LAS SECUENCIAS REPETITIVAS Y EL ORIGEN PARENTAL EN Tympanoctomys barrerae

Tamaño: px
Comenzar la demostración a partir de la página:

Download "LAS SECUENCIAS REPETITIVAS Y EL ORIGEN PARENTAL EN Tympanoctomys barrerae"

Transcripción

1 Profesor Patrocinante Dr. Milton Gallardo Narcisi. Facultad de Ciencias. Institución de Zoología Profesor Co-Patrocinante Dr. Jaime Figueroa. Instituto de Bioquímica. Facultad de Ciencias. LAS SECUENCIAS REPETITIVAS Y EL ORIGEN PARENTAL EN Tympanoctomys barrerae Tesis de Grado presentada como parte de los requisitos para optar al grado de Licenciado en Bioquímica y Título Profesional de Bioquímico CRISTIAN LEONARDO MARCHANT SOTO. VALDIVIA CHILE 2011

2 Los únicos regalos del mar son golpes duros, y ocasionalmente la oportunidad de sentirse fuerte. No conozco mucho el mar, pero sé que así es. Y también sé, lo importante que es en la vida no necesariamente ser fuerte, sino sentirse fuerte. Medirse uno mismo aunque sea una vez. Encontrarse aunque sea una vez en las condiciones humanas más primitivas, sin nada que te ayude excepto tus manos y tu propia cabeza. Dedicada a mis Padres, Sergio Marchant (Q.E.P.D) y María Soto.

3 AGRADECIMIENTOS. Por medio de estas palabras quisiera agradecer a las siguientes personas, sin ellas mis estudios de pregrado no hubiesen sido posibles: A mi difunto padre (Q.E.P.D) que gracias a él, todo esto que he logrado hasta la fecha ha sido gracias a sus grandes sacrificios y esfuerzos durante su vida. Gracias por creer en mí, por su apoyo y afecto. A mi gran madre, por sus palabras, consejos, compañía, perseverancia y sacrificio constante por verme titulado. A mi maestro y amigo, Dr. Milton Gallardo, por aceptarme en su grupo de investigación desde marzo del Por sus sabio consejos y apoyo en los momentos difíciles. Gracias por transmitirme su conocimiento, formarme en la ciencia y guiarme en los momentos de incertidumbre y crisis vocacional. Es un honor para mí haber formado parte de su grupo y haber aportado en su investigación. Al resto de mi familia, Hermanos, Cuñados y sobrinos. Ellos siempre me brindaron su apoyo y cariño. Gracias por su preocupación constante. A mis grandes amigos y compañeros de carrera, Jorge (fisho), Rodrigo (siber), Agustín (sapo), Paulina (Paly), Rodrigo (sandro), Magdalena (lena). Gracias por hacer los días en valdivia más agradables y llevaderos. Por compartir grandes momentos de fiestas y estudio. Por el cariño, la confianza y la amistada verdadera.

4 AGRADECIMIENTOS. Por medio de estas palabras quisiera agradecer a las siguientes personas, sin ellas mis estudios de pregrado no hubiesen sido posibles: A mi difunto padre (Q.E.P.D) que gracias a él, todo esto que he logrado hasta la fecha ha sido gracias a sus grandes sacrificios y esfuerzos durante su vida. Gracias por creer en mí, por su apoyo y afecto. A mi gran madre, por sus palabras, consejos, compañía, perseverancia y sacrificio constante por verme titulado. A mi maestro y amigo, Dr. Milton Gallardo, por aceptarme en su grupo de investigación desde marzo del Por sus sabio consejos y apoyo en los momentos difíciles. Gracias por transmitirme su conocimiento, formarme en la ciencia y guiarme en los momentos de incertidumbre y crisis vocacional. Es un honor para mí haber formado parte de su grupo y haber aportado en su investigación. Al resto de mi familia, Hermanos, Cuñados y sobrinos. Ellos siempre me brindaron su apoyo y cariño. Gracias por su preocupación constante. A mis grandes amigos y compañeros de carrera, Jorge (fisho), Rodrigo (siber), Agustín (sapo), Paulina (Paly), Rodrigo (sandro), Magdalena (lena). Gracias por hacer los días en valdivia más agradables y llevaderos. Por compartir grandes momentos de fiestas y estudio. Por el cariño, la confianza y la amistada verdadera.

5 i INDICE GENERAL. Pág. 1.-Resumen Summary Introducción Hipótesis de trabajo Objetivos generales Objetivos específicos Materiales y Métodos Materiales Material Biológico Enzimas Reactivos Metodología Extracción de ADN Genómico Obtención de placas metafásicas de T. barrerae Preparación de sondas genómicas de T. barrerae, P. 15 aures, O. mimax y O. gliroides Electroforesis de sondas y ADN genómicos. 15

6 ii Pág Cuantificación ADN genómico Experimentos controles Hibridación Genómica Comparada Total (W-CGH) Pre-Hibridación Hibridación Post-Hibridación, Montaje y Captura de Imagen Resultados Cuantificación y Calidad de ADN Genómico Electroforesis de sondas y ADN genómico Ensayo Controles Hibridación Genómica Comparada Total (W-CGH) Discusión Conclusión Bibliografía 44

7 iii INDICE DE FIGURAS. Pág. Figura 1.- Modelo explicativo en el origen de Tympanoctomys barrerae 8 mediante hibridación interespecífica. Figura 2.- Esquema de metodologia de W-CGH utilizada 18 Figura 3.- Gel de electroforesis de los DNA extraídos. 21 Figura 4.- Gel de electroforesis de las sondas fluorescentes. 22 Figura 5.- Experimento de Self-GISH, Sonda O. mimax y O. gliroides 24 sobre sus placas metafasicas. Figura 6.- Experimento de Self-GISH, Sondas de T. barrerae y P. aureus 25 hibridadas sobre sus placas metafásicas. Figura 7.- Experimentos de W-CGH sobre placas metafásicas de 27 T. barrerae. Figura 8.- Experimentos de W-CGH sobre placas metafásicas de 29 T. barrerae con sondas de O. mimax y P. aureus Figura 9.- Experimentos de W-CGH sobre placas meióticas y nucleos 30 interfásicos de T. barrerae con sondas de O. mimax y P. aureus Figura 10.- Esquema representativo para la co-evolución de las secuencias 36 repetitivas y proteínas centroméricas en T. barrerae

8 iv LISTA DE ABREVIATURAS. DAPI 4`,6-diamino-2-fenilindol. EDTA Ácido Etilendiaminotetraacetico. EtBr Bromuro de Etidio. F-12-UTP Fluoresceína-12-Uridina trifosfato. FISH Hibridación Fluorescente in situ. GISH Hibridación Genómica in situ. H 0 Hipótesis Nula. H 1 Hipótesis Alternativa. NOR Región Organizadora del Nucleolo. PBS Tampón fosfato salino. R-11-UTP Rodamina 11 Uridina trifosfato SBF Suero Bovino Fetal. SDS Dodecílsulfato Sódico. SSC Citrato Salino Sódico. W-CGH Hibridación Genómica Compara Total. % p/v Porcentaje Peso volumen

9 1 1.- RESUMEN Tympanoctomys barrerae (2n=102) es un roedor con duplicación genómica y con un aparente origen alotetraploide derivado de la hibridación interespecífica entre Pipanacoctomys aureus (2n=92) y Octomys mimax (2n=56). Estudios de pintura cromosómica señalan que T. barrerae es diploide y que su alto número cromosómico y contenido de ADN (16,8 pg) se debe a acumulación de secuencias repetitivas. Esta hipótesis se puso a prueba mediante hibridación genómica comparada in situ (W-CGH) hibridando sobre placas meióticas y mitóticas de T. barrerae con sondas de sus posibles ancestros, sin ADN bloqueador. De este modo es posible discriminar la proveniencia, el tamaño y localización del ADN repetitivo en T. barrerae. Los resultados indicaron que hay cromosomas cuya secuencias repetitivas tiene homología con el ADN de P. aureus mientras otros tienen homología con el ADN de O. mimax. Una tercera fracción muestra homología mixta. Estos resultados apoyan la condición alotetraploide de T. barrerae y descartan un incremento masivo de secuencias repetitivas, pues dicho ADN se limita a las regiones pericentroméricas y algunas teloméricas. Adicionalmente P. aureus tiene un mayor numero y diversidad de secuencias repetitivas a pesar de presentar menor tamaño del genoma. Por lo tanto la alotetraploidía es la explicación más parsimoniosa para explicar el doble número de cromosomas bibraquiados y el efecto gigas en T. barrerae. Estos atributos no tienen explicación bajo la hipótesis de adición de secuencias repetidas.

10 SUMMARY. Tympanoctomys barrerae (2n=102) is a rodent with genome duplication and an apparent allotetraploid origin derived by interspecific hybridization between Pipanacoctomys aureus (2n=92) and Octomys mimax (2n=56). Nevertheless, chromosome painting suggests that T. barrerae is diploid and that it is high chromosome number and DNA content (16,8 pg) is due to accumulation of repetitive sequences. This hypothesis was tested through Whole Comparative Genome Hybridization (W-CGH) on meiotic and mitotic plates of T. barrerae, using probes of its possible ancestors, without blocking DNA. Thus, it was possible to discriminate the origin, size and location of repetitive DNA in T.barrerae. These findings support the allotetraploid status of the species and discredited a massive increase of repetitive sequences to explain its large genome size since it DNA is limited to pericentromeric and telomeric regions. Therefore allotetraploidy is the more parsimonious explication for the double chromosome number of biarmed chromosome and for the gigas effect in T. barrerae. These attributes have no explication under the hypothesis of addition of repetitive sequences and corroborate the hybrid origin of the species.

11 3 2.- INTRODUCCION. En el genoma de organismos eucariontes las secuencias repetitivas son los principales constituyentes, pues comprenden más que el 50% en humanos (Shapiro et al., 2005). Las secuencias repetitivas contribuyen a la complejidad del genoma incluso entre especies estrechamente relacionas. Inicialmente, estas secuencias no eran del todo conocidas y se especulaba que no tenían función dentro del genoma, por ello se les denominó ADN basura o ADN parásito (Doolittle y Sapienza, 1980; Orgel y Crick, 1980). Actualmente, se han clasificado en dos grandes grupos, las secuencias dispersas y las repeticiones en tándem. El primer grupo lo componen secuencias repartidas de forma azarosa en el genoma, siendo las más abundantes los elementos móviles transponibles. Este grupo de secuencias se encuentra presente tanto en genomas procariontes como en eucariontes y su importancia evolutiva radica en que pueden producir mutaciones al momento de desplazarse de un punto a otro en el genoma (Alberts, 2006). Por su lado, las secuencias repetidas en tándem presentan una organización que consiste de una sucesión de copias (una al lado de la otra), de una determinada secuencia. Existen tres clases de secuencias en tándem: a) los microsatélites conformados por secuencias cortas entre 1 a 5 pares de bases y 10 a 100 repeticiones, b) los minisatélites son secuencias con 10 a 100 pares de base y 10 a 100 repeticiones. Finalmente c) el ADN satélite, corresponde al ADN repetido en tándem con tamaños que oscilan desde cientos hasta miles de pares de base (Charlesworth et al., 1994). Este ADN satélite se localiza principalmente en las regiones centroméricas y pericentroméricas donde

12 4 también se encuentra la heterocromatina constitutiva reconocida por el bandeo C (Redi et al., 2001). La heterocromatina corresponde a material genético transcripcionalmente inactivo y presenta dos principales componentes. El primero está formado por histonas y proteínas heterocromáticas como HP1, descrita en Drosophila (Belyaeva et al., 1993). El segundo, se compone de las secuencias repetidas satélites, caracterizadas por endonucleasas de restricción (Lica y Hamkalo 1983; Lohe et al., 1993). Se ha documentado una gran variedad de familias de secuencias satélites con diferencias en longitud, número de repeticiones y variantes nucleotídicas (Charlesworth et al., 1994). Esta gran variación está presente incluso entre especies estrechamente emparentadas (Pita et al., 2003). En primates, la familia del Satélite-α es la mejor caracterizada y en humanos, consta de una unidad de repetición de 171 pb, duplicada en tándem (Willard y Waye, 1987; Waburton et al., 1993). En Mus musculus domesticus se han identificado cuatro familias de ADN satélite: satélite mayor, satélite menor, satélite 3 y satélite 4. Estas secuencias satélites tienen distinta localización, longitud y número de repeticiones (Kuznetsova, et al., 2004). El satélite menor (MiSat) tiene localización centromérica mientras el satélite mayor (MaSat) se encuentra en regiones pericentroméricas (Wong y Rattner, 1988; Joseph et al., 1989; Garagna, et al,. 2001). La localización de las secuencias altamente repetitivas es primordialmente centromérica y se ha argumentado un rol funcional importante en el metabolismo celular, como la estructuración y ensamblaje de los centrómeros, (Pidoux y Allshire 2000). La heterocromatina centromérica tiene una constitución diferente a aquélla

13 5 localizada en otras regiones cromosómicas debido a que sus histonas están generalmente hipoacetiladas (Jeppesen et al., 1992). La detección de HP1 (proteina heterocromatica 1) mediante inmunofluorescencia y FISH (Fluorescence in situ Hybridization) han demostrado su contribución en la función del centrómero (Eissenberg y Elgin, 2000). Al respecto, se acumula específicamente sobre MaSat, mientras que la distribución de las proteínas centroméricas (CENP) están asociadas sólo con el MiSat (Guenatri et al., 2004). La detección citológica de las secuencias ha sido posible con advenimiento de la hibridación in situ usando sondas fluorescentes. Actualmente, la técnica de hibridación genómica comparada total (Whole- Comparative Genomic Hibridization; W-CGH), ha permitido la identificación de polimorfismos cromosómicos relacionados con el ADN repetitivo localizado en las regiones centroméricas y pericentroméricas. (Bloom et al., 2007). Tales polimorfismos son detectables estableciendo competencia entre dos ADNs genómicos en igual concentración y en un ambiente de hibridación in situ. A diferencia de la Hibridación genómica in situ (GISH), esta técnica no utiliza ADN bloqueador, de modo que no hay sustracción de las secuencias repetitivas, en comparaciones interespecíficas o intraespecífica (Pita et al., 2003). Esta estrategia consiste en cohibridar placas cromosómicas de la especie en estudio con las sondas genómicas totales de las especies con que se compara. Así, ambas sondas compiten por sus regiones de mayor homología produciendo tinciones diferenciales. Se obtiene un color intermedio cuando ambas sondas colocalizan en un mismo lugar debido a su homología. Esta técnica ha permitido identificar las diferencias en cuanto a la amplificación, distribución y localización de secuencias repetitivas en insectos y mamíferos. Por

14 6 ejemplo, se utilizó W-CGH para determinar la distribución de secuencias repetitivas en tres razas de ovejas (Dávila-Rodríguez et al., 2009). Igualmente, la técnica permitió concluir que tres razas de cerdos de origen independiente comparten familias con secuencias similares en sus regiones centroméricas. No obstante, el numero de copias está expandido diferencialmente entre las razas (Pita et al., 2008). Adicionalmente, la W-CGH permitió discriminar los cromosomas homólogos provenientes de cada progenitor (Hepperger et al., 2008). Considerando la utilidades de la W-CGH, se utilizará esta técnica para mapear citológicamente y discriminar los subgenomas que supuestamente forman el genoma de Tympanoctomys barrerae. Este roedor tiene un genoma de 16.8 pg de ADN por núcleo cuyo valor duplica el de sus especies filogenéticamente más cercanas como, Octodontomys gliroides (2n = 38) y Octomys mimax (2n = 56) cuyos genomas contiene 8.2 y 7.6 pg de ADN respectivamente (Gallardo y col., 2003, 2004). Como resultado de la duplicación de su genoma esta especie muestra incremento en el tamaño celular (efecto gigas) sugiriéndola como especie tetraploide. La directa relación en el contenido del ADN con las dimensiones celulares es bien conocida en plantas poliploides, como resultado, se observan estructuras reproductivas más grandes (Stebbins et al., 1971). La tetraploidía de T. barrerae fue corroborada por análisis de FISH, usando como sonda una fracción del enhancer temprano del gen Hoxc8 (Gallardo et al., 2006). Por otra parte, la meiosis diploidizada y estudio de genes ribosomales de esta especie ha sugerido un origen alotetraploide. Dado la cercanía filogenética, se ha sugerido un modelo en el origen de T. barrerae mediante hibridación interespecífica (figura 1). Este modelo propone a Octomys mimax como especie ancestral (2n = 56), la cual habría producido

15 7 gametos no reducidos durante la meiosis. La fusión de estos gametos, unidos a los 46 cromosomas de P. aureus, habrían dado origen a T. barrerae (2n =102). Este modelo ha sido corroborado mediante análisis de GISH al mostrar que el genoma de O. mimax y P. aureus están completamente contenidos en el genoma de T. barrerae (Suárez, tesis; 2007) Dado que la pintura cromosómica no corroboró la tetraploidía T. barrerae, se concluyó que esta especie es diploide y su gran tamaño del genoma se debe principalmente a un aumento y dispersión de secuencias repetitivas (Svartman et al., 2005). De estos resultados surge la necesidad de poner a prueba tal hipótesis mediante W-CGH (Pita et al., 2008; Dávila-Rodríguez et al., 2009). Para estos ensayos se utilizarán sondas genómicas de sus posibles progenitores con el fin de evaluar su potencial contribución al genoma de T. barrerae. Con todo, el presente trabajo tiene por objetivo poner a prueba la hipótesis de Svartman (2005) para contrastarla con la hipótesis de alopoliploidía propuesta por Gallardo (2006).

16 8 Figura 1. Modelo explicativo del origen de Tympanoctomys barrerae, mediante hibridación interespecífica.

17 HIPOTESIS DE TRABAJO. H 0 : T. barrerae es diploide y el gran tamaño de su genoma se debe a una expansión generalizada de las secuencias repetitivas. Esta hipótesis predice que se detectarán señales fluorescentes en brazos y cromosomas completos, producto del aumento de secuencias repetitivas. H 1 : Debido a la condición alotetraploide de T. barrerae, las secuencias repetitivas en tándem se distribuirán preferentemente en las regiones centroméricas y pericentroméricas. Esta hipótesis además predice que debido a la variación de estas secuencias se podrá discriminar los centrómeros provenientes de cada uno de sus parentales.

18 OBJETIVOS GENERALES. 1.- Determinar el origen y distribución de las secuencias repetitivas en el genoma de T. barrerae mediante la hibridación de sus cromosomas con ADN genómico total, marcado con fluoresceína y sin bloqueador (W-CGH).

19 OBJETIVOS ESPECÍFICOS. 1.- Realizar W-CGH sobre placas metafásicas de T. barrerae utilizando sondas fluorescentes de ADN genómico de cada uno de sus especies parentales y sin ADN bloqueador. 2.- Realizar W-CGH sobre placas meióticas de T. barreare utilizando sondas fluorescentes de ADN genómico de cada uno de sus especies parentales y sin ADN bloqueador. 3.- Determinar los cromosomas de T. barreare que presenta mayor homología por las secuencias repetitivas de sus taxa filogenéticamente más cercanos, O. mimax, P. aureus y O. gliroides. 4.- Identificar la existencia de distintas familias de secuencias repetitivas en el genoma de T. barrerae. 5.- Determinar citológicamente si el gran tamaño del genoma de T. barrerae se debe a un incremento de las secuencias altamente repetitivas. 6.- Corroborar la hipótesis de alotetraploidía de T. barrerae.

20 MATERIALES Y MÉTODOS MATERIALES MATERIAL BIOLÓGICO. Para la extracción de ADN genómico se utilizaron individuos de T. barrerae, O. mimax, O. gliroides, P. aureus, que fueron colectado en su hábitat natural. Los órganos utilizados de estas especies se encuentran preservados en alcohol o congelados en la Colección de Mamíferos del Instituto de Ecología y Evolución, de la Universidad Austral de Chile. Los cromosomas T. barrerae utilizados corresponden a la línea celular 1755 (hembra) y 1807 machos. Se realizaron experimentos controles en placas metafísicas de O. mimax, O. gliroides, P. aureus.

21 ENZIMAS Número de catálogo. Taq ADN polimerasa (Invitrogen) RNasa A (Invitrogen) Proteinasa K (Invitrogen) Pepsina (Sigma-Aldrich) P REACTIVOS. GelRedTM Nucleic Acid Gel Stain (Biotium) ADN λ HindIII ladder (NEB) Agarosa (Sigma-Aldrich) N3012L A9539 Etanol absoluto (Merck) Isopropanol (Sigma-Aldrich) Cloroformo (Merck) Fenol (Merck) Alcohol isoamílico (Merck) EDTA (Merck) Ácido clorhídrico (Merck) Paraformaldehido (Merck) Formamida (Merck) Dextran sulfato (Sigma-Aldrich) D8906 Fluoroceina-12-UTP (Invitrogen) C-7604 DAPI (Invitrogen) D1306 Vectashield (VectorLabs) H-1400

22 METODOLOGÍA EXTRACCIÓN DE ADN GENÓMICO. El ADN genómico se extrajo a partir de las muestras de tejido de hígado de P. aureus, O. mimax, T. barrerae, O. gliroides, según métodos estándares descrito por Sambrook y cols. (1998) con algunas modificaciones detalladas en Gallardo y cols. (2004) OBTENCIÓN DE PLACAS METAFÁSICAS DE T. barrerae. Para la obtención de cromosomas se utilizó la técnica de explante primario (Fershney, 2000) a partir de tejido pulmonar. El cultivo se incubó en una cámara de CO 2 al 10% a 37ºC, en medio de cultivo MEM EARLES. NEAA con 10% de suero bovino fetal (SBF). Cuando las células alcanzaron el 100% de confluencia, se procedió a la obtención de cromosomas de la siguiente manera: el cultivo se dividió en 3 frascos con aproximadamente 2 a 3 ml de medio de cultivo nuevo. Cumplidas las 24 h. se aplicó una solución de colchicina al 0,01 ug/ml a cada frasco, posteriormente transcurridas entre 3 a 4 h. las células se removieron por tratamiento con tripsina y se llevaron a un tubo de 15 ml para luego realizar el tratamiento de hipotonía. La hipotonía se realizó por 20 minutos en una solución 0,075 M de KCl a 37ºC. Finalmente el producto se centrifugó y el sedimento se fijó con una solución de metanol acido acético 3:1. Los cromosomas se almacenaron en dicha solución.

23 PREPARACION DE LAS SONDAS GENOMICAS DE T. barrerae, P. aureus, O. mimax y O. gliroides. Del ADN obtenido en el procedimiento 3.2.1, se tomaron 1 a 2 ul y se aforó a 15 ul con agua destilada para someterse a shock térmico a 95ºC por 10 minutos. Posteriormente se marcó con fluoresceína 12-UTP mediante el método de random primers. Este procedimiento se basa en la desnaturación y posterior hibridación de los fragmentos de ADN genómico con exameros al azar de ADN (cebadores). Posteriormente, la ADN polimerasa I, cataliza la adición de nucleótidos trifosfatos en dirección 5-3 hidroxilo. La presencia en esta reacción de fluoresceína 12-UTP, análogo a dutp permite que entre el 50-60% de dttp sean reemplazados por fluoresceína 12-UTP. Esta reacción produce sondas entre 200 y 400 pb (Lieu y cols., 2005) ELECTROFORESIS DE SONDAS Y ADN GENÓMICO. Con el fin de conocer el tamaño de las sondas preparadas, los productos obtenidos del procedimiento anterior se fraccionaron electroforéticamente en geles de agarosa al 1,5%. La preparación de los geles se realizó con TAE 1.0X (20 mm tris-acetato, ph 8,0; 1 mm EDTA y 10 mm de acetato de sodio) como tampón gel y tampón de corrida. Los productos de sonda de ADN se mezclan con 3 ul de buffer de carga 6X (xilencialol 0,25% p/v más azul de bromofenol 0,25% p/v en glicerol; Sambrook et al., 1989). El tamaño de los fragmentos se determinó fraccionando las muestras en un gel, junto aun estándar de tamaño molecular y concentración conocida (ADN 100 pb, invitrogen). Los geles se tiñeron con bromuro de etidio (EtBr) a una concentración de

24 ug/ml, que como agente intercalante del ADN permite la visualización de bandas de ácidos nucleicos en un transiluminador UV (Vilbert Loumart modelo TFX- 20.M). Los geles de agarosa al 0.8% se realizaron a fin de verificar la calidad del ADN genómico extraído CUANTIFICACIÓN DEL ADN GENÓMICO. El ADN extraído se cuantificó mediante un espectrofotómetro NanoDrop-1000 calibrado a 260 nm, para medir concentración de ácidos nucleicos. La razón de absorbancia 260/280 nm, se usó para verificar la pureza del ADN EXPERIMENTOS CONTROLES Los experimentos controles se realizaron por medio de la técnica Self-GISH, que consiste en hibridar sondas genómicas con placas metafísicas pertenecientes a una misma especie, con el fin corroborar si las muestras de ADN sondas corresponden realmente a secuencias repetitivas. Así en el self-gish se hibridaron sobre placas metafásicas de O. mimax, P. aureus, T. barrerae y O. gliroides sus propio ADN marcado con fluoresceína en ausencia de ADN bloqueador. El ambiente de hibridación se logra transcurrido 24 h de incubación en cámara húmeda a 37ºC. La rápida cinética de reasociación permite determinar la localización de estas secuencias en el genoma de O. mimax, P. aureus, T. barrerae y O. gliroides.

25 HIBRIDACIÓN GENÓMICA COMPARATIVA TOTAL (W-CGH). Con el fin de poner aprueba si el tamaño del genoma de T. barrerae se debe a la acumulación de secuencias repetitivas. En este experimento las señales verdes (fluoresceína) corresponden a O. mimax y las señales en rojo (rodamina) corresponde a P. aureus (Figura 2). La colocalización de ambas se observará de color amarillo. La W-CGH consta de 5 pasos: Pre-hibridación Las placas cromosómicas de T. barrerae obtenidas a partir del procedimiento descrito anteriormente, se envejecen por shock térmico de 95ºC por 10 seg según protocolo de Henegariu (2001). Posteriormente las placas se someten a tratamientos consecutivos de HCl (10mM) por 5 minutos, pepsina (5mg/ul) por 1 min a 37ºC, formaldehído al 1% por un minuto y dos lavados con 2X SSC por 5 minutos. Posteriormente se transfieren a una batería de etanol al 50%, 70% y 100% por 5 minutos cada uno, formamida al 70% por 3 minutos, 2X SSC por 3 minutos y una deshidratación final con la batería de alcoholes mencionadas anteriormente. (Traut et al., 1999; Gallardo et al., 2006).

26 18 Figura 2. Esquema de metodología de W-CGH utilizada. El ADN extraido de O. mimax y P. aureus es marcado con fluoresceína y utilizado como sonda. La solución de hibridación contiene ambas sondas en concentración equimolar de rodamina (rojo) y fluoresceína (verde). Además, contiene 20XSS, formamida y dextrán sulfato. Paralelamente, se trabajó la placa metafásica con lavados de etanol y 2XSSC en etapas de pre-hibridación. La etapa de hibridación se realizó a 37ºC por 24 h. En post-hibridación, se realizaron lavados con 4XSSC+tween % y etanol para finalmente capturar las imágenes en microscopio de epifluorescencia.

27 Hibridación: Consiste en la aplicación de la mezcla de hibridación (30 ul por portaobjeto), la cual se desnatura previamente a 83ºC por 6 minutos. La mezcla contiene 100 ng de sonda de hibridación de O. mimax y P. aureus equimolar, 50% formamida desionizada (v/v), 2X SSC y 10% de dextran sulfato. La hibridación se lleva a cabo en una cámara húmeda por 24 h a 37ºC Post-hibridación, montaje y captura de imagen. Cumplidas la 24 h, los portaobjetos son sometidos a los siguientes tratamientos de lavados post-hibridación: formamida al 50% por 3 min a 37ºC, 2X SSC por 3 min a 37ºC y 4X SSC preparado con tween 20 (0,1%) tres veces por 5 minutos (Zhan 2004; Gallardo et al., 2006). El contrateñido se realizó con DAPI, una sustancia que se une fuertemente al ADN y que al ser excitada a 345 nm emite un color azul (488 nm) en todos los cromosomas. Posteriormente se realiza el montaje de la placa con una solución antifade (vectashield). Las placas mitóticas se visualizaron en microscopio de epifluorescencia Zeiss AxioLAB modelo 50/AC equipado con una cámara fotográfica Axiocam MRC. Las fotografías fueron tomadas con cada uno de los filtros, azul, verde y rojo.

28 RESULTADOS CUANTIFICACIÓN Y CALIDAD DEL ADN GENÓMICO. A fin de verificar la calidad del ADN genómico extraído se realizó una electroforesis en gel de agarosa al 0.8%. Una gruesa banda de alto peso molecular bien definida en el gel, refleja un ADN en buen estado e integro para obtener sondas genómicas apropiadas. El ADN utilizado se observa en los carriles 2, 3, 4 y 5 de P. aureus, O. mimax, O. gliroides y T. barrerae, respectivamente (Figura 3). La concentración de ADN adecuada para realizar nuestro trabajo corresponde a valores mayores de 1000 ng/µl, presentando además un índice de pureza mayor o igual a 1,8. Las concentración de ADN que se utilizaron fueron de ng/µl, ng/ µl, 1223 ng/ µl y 1374 ng/ µl para P. aureus, O. mimax, O. gliroides y T. barrerae, respectivamente. Sus índices de pureza fueron 1.82, 1.81, 1.84 y 1.87 para P. aureus, O. mimax, O. gliroides y T. barrerae, respectivamente ELECTROFORESIS DE LAS SONDA GENÓMICAS. Los tamaños aproximados de las sondas (Figura 4) obtenidos por comparación con el estándar de tamaño molecular (100 bp) se encontraron entre pb.

29 21 Figura 3. Electroforesis en gel de agarosa 0,8% de ADN genómico extraído de 3 especies de octodóntidos. Carril 1, estándar de tamaño molecular correspondiente al ADN del fago lambda digerido con HindIII. Carril 2, ADN genómico de P. aureus. Carril 3, O. mimax. Carril 4, O. gliroides y Carril 5, T. barrerae.

30 22 Figura 4. Electroforesis en gel de agarosa al 1,5%, de sondas ADNs fluorescentes, marcadas con F-12-UTP (fluoresceína) y R-11-UTP (Rodamina) por medio del método random primer. Carril 1, marcador de tamaño molecular 100 bp. Carril 2 sonda ADN genómico de T. barrerae. Carril 3, sonda ADN genómico de P. aureus. Carril 4, sonda ADN genómico de O. mimax y Carril 5, sonda ADN genómico O. gliroides.

31 ENSAYOS CONTROLES. Se empleó Self-GISH como técnica de control y para conocer la localización de las secuencias repetitivas en los genomas de las especies en estudio. Esta consiste en hibridar placas metafásicas con sondas genómicas totales del mismo individuo. Al hibridar las sonda genómica de O. mimax y O. gliroides (Figura 5), P. aureus (Figura 6b) sobre sus propias placa metafásicas, las sondas fluorescentes identificaron las secuencias repetitivas pericentroméricas en la totalidad de los cromosomas, exceptuando dos pares cromosómicos en O. mimax (Figura 5). Además las sonda genómica de P. aureus detectó 26 señales fluorescentes adicionales, con ubicación telomérica (Figura 6b, flecha verde). Los experimentos Self-GISH sobre T. barrerae mostraron que la sonda detectó todos los cromosomas de la especie, (2n = 102). La detección se ve reflejada por la fluorescencia de color verde sobre todos los cromosomas, generada por el marcaje con fluoresceína 12-UTP en placas de hembra (Figuras 6a).

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Tipos de mapas: MAPAS FISICOS (de restricción, citogenéticos, de híbridos de radiación...)

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

Cromosomas y Cariotipo Prof. Víctor Zárate Tribiño

Cromosomas y Cariotipo Prof. Víctor Zárate Tribiño Liceo Coeducacional La Igualdad Departamento de Ciencias Biología, Segundo medio Cromosomas y Cariotipo Prof. Víctor Zárate Tribiño Qué son los Cromosomas? Un cromosoma es una estructura organizada de

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Bases moleculares y estudios genéticos

Bases moleculares y estudios genéticos II Jornada Genética Clínica para Médicos de Familia Bases moleculares y estudios genéticos María García-Barcina Unidad de Genética del H. Universitario de Basurto Osakidetza Sede SVMFIC Valencia, 2 de

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Tema 11. Herramientas de la genética molecular

Tema 11. Herramientas de la genética molecular Tema 11. Herramientas de la genética molecular Genética CC. Mar 2004-05 Objetivos Técnicas de clonación Construcción de genotecas e identificación de secuencias Mapas de restricción Amplificación (PCR)

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Tema 3: Mitosis y Meiosis

Tema 3: Mitosis y Meiosis Tema 3: Mitosis y Meiosis Objetivos tema Mitosis y meiosis Deberán quedar bien claros los siguientes puntos Cromosomas: topografía, comparación, idiograma Mitosis y meiosis: similitudes y diferencias Paralelismo

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

Comprobando la calidad del DNA genómico mediante electroforesis en gel

Comprobando la calidad del DNA genómico mediante electroforesis en gel Comprobando la calidad del DNA genómico mediante electroforesis en gel GELES 1 Y 2 Agarosa 0.8 %, electroforesis a 1 V/cm Muestras: Se ha cargado muestras de DNA genómico no digerido, antes (líneas impares)

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Citogenética Básica. Tinción de las preparaciones cromosómicas para detectar los posibles cambios numéricos y estructurales.

Citogenética Básica. Tinción de las preparaciones cromosómicas para detectar los posibles cambios numéricos y estructurales. Citogenética Básica Qué son los Cromosomas? La citogenética es el estudio de los cromosomas y las enfermedades relacionadas, causadas por un número y/o estructura anormales de los cromosomas. Los cromosomas

Más detalles

CROMOSOMA 21. Pintado Cromosómico Total 21

CROMOSOMA 21. Pintado Cromosómico Total 21 CROMOSOMA 21 Pintado Cromosómico Total 21 21q21.3 Early onset Alzheimer region probe EN 21 Break Apart 21q22 [AML1(RUNX1)] Doble Fusión t(12;21)(p13;q22)[etv6/aml1(runx1)] Doble Fusión t(8;21)(q21;q22)

Más detalles

La división celular. .Interfase

La división celular. .Interfase .Interfase La división celular El conjunto de procesos propios de la interfase hacen posible el mantenimiento o el incremento de las estructuras celulares, lo que conlleva, en principio, un incremento

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/

Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ 4º E.S.O. Biología y Geología - Unidad 5.- La herencia biológica Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ Alumno/a... Fecha... 1.- Completa: Todos los seres vivos tienen

Más detalles

Clase Teórico-Práctica N 1. Cromatina y cromosomas

Clase Teórico-Práctica N 1. Cromatina y cromosomas 1 Clase Teórico-Práctica N 1 Tema: Ácidos nucléicos. Estructura. Cromatina. Cromosomas. Tipos de secuencias y su organización en el genoma. Cariotipo. Objetivos: Repasar y profundizar los conocimientos

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

Catálogo de Servicios GenXPro

Catálogo de Servicios GenXPro Catálogo de Servicios GenXPro Aplicando las mejores y más sensibles técnicas de preparación de muestras, en combinación con las técnicas más modernas de secuenciación de última generación, GenXPro ofrece

Más detalles

COPIA NO VÁLIDA PARA TRÁMITE

COPIA NO VÁLIDA PARA TRÁMITE PÁGINA: 1 de 6 FACULTAD DE: CIENCIAS BASICAS PROGRAMA DE: BIOLOGIA PLANEACIÓN DEL CONTENIDO DE CURSO 1. IDENTIFICACIÓN DEL CURSO NOMBRE : Biología Molecular CODIGO : 20116 SEMESTRE : SEXTO INTENSIDAD HORARIA

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

CICLO 2 : Fraccionamiento subcelular

CICLO 2 : Fraccionamiento subcelular Curso de Fisicoquímica Biológica 2006 Licenciatura de Bioquímica. Facultad de Ciencias. CICLO 2 : Fraccionamiento subcelular OBJETIVOS GENERALES: 1) Obtención de preparados enriquecidos en fracciones subcelulares

Más detalles

Estructura Genoma Procariota. Estructura Genoma Eucariota

Estructura Genoma Procariota. Estructura Genoma Eucariota Estructura Genoma Procariota Organización compacta (poco espacio entre genes) Información adicional en plásmidos DNA no codificante en pequeños segmentos dispersos en el genoma (

Más detalles

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO

Técnicas de Biología Molecular. Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO Técnicas de Biología Molecular Dr. Luis Salazar N Depto. de Ciencias Básicas / UFRO 2004 Extracción de ácidos nucleicos o o DNA RNA Tipos de Muestras Sangre total (EDTA) Saliva Líquido Amniótico Bulbo

Más detalles

Congreso Nacional del Laboratorio Clínico 2014

Congreso Nacional del Laboratorio Clínico 2014 Técnicas de Citogenética en diagnóstico prenatal: cariotipo, FISH, QF-PCR y arrays CGH. Cristina Torreira Análisis Clínicos Xerencia de Xestión Integrada de Vigo Comisión de Genética de la SEQC Índice

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

IES Pando Departamento de Biología y Geología 1

IES Pando Departamento de Biología y Geología 1 IES Pando Departamento de Biología y Geología 1 2 Células en diversos estadios del ciclo celular en la raíz de ajo. 3 Diversos aspectos del núcleo durante el ciclo celular Ciclo celular 4 Repartición del

Más detalles

TEMA 3. ESTRUCTURA Y EVOLUCIÓN DEL GENOMA EUCARIOTA

TEMA 3. ESTRUCTURA Y EVOLUCIÓN DEL GENOMA EUCARIOTA TEMA 3. ESTRUCTURA Y EVOLUCIÓN DEL GENOMA EUCARIOTA Genes y genomas. Estructura del genoma eucariota. Genómica comparada. Evolución del tamaño, del número y de la complejidad de los genes. Origen y evolución

Más detalles

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares MSc. Juan Agapito Panta Laboratorio de Genómica y Biología Molecular Instituto Peruano de Energía Nuclear

Más detalles

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR. RESUMEN Las repeticiones

Más detalles

TEMA 10: CICLO Y DIVISIÓN CELULARES

TEMA 10: CICLO Y DIVISIÓN CELULARES 1. El ciclo celular en las células eucariotas TEMA 10: CICLO Y DIVISIÓN CELULARES La reproducción es el mecanismo mediante el cual se perpetúan las especies y la vida. La reproducción celular consiste

Más detalles

Definición: cariotipo y características

Definición: cariotipo y características Prof. Oswaldo Javier Loreto Marzo 2014 Definición: cariotipo y características El cariotipo es el ordenamiento de los cromosomas de una célula metafásica de acuerdo a su morfología, tales como el tamaño,

Más detalles

OBTENCIÓN DE MUTANTES

OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles

Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012

Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012 Avances de la investigación en la Amazonía Iquitos, 12 y 13 de diciembre del 2012 NOMBRE DE LA INVESTIGACIÓN ANÁLISIS DE DIVERSIDAD GENÉTICA DE UNA COLECCIÓN DE AGUAJE DE Mauritia flexuosa (Aracaceae:

Más detalles

ELECTROFORESIS. Agarosa. Poliacrilamida

ELECTROFORESIS. Agarosa. Poliacrilamida ELECTROFORESIS DE ADN ELECTROFORESIS Agarosa Poliacrilamida Finalidad de la electroforesis Separar Identificar Purificar 1 2 3 4 5 Tinción del ADN Bromuro de etidio Absorbancia a 302 y 366 y emisión a

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Biología Celular y Molecular. Guía de TP Nro. 3. Ensayos de proliferación, adhesión y migración celular in vitro.

Biología Celular y Molecular. Guía de TP Nro. 3. Ensayos de proliferación, adhesión y migración celular in vitro. Biología Celular y Molecular. Guía de TP Nro. 3 Ensayos de proliferación, adhesión y migración celular in vitro. Introducción La valoración de la proliferación celular y la citotoxicidad in vitro es, muchas

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas

Grado en Química. 4º Curso Bioquímica. Guión de Prácticas Grado en Química 4º Curso Bioquímica Guión de Prácticas UTILES A TRAER POR EL ALUMNO Bata Gafas de Seguridad Cuaderno de Laboratorio NORMAS DE TRABAJO Antes de empezar Antes de empezar cada práctica, el

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus

7/13/2009. Breve introducción a la biología molecular y sus aplicaciones. Victoria koala. Queensland koala. Morfología vs. ADN? Phascolarctus cinereus Morfología vs. ADN? Phascolarctus cinereus Queensland koala Victoria koala New South Wales koala 3 subespecies Morfológicamente: Diferencias en tamaño y color principalmente Molecularmente: Un grupo dividido

Más detalles

Capítulo 1. La célula Dra. Millie L. González ISBN-13: 978-0321689634 ISBN-10: 0321689631. 8va edición

Capítulo 1. La célula Dra. Millie L. González ISBN-13: 978-0321689634 ISBN-10: 0321689631. 8va edición Capítulo 1 La célula Dra. Millie L. González ISBN-13: 978-0321689634 ISBN-10: 0321689631 8va edición Lectures by Kathleen Fitzpatrick Simon Fraser University Actividad de aprendizaje activo Grupos QUE

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD)

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) Las alteraciones genéticas son una importante causa de esterilidad e infertilidad y pueden ser responsables de algunos defectos congénitos. Estas alteraciones

Más detalles

CAPÍTULO 13 DIVISIÓN CELULAR

CAPÍTULO 13 DIVISIÓN CELULAR DIVISIÓN CELULAR 1. FISIÓN BINARIA Ocurre en procariontes: tras la duplicación del ADN, se segregan las moléculas hijas y se divide el citoplasma. Bacteria en Fisión Binaria Esquema de la Fisión Binaria

Más detalles

CAPÍTULO 3: ANÁLISIS DE MARCADORES MICROSATÉLITES SELECCIÓN DE MARCADORES

CAPÍTULO 3: ANÁLISIS DE MARCADORES MICROSATÉLITES SELECCIÓN DE MARCADORES CAPÍTULO 3: ANÁLISIS DE MARCADORES MICROSATÉLITES SELECCIÓN DE MARCADORES Todo nuestro trabajo basado en el análisis de microsatélites se realizó con un panel de 8 de los 29 microsatélites descritos en

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS

PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

Familia multigénica: Dos o más loci con secuencias nucleotídicas similares que han derivado de una secuencia ancestral común

Familia multigénica: Dos o más loci con secuencias nucleotídicas similares que han derivado de una secuencia ancestral común Curso de 2015 Facultad de Ciencias Montevideo, Uruguay http://evolucion.fcien.edu.uy/ http://eva.universidad.edu.uy/ 10. de familias multigénicas. Concepto y generalidades. Familia multigénica: Dos o más

Más detalles

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3)

Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) Generalidades de la PCR: MÉTODO DE DIAGNÓSTICO MOLECULAR DE Foc RT4 Miguel Dita (1) Einar Martínez de la Parte (2) Monica Blanco (3) 1) Bioversity International, Costa Rica 2) INISAV Cuba. 3) Universidad

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge

FISIOLOGÍA GENERAL Jesús Merino Pérez y María José Noriega Borge REPLICACIÓN DEL ADN INTRODUCCIÓN La unidad básica de información en los seres vivos es el gen, definido en células eucariotas como un segmento de ADN que lleva la información necesaria para la síntesis

Más detalles

Tecnologías basadas en el ADN

Tecnologías basadas en el ADN Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Fundamentos del ADN Derechos de Autor: IPGRI y Cornell University,

Más detalles

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN

ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Universidad Centroccidental Lisandro Alvarado Decanato de Ciencias de la Salud ACTIVIDAD PRACTICA No. 8 BIOLOGIA CELULAR EXTRACCIÓN DE ADN Octubre 2009 INTRODUCCION La molécula de ADN (que es la que se

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

Tema 3. Variaciones cromosómicas estructurales y numéricas

Tema 3. Variaciones cromosómicas estructurales y numéricas Tema 3. Variaciones cromosómicas estructurales y numéricas Genética CC. Mar 2005-06 Objetivos Entender la naturaleza y consecuencias de la rotura y reunión cromosómica. Entender la naturaleza y consecuencias

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Regeneración in vitro

Regeneración in vitro Regeneración in vitro A. K. Neelakandan K. Wang (2012) Recent progress in the understanding of @ssue culture- induced genome level changes in plants and poten@al applica@ons.plant Cell Rep 31:597 620 Variación

Más detalles

Marcadores moleculares (MM)

Marcadores moleculares (MM) Marcadores moleculares (MM) Un marcador genético o marcador molecular es un segmento de ADN situado en un lugar específico del genoma (locus) y cuya herencia genética se puede rastrear. Puede ser un gen

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo:

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo: Página 1 de 1 1. Titulo: Electroforesis de DNA 2. Objetivo Conocer los principios básicos de la electroforesis horizontal en geles de agarosa y aplicarlo para la separación de DNA humano, plasmídico, recombinante

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado TIPIFICACION HLA Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado Tipificación HLA: Estudio mediante el cual se determina cuales de todas las variantes conocidas del locus HLA están presentes

Más detalles