegar nuestra secuencia en la ventana correspondiente:

4 Generalmente cuando trabajas en el laboratorio se suele tener claro la especie de la que procede la secuencia, pero supongamos por un momento que desconocemos por completo el origen de la secuencia. En ese caso debemos hacer un BLASTn contra Nucleotide Collection (nr/nt), pinchando en la ventana desplegable indicada con la fecha, porque se trata de la colección de todas las secuencias depositadas en la base de datos, de todas las especies y de todos los tipos. Entonces le damos al botón BLAST que hay en la parte inferior y esperamos hasta que aparezca la ventana de resultamos. Obtendremos un diagrama de resultados como el siguiente:

5 Este diagrama tiene un código de colores según la similitud entre la secuencia que nosotros hemos introducido en BLAST y las secuencias que ha encontrado. La primera barra roja que se nos muestra presenta un 100% de identidad con la secuencia que hemos introducido en toda su longitud. Si descendemos en la página podemos ver la siguiente representación: En esta segunda representación obtenemos algo más de información que en la primera. Nos da los mismos resultados con una pequeña descripción de las secuencias que ha encontrado el programa. Además, nos da algunos datos como: 1. Query coverage: es el porcentaje de la longitud de la secuencia que hemos introducido que ha conseguido encontrar en la base de datos. 2. Max. Ident.: se trara del porcentaje de identidad que posee la secuencia que hemos introducido y la secuencia de la base de datos, dentro de la longitud que ha encontrado. 3. E value: es un dato estadístico que representa cuanto se parecen nuestra secuencia con la que ha encontrado el software. Cuando más se acerque a cero más se parecerán ambas secuencias.

6 Pongamos un ejemplo para entender esto mejor: El primer resultado que nos muestra el programa posee un query coverage del 100%, que quiere decir que ha conseguido encontrar una secuencia en la base de datos de la misma longitud que la nuestra, 2142 pb, con la que comparar. Por otro lado, el valor de max. Ident. es también del 100%, lo que significa que en esas 2142 pb son idénticas a las de la secuencia que hemos introducido. Por tanto, el E value es 0, es decir, son totalmente idénticas. Sin embargo, en el segundo resultado el query coverage es sólo del 98%, esto quiere decir que el programa ha encontrado una secuencia de 2100 pb que se parece a una parte de nuestra secuencia, y como el valor de max. Ident. es del 100%, esas 2100 pb son idénticas a las de la secuencia problema. El E value en este caso también es 0, pero se refiere únicamente a las 2100 pb que son iguales. Volviendo al caso práctico, si pinchamos en la primera barra roja, del diagrama anterior, podremos ver lo siguiente: Aquí podemos conocer más detalles de la secuencia que ha encontrado el programa. Por un lado nos dice que es la secuencia que ha encontrado; en este caso Homo sapiens CUG triplet repeat, RNA binding protein 1(CUGBP1), que es el transcript variant 1 y que por lo tanto es un mrna (mensajero). Debajo, nos da la información del gen al que pertenece dicho mensajero. Después aparece nuevamente la información de cuán bueno ha sido el alineamiento entre las secuencias. Y, por último, aparece el alineamiento entre la secuencia que hemos introducido (query) y la que ha encontrado (Sbjct). Llegado este punto podemos asegurar que la secuencia que hemos obtenido es el mensajero que codifica la variante 1 del gen CUGBP. Si queremos conocer más información acerca del mrna o del mensajero podríamos pinchar en los link que aparecen arriba recuadrados. Si pinchamos en el primero aparecerá una página con información del mensajero:

7 En la parte superior aparece información del mrna: su tamaño, su nombre, el número de acceso, la especie a la que pertenece, etc. Un poco más abajo aparecen referencias bibliográficas en las que se habla del gen en cuestión. Si descendemos en la página aparece lo siguiente: Aparece aquí información del gen al que pertenece, si pinchamos sobre gene, se nos muestra una página similar a la que estamos viendo pero con información del gen (lo veremos un poco más tarde). En el recuadro rojo aparece resaltado la información que nos da la base de datos acerca de la posición de los exones en el mensajero. En el recuadro verde vemos la CDS (CoDing Sequence).

8 Si por el contrario hubiéramos pinchamos en BLAST el link del gen obtendríamos una página como la que sigue: En esta página podemos acceder a toda la información relacionada con este gen. Por un lado, podemos ver otros nombres de este gen (fecha roja), una breve descripción de la función del gen (fecha roja), las secuencias génica (de mrnas y de proteína derivadas de este gen) y su localización cromosómica (recuadros verdes), bibliografía relacionada y una serie de enlaces a otras páginas de interés (recuadros rojos). De los enlaces de interés vamos a consultar los siguientes: 1. Homologene: donde podremos consultar si existen homólogos de este gen en otras especies. 2. OMIN: aquí podremos conocer si el gen en cuestión ha sido relacionado con alguna enfermedad. 3. Pubmed: para búsquedas bibliográficas. 4. Ensembl: otra base de datos de la que luego hablaremos. 5. HGNC o HUGO: página internacional de nomenclatura de los genes.

9 Como podéis ver aparecen muchos otros enlaces, os animamos a que pinchéis sobre ellos para bucear por todas las páginas en las que podéis encontrar muchísima información de cualquier gen que os interese y desde muchos puntos de vista. Una vez que conocemos el gen al que pertenece la secuencia problema, CUGBP, podemos ir a la página de inicio del NCBI y escribir directamente en la barra de búsqueda el nombre de nuestro gen, y pinchamos en GO : En la ventana desplegable Search ponemos All Databases, todas las bases de datos, aunque si estamos buscando algo en particular podemos seleccionar en la ventana aquello que nos interese: Pubmed, protein, nucleotide, structure, etc.

10 En esta página se resume toda la información que contiene NCBI acerca del gen que le hemos introducido. Si pinchamos en los distintos apartados podremos acceder a ellos. Si pinchamos en Gene podremos acceder a la página anterior que obtuvimos tras hacer el BLASTn.

11 Ahora vamos a buscar información sobre nuestro gen en otra base de datos: Ensembl. Podemos acceder pinchando en el link que aparece en la página del NCBI o bien podemos ir a la página de inicio de Ensembl y poner en el buscador el nombre nuestro gen: Podemos seleccionar una especie en concreto o simplemente buscar en todas las especies:

12 Nos ha encontrado una entrada en Humano. Pinchamos: En esta página obtenemos de un vistazo gran información sobre el gen de interés. Por un lado nos da su localización cromosómica, una breve descripción de la función e información acerca de los mensajeros, proteínas que deriban del gen y un diagrama de la estructura de los mensajeros. Para ver de manera gráfica los exones e intrones de este gen podemos pinchar en sequence (Fecha naranja): Nos aparece la secuencia completa con los exones resaltados y los intrones sin subrayar.

13 Volviendo al planteamiento inicial: supongamos que después de haber hecho todas las búsquedas de información con la secuencia de nucleótidos que obtuvimos de nuestros experimentos no hemos conseguido ningún resultado. Qué podríamos hacer? En primer lugar deberíamos tratar de traducir la secuencia de nucleótidos a proteína (secuencia de animoácidos). Para ello utilizaremos el ORF Finder, una aplicación que está disponible en la página de inicio del NCBI, en los links de la parte derecha: Pinchamos en el enlace y copiamos en la ventana que aparece nuestra secuencia de nucleótidos (también podríamos poner el número de acceso de la secuencia si estuviera registrada):

14 Pinchamos en ORFind y esperamos a los resultados: El software nos devuélvela la información de todos los posibles ORF (Open Reading Frames, o marcos de lectura) que podría tener la secuencia de nucleótidos. En este caso el codón de inicio (ATG) está presente en la secuencia que poseemos, aunque eso no siempre es así, y quizás el marco de lectura podría ser uno que empezase en un punto anterior en la secuencia, que no poseyéramos. En cualquier caso, existen proteínas pequeñas, pero por lo general suelen tener más de animoácidos (AA). En nuestro caso parece lógico que la ORF correcta es la más larga que aparece. Si pinchamos sobre ella:

15 Aparece en la parte inferior la traducción que ha hecho el programa en el marco +3. En la parte superior podemos ver que ha aparecido un enlace para poder realizar un BLAST, en este caso BLASTp, porque estamos trabajando con secuencia de proteína. Si le damos al botón BLAST, y luego a view report, obtenemos lo siguiente:

16 Mientras carga el programa ha reconocido en la secuencia de AA que existen ciertos fragmentos cuya secuencia recuerda a que secuencia que tienen los dominios RRM (dominio estructural de unión a RNA, luego hablaremos de estructura de proteínas). Tras la carga del programas obtenemos el siguiente diagrama: Se trata de un diagrama con las mismas características que el diagrama que obtuvimos al hacer el BLASTn, pero en este caso todo está referido a la secuencia de AA. Si descendemos en la página vemos el siguiente esquema: Donde podemos ver una pequeña descripción de las secuencias de AA que ha encontrado en la base de datos. Más abajo:

17 En este último punto se nos muestra el alineamiento de la secuencia de AA que nosotros hemos introducido (a través del ORF Finder) y la secuencia que ha encontrado en la base de datos. En el recuadro rojo, podemos ver los datos del alineamiento: 1. Identities: hace referencia al porcentaje de secuencia idéntica. 2. Positives: se refiere a las propiedades físico-químicas de los AA. Puede ocurrir que los AA no sean idénticos, pero de propiedades físico-químicas similares con lo cual ejercería un papel similar en la función y/o estructura de la proteína. 3. Gaps: son huecos en la secuencias, es decir, dentro de una región en la que la secuencia que hemos introducido es similar a la encontrada por base de datos, pero en esta última existe algún AA de más o de menos. En rojo, aparece resaltado un signo +, que quiere decir que pese a que lo AA comparados no son el mismo, si que poseen propiedades físico-químicas similares. En verde podemos ver un Gap en el alineamiento, a nuestra secuencia le faltan tres AA con respecto a la encontrada por el software. Si pinchamos el GENE ID iremos a la página del gen que ya consultamos anteriormente han hacer nuestra búsqueda por secuencia de nucleótidos. Sin embargo, si pinchamos en el enlace señalado por la fecha roja pasaremos a una página de información de la proteína en cuestión.

18 En esta ventana podemos conseguir información del número de AA que componen nuestra proteína, de la especie a la que pertenece, de referencias bibliográficas, de dominios estructurales (recuadro rojo) y la secuencia. Ahora ya sabemos muchas cosas acerca de la secuencia que hemos obtenido. Supongamos ahora que yo quiero hacer un estudio a nivel de proteína, porque estamos interesados en hacer un estudio funcional de ciertos mutantes, es decir, queremos conocer cómo ciertos cambios que pueden ocurrir en la secuencia de nucleótidos afectan a la estructura tridimensional de la proteína, puesto que esas mutaciones provocan un cambio de AA. Pues bien, lo primero que deberíamos hacer es conocer la estructura tridimensional de la proteína normal. Para ello vamos al NCBI escribimos CUGBP1 en la barra de búsqueda y pinchamos GO :

19 Ahora pinchamos en 3D Domains: Debido a la complejidad de algunas proteínas, y también de las técnicas para la obtención de estructuras de proteínas, no siempre encontraremos la estructura completa de nuestra proteína, sino que conseguiremos fragmentos o dominios estructurales por separado. Si tenemos suerte, quizás se conozca la estructura de todos los dominios, aunque quizás nos encontremos con que sólo hay algunos. O peor, quizás no se conozca nada. En nuestro caso están todos los dominios caracterizados. Si pinchamos sobre el primero pasamos a otra página con información de la publicación de la obtención de la estructura y un diagrama con los dominios que componen nuestra proteína.

20 Si pinchamos sobre el dominio que estamos consultando: En esta nueva ventana podemos ver un alineamiento de la secuencia que compone el dominio de nuestra proteína con las secuencias de otras proteínas que presentan la misma estructura, y por lo tanto suelen presentar funciones similares.

21 Por último, si pinchamos en structure y luego a structure view, y si disponemos del programa Cn3D (disponible gratis en la página del NCBI podemos ver la estructura en un programa de simulación. Para aprender el manejo del programa podéis consultar el tutorial disponible en la siguiente dirección Por último, podríamos acudir a la base de datos del PDB (Protein Data Bank Escribir el nombre de nuestra proteína y buscar si existe alguna estructura relacionada. Obtenemos dos resultados:

22 Pinchamos en la primera: En esta página podemos obtener información de la estructura y de cómo ha sido obtenida experimentalmente. Además nos dan el enlace a la referencia de la publicación de la estructura.


BASES DE DATOS DE INTERÉS EN BIOQUÍMICA BASES DE DATOS DE INTERÉS EN BIOQUÍMICA Las técnicas de alto rendimiento desarrolladas en las últimas décadas han permitido la adquisición masiva de información de biología molecular que se depositan en

Más detalles

Estas prácticas tienen por objeto aprender a manejar la información contenida en el NCBI de una forma más o menos sencilla o elemental.

Estas prácticas tienen por objeto aprender a manejar la información contenida en el NCBI de una forma más o menos sencilla o elemental. NCBI. Bases de Datos: Pubmed, Nucleotide, Protein, Structure A lo largo de los últimos 15 o 20 años, se ha ido acumulando una gran cantidad de información de naturaleza molecular (secuencias de genes,

Más detalles



Más detalles

Página principal de Ensembl. Especies para las que mantiene información.

Página principal de Ensembl. Especies para las que mantiene información. EL GENOMA HUMANO VISTO POR ENSEMBL El objetivo de estas prácticas consistirá en analizar una región del genoma humano de aproximadamente 1 Mb de extensión. Se indicará, entre otras cosas, las características

Más detalles

Práctica 1: BLAST y Recuperación de Secuencias

Práctica 1: BLAST y Recuperación de Secuencias Introducción a la Bioinformática Práctica 1: BLAST y Recuperación de Secuencias Recuperación de Secuencias La recuperación de secuencias, es decir la búsqueda y obtención de secuencias de interés en bases

Más detalles

Enfermedad Mendeliana. Búsqueda en bases de datos con proteínas homólogas. Clonaje in silico del gen. Gen candidato

Enfermedad Mendeliana. Búsqueda en bases de datos con proteínas homólogas. Clonaje in silico del gen. Gen candidato Enfermedad Mendeliana Defecto determinado por métodos bioquímicos Sin pistas bioquímicas Identificación proteína Clonaje funcional del gen Búsqueda en bases de datos con proteínas homólogas Clonaje in

Más detalles

Portales que ofrecen servicios de wiki

Portales que ofrecen servicios de wiki Qué es una wiki Una wiki es un sitio web que permite a todos acceder y participar; se pueden crear o editar fácilmente contenidos sin precisar ninguna herramienta técnica. Lo único necesario es un ordenador

Más detalles

La ventana de Microsoft Excel

La ventana de Microsoft Excel Actividad N 1 Conceptos básicos de Planilla de Cálculo La ventana del Microsoft Excel y sus partes. Movimiento del cursor. Tipos de datos. Metodología de trabajo con planillas. La ventana de Microsoft

Más detalles



Más detalles



Más detalles


10. GENERADOR DE INFORMES. 10. GENERADOR DE INFORMES. El generador de informes es un módulo de la aplicación que nos permite elaborar listados de artículos y de clientes pero de forma personalizada, pues se definen los criterios

Más detalles

Introducción a la Estadística con Excel

Introducción a la Estadística con Excel Introducción a la Estadística con Excel En el siguiente guión vamos a introducir el software Excel 2007 y la manera de trabajar con Estadística Descriptiva. Cargar o importar datos En Excel 2007 podemos

Más detalles

Guia de realización de un GIG personal en nuestra página web (

Guia de realización de un GIG personal en nuestra página web ( Crear un GIG en la web del instituto Zunzunegui (v2) Guillermo Hierrezuelo Guia de realización de un GIG personal en nuestra página web ( PREÁMBULO: entrar a nuestra página; navegadores

Más detalles


TRANSFERENCIA DE INFORMACIÓN CON FTP TRANSFERENCIA DE INFORMACIÓN CON FTP La finalidad de Internet es el intercambio de información. Existe la necesidad de transferir grandes archivos desde un punto de la red a otro punto (punto a punto),

Más detalles


SISTEMA DE SEGURIDAD 2FA PARA WINDOWS 8. SISTEMA DE SEGURIDAD 2FA PARA WINDOWS 8. El Sistema de Seguridad 2FA es el Sistema que GCR utiliza para poder acceder a su cuenta personal. Lo que significa es que, una vez el Sistema 2FA esté activado

Más detalles

Alberto Marcano Díaz

Alberto Marcano Díaz Tutorial sobre Internet y su uso (Básico) Creado por: Alberto Marcano Díaz Diciembre, 2006 San Cristóbal, Táchira. VENEZUELA En la nueva era, Internet y todo su entorno es una

Más detalles

Introducción a Mozilla Navegador

Introducción a Mozilla Navegador 20021125 Universidad de Navarra Introducción a Mozilla Navegador Versión 1.1. cti Centro de Tecnología Informática Tabla de contenidos 1. Mozilla Navegador...3 1.1.Establecer las preferencias de Navigator...4

Más detalles


BÚSQUEDA AVANZADA DE IMÁGENES CON GOOGLE BÚSQUEDA AVANZADA DE IMÁGENES CON GOOGLE Las imágenes nos resultan muy útiles para ilustrar cualquier actividad del aula, o para que los propios alumnos ilustren sus creaciones. Sin embargo no siempre

Más detalles


MANUAL BÁSICO DE WRITER MANUAL BÁSICO DE WRITER Los contenidos que vamos a tratar en este pequeño manual son los siguientes: 1. 2. 3. 4. 5. 6. 7. 8. Qué es OpenOffice y qué es Writer? Cómo accedemos a Writer? Principales opciones

Más detalles

2. Seleccionar Insertar función:

2. Seleccionar Insertar función: Estadística I Curso 2014/2015 Guión de la Práctica 1 Introducción a la Estadística con Excel; Estadística Descriptiva En el siguiente guión vamos a ver cómo realizar Estadística Descriptiva con el software

Más detalles

Práctica 2: Alineamiento múltiple e Identificación y búsqueda de Motivos.

Práctica 2: Alineamiento múltiple e Identificación y búsqueda de Motivos. Introducción a la Bioinformática Práctica 2: Alineamiento múltiple e Identificación y búsqueda de Motivos. El alineamiento múltiple es una de las técnicas bioinformáticas más usadas, ya que por medio de

Más detalles


BLAST EJERCICIOS PNLHGLFGRKTG BLAST EJERCICIOS Ejercicio 1 Haz una búsqueda blastp en el NCBI usando la siguiente secuencia de búsqueda: PNLHGLFGRKTG Por defecto, los parámetros se van a reajustar para búsquedas de secuencias cortas.

Más detalles

Laboratorio 6. Creación de sitios Web - Dreamweaver

Laboratorio 6. Creación de sitios Web - Dreamweaver UNIVERSIDAD CARLOS III DE MADRID. ESCUELA DE TURISMO. Informática aplicada al sector turístico Laboratorio 6. Creación de sitios Web - Dreamweaver El objetivo de este laboratorio es aprender a crear sitios

Más detalles

Nos identificamos con nuestro nombre de usuario y la contraseña y llegamos a esta página

Nos identificamos con nuestro nombre de usuario y la contraseña y llegamos a esta página ADMINISTRACIÓN DEL SITIO WEB Todos los jefes de Departamento, coordinadores de proyectos y directivos del Centro somos administradores de la página web. Cada uno tendrá la responsabilidad de administrar

Más detalles



Más detalles


CÓMO CREAR UNA WEBQUEST Paso a Paso CÓMO CREAR UNA WEBQUEST Paso a Paso 1.- Lo primero que tenemos que hacer es acceder a la página del instituto usando Mozilla (no usar el navegador Firefox que puede dar problemas) URL:

Más detalles


MANUAL BASICO DE WEBEX MANUAL BASICO DE WEBEX Webex es un servicio de web conferencias y soluciones de colaboración, lo que significa que nos permite crear una conferencia por internet en la cual además de vernos los unos a

Más detalles

Manual de Inicio Enero 2014 Versión 1.0

Manual de Inicio Enero 2014 Versión 1.0 Manual de Inicio Enero 2014 Versión 1.0 Introducción En este sencillo manual mostramos los pasos para empezar a trabajar con Røter. Lo primero que debemos tener en cuenta es que se trata de una herramienta

Más detalles

Curso de Formación del Programa Un negocio Una Web. - MÓDULO 2 -

Curso de Formación del Programa Un negocio Una Web. - MÓDULO 2 - 1 Curso de Formación del Programa Un negocio Una Web. - MÓDULO 2-1. Secciones 1.1. Visión general y ordenación. 1.2. Como editar sección ya creada. 1.3. Como buscar una sección. 1.4. Como borrar una sección.

Más detalles

Pymol - Práctica guiada

Pymol - Práctica guiada Pymol - Práctica guiada Pymol es un potente visualizor de moleculas muy práctico para trabajar con proteínas. Su interfaz puede parecer compleja en un primer momento, pero vereis que con un poco de práctica

Más detalles

Nosotros, en nuestro ejemplo, hemos optado por quitar todos los caracteres, con lo cual, la pantalla de trabajo nos quedará así:

Nosotros, en nuestro ejemplo, hemos optado por quitar todos los caracteres, con lo cual, la pantalla de trabajo nos quedará así: Tutorial de Rayuela El juego del ahorcado Para empezar a diseñar actividades con Rayuela tenemos que crear primero en la unidad C: una carpeta con nombre dswmedia. Será en esta carpeta donde guardemos

Más detalles

Crear presentaciones con PREZI

Crear presentaciones con PREZI 2012 Crear presentaciones con PREZI Manual de creación y manejo de la HERRAMIENTA WEB 2.0 PREZI. JAVIER FERNÁNDEZ ÁLVAREZ Crear una presentación con PREZI PREZI es una herramienta

Más detalles


GENERADOR DE INFORMES GENERADOR DE INFORMES IdeSoftware Catalonia S.L. 1 ÍNDICE 1 ÍNDICE...2 2 INTRODUCCIÓN:...3 2.1 Acceder al generador...4 2.2 Crear un informe nuevo...5 2.2.1 Modificar uno ya existente...5 2.2.2 Crear uno

Más detalles


MANUAL PARA GESTIÓN DE INCIDENCIAS INFORMÁTICAS MANUAL PARA GESTIÓN DE INCIDENCIAS INFORMÁTICAS En este manual aprenderemos a introducir un Ticket de Soporte (Incidencia Informática) y ver todo el proceso hasta que se resuelve. Para poder escribir Tickets

Más detalles

Creación paso a paso de Formularios con Google (Parte I) (AKA: no corrijo nunca más!)

Creación paso a paso de Formularios con Google (Parte I) (AKA: no corrijo nunca más!) Creación paso a paso de Formularios con Google (Parte I) (AKA: no corrijo nunca más!) por Rodrigo Martínez Gazoni La idea de este tutorial es meternos en una de los servicios que ofrece Google en forma

Más detalles

5.2.1 La Página Principal

5.2.1 La Página Principal 5.2 Las Páginas WEB Una página Web es un documento electrónico escrito en un lenguaje de ordenador llamado HTML, o Hypertext Markup Language (lenguaje de marcación de hipertexto). Como ya hemos dicho,

Más detalles


PROYECTO ADMINISTRACIÓN ORACLE ENTERPRISE MANAGER PROYECTO ADMINISTRACIÓN ORACLE ENTERPRISE MANAGER Proyecto de administración avanzada Alejandro Romero Abadía 1 Este proyecto consiste en una explicación de las funciones que ofrece la consola web de administración

Más detalles

CHEMICAL ABSTRACTS. Pepa Romero Martínez Responsable Hemeroteca Científica

CHEMICAL ABSTRACTS. Pepa Romero Martínez Responsable Hemeroteca Científica CHEMICAL ABSTRACTS Pepa Romero Martínez Responsable Hemeroteca Científica CHEMICAL ABSTRATS Producida por: Chemical Abstracts Service, Ohio (USA) Publicada por: The American Chemical Society Tipo: fuente

Más detalles

Tutorial DC++ Usarlo es muy sencillo y configurarlo también, aunque tiene algunos trucos importentes.

Tutorial DC++ Usarlo es muy sencillo y configurarlo también, aunque tiene algunos trucos importentes. Tutorial DC++ Para compartir, lo mejor es usar el DC++, que es un programa de intercambio P2P (como el emule) pero optimizado para usarlo en redes locales. Usarlo es muy sencillo y configurarlo también,

Más detalles


PRACTICA VI: BUSQUEDA DE SIMILITUDES EN BASES DE DATOS Objetivo: PRACTICA VI: BUSQUEDA DE SIMILITUDES EN BASES DE DATOS Ø Conocer el fundamento de los programas BLAST y FASTA y utilizarlos eficientemente para la búsqueda de similitudes de secuencias de DNA

Más detalles

CRECE EN INTERNET. Llegar a buen puerto: buscando información

CRECE EN INTERNET. Llegar a buen puerto: buscando información CRECE EN INTERNET Llegar a buen puerto: buscando información Llegar a buen puerto: buscando información Internet es una red mundial que vincula miles de ordenadores que almacenan gran cantidad de documentos

Más detalles

Tutorial de Windows Movie Maker

Tutorial de Windows Movie Maker Tutorial de Windows Movie Maker Índice 1-Conocemos el Programa Windows Movie Maker 2- Cómo crear y guardar un Proyecto? 3- Cómo importar imágenes, videos y audios? 4- Cómo crear la película? 4.1.Añadir.Añadir

Más detalles


TRABAJANDO CON BLOGGER TRABAJANDO CON BLOGGER 1 La utilización de las etiquetas y la opción buscar pág.2 2 Cómo añadir autores y lectores a un blog pág.5 3 Añadir elementos a tu blog pág.7 a. Una barra de vídeo b. Una lista

Más detalles


TRABAJANDO CON NUESTRO BLOG DE AULA TRABAJANDO CON NUESTRO BLOG DE AULA Tutorial sobre cómo crear un Blog de Aula mediante la plataforma Blogger Curso 2012/13 Daniel Mantilla Fernández Tutorial 1. Crear una cuenta de correo en Gmail Para

Más detalles

Proveedores y Acreedores

Proveedores y Acreedores Proveedores y Acreedores 1.1 Funciones generales. Para acceder a la pantalla general de proveedores/acreedores pulsaremos las teclas Ctrl+P, aunque puede utilizarse el mouse y en el menú seleccionar dentro

Más detalles

Tabla de contenidos. 1. Introducción. 2. Algunos ejemplos

Tabla de contenidos. 1. Introducción. 2. Algunos ejemplos Tabla de contenidos 1. Introducción 2. Algunos ejemplos 3. Iniciar una actividad nueva 4. Web Worksheet Wizard Step 1: Personal Information 5. Web Worksheet Wizard Step 2: Header and Body Layout 6. Web

Más detalles

Cierre y Apertura de ejercicio. Gestión - Contabilidad

Cierre y Apertura de ejercicio. Gestión - Contabilidad Cierre y Apertura de ejercicio. Gestión - Contabilidad Cliente : Cooperativa Madrileña de Ferreteros, soc. coop. Referencia : I-3-PC-02 / 000041 Asunto : Cierre y apertura de ejercicio. Gestión Contabilidad

Más detalles


UTILIZACIÓN DE UNA CUENTA DE CORREO ELECTRÓNICO (NUEVO) Acceso al correo electrónico Acceso al correo electrónico Pasamos ahora a lo que sería usar la cuenta de correo que nos hicimos en la clase anterior. Lo primero que hacemos es entrar en la página web de Yahoo y localizar el icono

Más detalles

CASO PRÁCTICO Nº 03. El desarrollo del Caso Práctico Nº 03, busca lograr los siguientes objetivos en el participante:

CASO PRÁCTICO Nº 03. El desarrollo del Caso Práctico Nº 03, busca lograr los siguientes objetivos en el participante: CASO PRÁCTICO Nº 03 1. OBJETIVO El desarrollo del Caso Práctico Nº 03, busca lograr los siguientes objetivos en el participante: - Identificar la Ruta Crítica del proyecto. - Realizar el ajuste del tiempo

Más detalles


GUÍA DE APOYO A LA PREINSCRIPCIÓN MÁSTER UNIVERSITARIO EN INTERVENCIÓN ASISTIDA CON ANIMALES Esta guía está editada por la Dirección del Máster Universitario en Intervención Asistida con Animales de la Universidad de Jaén y la Universidad Internacional de Andalucía con el fin de facilitar al posible

Más detalles

9. Composer: Bugs y consejos.

9. Composer: Bugs y consejos. 9. Composer: Bugs y consejos. Composer: bugs y consejos 9.1. Sobre la barra de herramientas de formato Elegir color para remarcar texto En la actualidad existe un lenguaje complementario a las etiquetas

Más detalles



Más detalles

Año: 2008 Página 1 de 31

Año: 2008 Página 1 de 31 Lección 4. Tesorería 4.1. Bancos y caja 4.2. Cobros y pagos con un vencimiento asociado 4.3. Cobros y pagos sin un vencimiento asociado 4.4. Cobro o pago del que desconocemos el origen 4.5. Pago o cobro

Más detalles

IMÁGENES. Existen una serie de formatos de imagen más recomendables que otros para ser introducidos en una página web.

IMÁGENES. Existen una serie de formatos de imagen más recomendables que otros para ser introducidos en una página web. IMÁGENES Todas las páginas web acostumbran a tener un cierto número de imágenes, que permiten mejorar su apariencia, o dotarla de una mayor información visual. Existen una serie de formatos de imagen más

Más detalles

Qué es Chemical Abstracts

Qué es Chemical Abstracts GUÍA DE USO GUÍA DE USO Qué es Chemical Abstracts Chemical Abstracts es la primera fuente de la literatura química mundial. Se incluyen referencias bibliográficas y resúmenes de la literatura internacional

Más detalles

2 Congreso Colombiano de Bioinformática y biología computacional.

2 Congreso Colombiano de Bioinformática y biología computacional. 2 Congreso Colombiano de Bioinformática y biología computacional. Presentación y evaluación de ABMS (Automatic Blast for Massive Annotation) Nelson Perez Cristian Rojas

Más detalles

Como Solicitar y configurar tu web de DXN. Por: Jorge Calvo

Como Solicitar y configurar tu web de DXN. Por: Jorge Calvo Como Solicitar y configurar tu web de DXN Por: Jorge Calvo Paso 1: al poco tiempo de registrarte en DXN recibirás un email de con el asunto Acceso a intranet DXN en

Más detalles

TUTORIAL DE Facebook. Proyecto Empleo 2.0

TUTORIAL DE Facebook. Proyecto Empleo 2.0 TUTORIAL DE Facebook Proyecto Empleo 2.0 ÍNDICE DE CONTENIDOS 1. Cómo registrarse... 1 2. Cómo acceder a tu cuenta... 5 3. Cómo añadir amigos... 6 4. Carga tu foto de perfil... 8 5. Perfil... 9 6. Fotos...

Más detalles



Más detalles

Tutorial 1 Mapas Mentales con Mindomo

Tutorial 1 Mapas Mentales con Mindomo Tutorial 1 Mapas Mentales con Mindomo Instalación y acceso online...2 Comenzando el mapa...3 Temas o categorías principales...4 Generación de subtemas...5 Grabación del mapa mental...6 Formateo del mapa...6

Más detalles

Como verás pone Microsoft Office y si te colocas sobre esta línea debería salir:

Como verás pone Microsoft Office y si te colocas sobre esta línea debería salir: :: Introducción: Microsoft dispone de un conjunto de herramientas llamado Office que se compone de todo lo necesario para resolver cuantos problemas se presenten en los trabajos propios de cualquier usuario

Más detalles


REGISTRAR LOS SITIOS WEB MÁS INTERESANTES REGISTRAR LOS SITIOS WEB MÁS INTERESANTES La forma más fácil de volver a páginas Web que visitamos con frecuencia es almacenándolas en una lista. En Internet Explorer estas páginas se denominan sitios

Más detalles

Título: Manual Básico de Calc. Parte I: Introducción a Calc de

Título: Manual Básico de Calc. Parte I: Introducción a Calc de Título: Manual Básico de Calc. Parte I: Introducción a Calc de Autora: Mª del Pilar Pavón Rosano DNI: 52.923.715-W INTRODUCCIÓN Este manual está dirigido a los alumnos y alumnas del módulo

Más detalles


CASO PRÁCTICO HERRAMIENTAS DE BASES DE DATOS EN EXCEL CASO PRÁCTICO HERRAMIENTAS DE BASES DE DATOS EN EXCEL Nuestra empresa es una pequeña editorial que maneja habitualmente su lista de ventas en una hoja de cálculo y desea poder realizar un análisis de sus

Más detalles


TUTORIAL PHP WEBQUEST TUTORIAL PHP WEBQUEST CURSO TIC CEIP ANDALUCÍA POSADAS (Córdoba) 1 TUTORIAL SOBRE PHP WEBQUEST PHP Webquest es un programa educativo pensado para realizar Webquest, Miniquest y Cazas del Tesoro sin necesidad

Más detalles

Bases de datos biológicas

Bases de datos biológicas Dr. Eduardo A. RODRÍGUEZ TELLO CINVESTAV-Tamaulipas 28 de mayo del 2013 Dr. Eduardo RODRÍGUEZ T. (CINVESTAV) 28 de mayo del 2013 1 / 50 1 Introducción Desventajas de las bases de datos biológicas Recuperación

Más detalles

GUIA APLICACIÓN DE SOLICITUDES POR INTERNET. Gestión de Cursos, Certificados de Aptitud Profesional y Tarjetas de Cualificación de Conductores ÍNDICE

GUIA APLICACIÓN DE SOLICITUDES POR INTERNET. Gestión de Cursos, Certificados de Aptitud Profesional y Tarjetas de Cualificación de Conductores ÍNDICE ÍNDICE ACCESO A LA APLICACIÓN... 2 1.- HOMOLOGACIÓN DE CURSOS... 4 1.1.- INICIAR EXPEDIENTE... 4 1.2.- CONSULTA DE EXPEDIENTES... 13 1.3.- RENUNCIA A LA HOMOLOGACIÓN... 16 2.- MECÁNICA DE CURSOS... 19

Más detalles

- Se puede liberar memoria, espacio, etc. manualmente en nuestro propio ordenador.

- Se puede liberar memoria, espacio, etc. manualmente en nuestro propio ordenador. 1 Curso de Internet a distancia para sacerdotes, religiosos y religiosas Material de apoyo para las teleclases - Viernes, 2 diciembre 2011 Vea los vídeos resúmenes en: y

Más detalles

Guía para el tratamiento en Allegro de recibos para centros no pertenecientes a la Generalitat Valenciana.

Guía para el tratamiento en Allegro de recibos para centros no pertenecientes a la Generalitat Valenciana. Guía para el tratamiento en Allegro de recibos para centros no pertenecientes a la Generalitat Valenciana. Esta guía muestra como proceder en la configuración y posterior uso de la aplicación Allegro en

Más detalles

Phoca Gallery. Cada una de las ramas es una categorías, de modo que, por ejemplo, Mig Any, pertenece a Cavallers 2010 y éstos a Cavallers.

Phoca Gallery. Cada una de las ramas es una categorías, de modo que, por ejemplo, Mig Any, pertenece a Cavallers 2010 y éstos a Cavallers. Phoca Gallery Para subir imágenes a la web, vamos a usar un componente llamado Phoca Gallery, que nos permite crear álbumes de fotos basándonos en el concepto de categorías. Por ello, crearemos una categoría

Más detalles

Introducción al Programa ImageJ

Introducción al Programa ImageJ Introducción al Programa ImageJ Autor Darío Kunik Contacto El ImageJ es una herramienta muy interesante para el procesado de imágenes. Se pueden hacer operaciones muy sencillas sobre imágenes

Más detalles

Modelado de un Sistema Multi-Agente mediante la aplicación de la metodología INGENIAS con el Ingenias Development Kit

Modelado de un Sistema Multi-Agente mediante la aplicación de la metodología INGENIAS con el Ingenias Development Kit Modelado de un Sistema Multi-Agente mediante la aplicación de la metodología INGENIAS con el Ingenias Development Kit Juan A. Botía MASTER TITA, Convocatoria 2007/2008 Ingeniería de Agentes Software y

Más detalles



Más detalles

Funciones lineales. Objetivos. Antes de empezar. 1.Función de proporcionalidad directa pág. 170 Definición Representación gráfica

Funciones lineales. Objetivos. Antes de empezar. 1.Función de proporcionalidad directa pág. 170 Definición Representación gráfica 10 Funciones lineales Objetivos En esta quincena aprenderás a: Identificar problemas en los que intervienen magnitudes directamente proporcionales. Calcular la función que relaciona a esas magnitudes a

Más detalles

Configuración de un APs D-Link DWL-2100AP.-

Configuración de un APs D-Link DWL-2100AP.- Configuración de un APs D-Link DWL-2100AP.- El Acess Point (AP) D-Link 2100AP, es el AP que actualmente colocan Los Servicios Provinciales en los centros. Para poder acceder a su configuración tenemos

Más detalles

Un pequeñísimo tutorial para explicar cómo darse de alta al MEJOR SISTEMA de compartición, backup... en la web.

Un pequeñísimo tutorial para explicar cómo darse de alta al MEJOR SISTEMA de compartición, backup... en la web. ALTA EN DROPBOX Un pequeñísimo tutorial para explicar cómo darse de alta al MEJOR SISTEMA de compartición, backup... en la web. DROPBOX EN LA RED Nos vamos a cualquiera de los navegadores que tengamos

Más detalles

Manual de Usuario. Página: 1

Manual de Usuario. Página: 1 Manual de Usuario Página: 1 INDICE CONTENIDO 1.- ACCESO A CONSULTA DE TRIBUTOS Página 3 2.- DEFINICIÓN DEL PROCESO DE CONSULTA DE TRIBUTOS 2.1- Detalle del tributo 2.2- Pago de tributos 2.2.1- Pago con

Más detalles


UNA HERRAMIENTA DE OFICINA BÁSICA UNA HERRAMIENTA DE OFICINA BÁSICA Empecemos viendo si esto de Google Docs puede ser útil en el aula. Os planteo una situación: Supongamos que mandamos a un grupo de alumnos hacer un trabajo en parejas,

Más detalles

Avanza Lectura Fácil. E3: Guía de usuario

Avanza Lectura Fácil. E3: Guía de usuario Avanza Lectura Fácil E3: Guía de usuario Financiado por: Índice de contenidos 1 Introducción... 3 1.1 Para qué vale este manual?... 3 1.2 Vale para más cosas?... 3 2 Cómo entrar en el portal... 3 2.1 Registro

Más detalles

Módulo I - PowerPoint

Módulo I - PowerPoint Módulo I - PowerPoint Índice Conociendo la aplicación de PowerPoint... 2 Iniciando la aplicación de PowerPoint... 3 Abriendo una presentación existente... 4 Conociendo las partes del área de trabajo de

Más detalles

Prácticas guiadas para el diseño gráfico con Gimp 2.0

Prácticas guiadas para el diseño gráfico con Gimp 2.0 Prácticas guiadas para el diseño gráfico con Gimp 2.0 Luis Escandell Gómez Enero de 2.007 1 Práctica 1 - Diseño Gráfico con Gimp Introducción a Gimp GIMP es el Programa de Manipulación de Imágenes GNU

Más detalles

Practica A. Crear y Administrar Grupos

Practica A. Crear y Administrar Grupos Practica A Crear y Administrar Grupos Los grupos simplifican la administración ya que permiten dar permisos a grupos de usuarios en vez de uno a uno. Antes de comenzar a utilizar los grupos hay que entender

Más detalles

SIL SERVICIO INTERMEDIACIÓN LABORAL. Guía de Iniciación a la búsqueda de empleo por Internet

SIL SERVICIO INTERMEDIACIÓN LABORAL. Guía de Iniciación a la búsqueda de empleo por Internet SIL SERVICIO DE Guía de Iniciación a la búsqueda de empleo por Internet Índice PÁGINAS Correo Electrónico... 2 Crear una cuenta de correo...2 Abrir y leer correo... 4 Escribir y enviar correo... 6 Enviar

Más detalles

TEMA 5: HOJAS DE CÁLCULO. Edición de hojas de cálculo con OpenOffice Calc

TEMA 5: HOJAS DE CÁLCULO. Edición de hojas de cálculo con OpenOffice Calc TEMA 5: HOJAS DE CÁLCULO Edición de hojas de cálculo con OpenOffice Calc Qué vamos a ver? Qué es una hoja de cálculo y para qué sirve El entorno de trabajo de OpenOffice Calc Edición básica de hojas de

Más detalles

Fórmulas y funciones

Fórmulas y funciones 05... Fórmulas y funciones En este tema vamos a profundizar en el manejo de funciones ya definidas por Excel, con el objetivo de agilizar la creación de hojas de cálculo, estudiando la sintaxis de éstas

Más detalles

Manual de usuario. Autor: Oriol Borrás Gené.

Manual de usuario. Autor: Oriol Borrás Gené. Manual de usuario Autor: Oriol Borrás Gené Índice 1. Qué es Pinterest 2. Crear una cuenta 3. Entorno o Inicio o Estructura de un pin o Perfiles 4. Cómo trabajar con Pinterest o Crear

Más detalles

Manual para uso de cuentas de correo

Manual para uso de cuentas de correo Manual para uso de cuentas de correo Indice! " # $ $ % &# % ' " " (# '!)#"#*+ ),(- )#"#*+. % / 0 1 ' 2 -). 3! Introducción El presente documento describe los procedimientos para la configuración del cliente

Más detalles

Charla No 3: Fórmulas de mayor uso.

Charla No 3: Fórmulas de mayor uso. 1 Charla No 3: Fórmulas de mayor uso. Objetivos generales: Explicar el uso de las funciones de mayor uso en MS-Excel Objetivos específicos: Autosuma. Asistente de fórmulas. Max y Min. Buscarv Contar Si

Más detalles

Con este programa pueden abrirse formatos sencillos de texto (como TXT) y editarlos de manera básica.

Con este programa pueden abrirse formatos sencillos de texto (como TXT) y editarlos de manera básica. El Bloc de Notas es el programa más básico que tiene Windows para crear documentos de texto. Puede también venir identificado por su nombre en inglés: Notepad. Es una aplicación muy sencilla que apenas

Más detalles

Manual de Administrador de Entidades

Manual de Administrador de Entidades Manual de Administrador de Entidades Tabla de contenido 1 INTRODUCCIÓN... 1 2 CREAR ENTIDADES... 2 3 RELACIÓN CON USUARIOS Y SALAS... 6 4 NOTICIAS... 8 5 ENCUESTA... 9 6 DOCUMENTOS... 11 7 EVENTO... 12

Más detalles

Creando el balance de mí presupuesto familiar.

Creando el balance de mí presupuesto familiar. Creando el balance de mí presupuesto familiar. Microsoft Excel Xp es la planilla de cálculo mas utilizada hoy en día, forma parte de la Suite de Microsoft Office Xp. Una diferencia con cualquier programa,

Más detalles


TEMA 2 WINDOWS XP Lección 3 PROGRAMA WORDPAD TEMA 2 WINDOWS XP Lección 3 PROGRAMA WORDPAD 1) TRATAMIENTO DE TEXTOS Uno de los programas accesorios más útiles entre los que vienen con Windows XP es WordPad: un tratamiento de textos pequeño, pero potente,

Más detalles

Joomla!: La web en entornos educativos. Capítulos 7 y 8

Joomla!: La web en entornos educativos. Capítulos 7 y 8 Joomla!: La web en entornos educativos Capítulos 7 y 8 Material actualizado a septiembre de 2012 Índice Índice de contenido 7. Menús...109 7.1. Introducción...109 7.2. Gestión de menús...109 7.3. Gestión

Más detalles

MANUAL DE USO Octubre 2011. CLIENTE: Liber Ediciones AUTOR: 2.0 DISEÑO _

MANUAL DE USO Octubre 2011. CLIENTE: Liber Ediciones AUTOR: 2.0 DISEÑO _ MANUAL DE USO Octubre 2011 PROYECTO: MANUAL DE USO - Página Web PAG: 1 INDICE 1. INICIO DE SESIÓN:... 3 2. AÑADIR Y MODIFICAR LAS PÁGINAS:... 5 2.1. Añadir un nuevo libro a bibliofilia...

Más detalles

Manual SBR. Pero antes de explicar las actividades que principalmente podemos desarrollar vamos a dar una visión global de la aplicación.

Manual SBR. Pero antes de explicar las actividades que principalmente podemos desarrollar vamos a dar una visión global de la aplicación. Manual SBR Este proyecto consta de una herramienta denominada SBR mediante la cual el usuario podrá realizar principalmente las siguientes actividades: Crear un nuevo dominio. Modificar el dominio existente.

Más detalles

Nos situamos en la pestaña DISEÑO y encontraremos varios lugares donde añadir un gadget: columnas, debajo de la cabecera, en el pie del blog

Nos situamos en la pestaña DISEÑO y encontraremos varios lugares donde añadir un gadget: columnas, debajo de la cabecera, en el pie del blog TEMA 4 GADGETS 4.1. Añadir Gadgets. Se conoce el término gadget o widget como una serie de mini aplicaciones diseñadas para proveer información, interacción a través de internet que, en nuestro caso, se

Más detalles

X-Trade Brokers Dom Maklerski S.A. MetaTrader 4 Builder. Tutorial. Michał Zabielski 2011-07-27 Traducido por Pablo del Barrio

X-Trade Brokers Dom Maklerski S.A. MetaTrader 4 Builder. Tutorial. Michał Zabielski 2011-07-27 Traducido por Pablo del Barrio X-Trade Brokers Dom Maklerski S.A. MetaTrader 4 Builder Tutorial Michał Zabielski 2011-07-27 Traducido por Pablo del Barrio Índice Instalación... 2 Información Legal... 7 Ajustes previos / Propiedades...

Más detalles



Más detalles


15 CORREO WEB CORREO WEB CORREO WEB Anteriormente Hemos visto cómo funciona el correo electrónico, y cómo necesitábamos tener un programa cliente (Outlook Express) para gestionar los mensajes de correo electrónico. Sin embargo,

Más detalles

10 Claves para mejorar el posicionamiento en buscadores de tu negocio

10 Claves para mejorar el posicionamiento en buscadores de tu negocio 10 Claves para mejorar el posicionamiento en buscadores de tu negocio Calle San Rafael, 14 28108 Alcobendas (Madrid) 902 90 10 20 Introducción Toda empresa o particular que pone en marcha una

Más detalles