ES A1 C12Q 1/68 ( ) OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "ES 2 304 832 A1 C12Q 1/68 (2006.01) OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación: 2 304 832"

Transcripción

1 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: Número de solicitud: Int. Cl.: C12Q 1/68 (06.01) 12 SOLICITUD DE PATENTE A1 22 Fecha de presentación: Fecha de publicación de la solicitud: Solicitante/s: Consejo Superior de Investigaciones Científicas c/ Serrano, Madrid, ES 72 Inventor/es: Zimmermann, Johannes; González Grau, Juan Miguel y Sáiz Jiménez, Cesáreo 43 Fecha de publicación del folleto de la solicitud: Agente: No consta 4 Título: Oligonucleótidos dirigidos al gen ARN ribosómico 23S de Acidobacterias y su utilización. 7 Resumen: Oligonucleótidos dirigidos al gen ARN ribosómico 23S de Acidobacterias y su utilización. La detección rápida de bacterias es esencial para determinar su papel en los distintos procesos, tanto de organismos beneficiosos como perjudiciales. El objeto de esta invención es el diseño de secuencias características que permiten identificar las Acidobacterias y los subgrupos a los que pertenecen de forma rápida y eficaz. La identificación de esta división bacteriana se ha llevado a cabo en base a secuencias previamente desconocidas del gen 23S del RNA ribosómico de Acidobacterias. Esos oligonucleótidos pueden ser utilizados para preparar cebadores (primers) para su uso en reacciones de amplificación de ADN, como sondas de ácidos nucleicos, o para su uso en arrays de ADN/ARN. La detección de las Acidobacterias y la diferenciación de sus subgrupos es de aplicación en muestras de diversos tipos, preferentemente, en muestras ambientales, biológicas y/o médicas. ES A1 Venta de fascículos: Oficina Española de Patentes y Marcas. Pº de la Castellana, Madrid

2 DESCRIPCIÓN Oligonucleótidos dirigidos al gen ARN ribosómico 23S de Acidobacterias y su utilización Sector de la técnica El sector principal de aplicación es la biotecnología en aquellos campos que requieran la detección de Acidobacterias tanto cultivadas como no cultivadas. Entre los campos de aplicación figuran la conservación de obras y objetos de arte, estudios biogeoquímicos y trabajos in situ sobre cualquier tipo de muestras. Estado de la técnica Hoy en día, los microorganismos pueden ser identificados sin necesidad de ser cultivados utilizando técnicas moleculares como la amplificación por PCR ( Polymerase Chain Reaction ) y secuenciación, Fluorescent In Situ Hybridization (FISH) o hibridación in situ con sondas de ADN marcadas fluorescentemente, o con el empleo de microarrays de ADN. Estas técnicas requieren el uso de oligonucleótidos o sondas específicas diseñadas para detectar genes determinados. Uno de los genes o fragmentos de ADN más utilizados con este fin es el del ARN ribosómico 16S ya que el número de copias por célula de este gen es más elevado que el de otras secuencias. Los procedimientos de PCR y FISH son habituales en laboratorios de biología molecular. Ambos requieren el uso de oligonucleótidos que constan de una secuencia de unos 1- nucleótidos de longitud. En el caso de sondas de ADN, estos oligonucleótidos son marcados, generalmente, en su lado terminal con un colorante fluorescente o radioisótopos. Estos oligonucleótidos, también llamados primers o cebadores, en la reacción PCR sirven para amplificar el gen o fragmento de ADN de interés. Una reacción positiva indicaría la presencia de microorganismos del tipo buscado. El procedimiento FISH permite una rápida detección con la utilización de sondas de ADN marcadas fluorescentemente, permitiendo la rápida detección de células determinadas in situ (De Long et al. 1989). El uso de microarrays se está extendiendo en los últimos años ya que permite la utilización de numerosos oligonucleótidos simultáneamente dirigidos a la detección de diversos grupos microbianos o genes sobre un mismo portaobjetos o membrana (Peplies et al. 03). Estas técnicas constituyen los métodos más importantes que tenemos disponibles hoy en día para la detección de microorganismos no cultivables en ambientes naturales (Amann et al. 01) y en muestras médicas (Moter y Gbbel 00). Se han publicado muchos primers generales para microorganismos y para algunos grupos específicos así como sondas oligonucleotídicas para el rrna (Loy et al. 03). Las Acidobacterias constituyen una División bacteriana hasta hoy constituida por tan solo tres especies cultivadas Acidobacterium, Holophaga y Geothrix. Sin embargo, recientemente, se ha descubierto la existencia de mayor número de Acidobacterias utilizando métodos moleculares basados en secuencias del gen 16S rrna obtenidas por PCR. Se sabe que las Acidobacterias constituyen una fracción altamente significativa de la comunidad microbiana presente en suelos y monumentos, pueden alcanzar el 2% de presencia en muestras de cuevas, por ejemplo. Su papel en la biogeoquímica de estos ecosistemas, dada su elevada presencia, es sin duda de gran importancia. Esta abundancia justifica la necesidad de conocer con mayor detalle dichas acidobacterias para lo cual es preciso su previa identificación. Dado el interés por descubrir y comprender el papel de las Acidobacterias y sus implicaciones en los ecosistemas donde se desarrollan, se hace necesaria la existencia de una metodología capaz de detectar estos microorganismos de la manera más fiable y precisa posible. Las Acidobacterias descubiertas hasta ahora, mediante técnicas moleculares basadas en los genes de ARN ribosómico 16S, han sido clasificadas en ocho (8) subgrupos (Hugenholtz et al. 1998), siendo los correspondientes a las especies cultivadas los subgrupos número 1 y 8. Estos 8 subgrupos pueden caracterizarse en el gen ARN ribosómico 16S por las siguientes secuencias, con los números de acceso dados (GenBank, subgrupo 1, D26171; subgrupo 3, AF0131; subgrupo 4-I, U68644; subgrupo 4-II, AF013; subgrupo 4-III, AF013; subgrupo, Z9707; subgrupo 6, Z9733; subgrupo 7-I, Z9729; subgrupo 7-II, Z9713; subgrupo 8, U4163. Trabajos posteriores llevados a cabo por nuestro grupo (con 16S y 23S) han dado lugar al descubrimiento de nuevas secuencias que al ser clasificadas en base a su distancia filogenética no pertenecen a ninguno de los 8 subgrupos diferenciados con el 16S, indicando la existencia de nuevos subgrupos distintos. El gen de ARN ribosómico 23S es de mayor longitud (unas 00 bases) que el ARN ribosómico 16S (unas 0 bases). Tanto el gen 16S como el 23S de ARN ribosómico se encuentran en todas las bacterias y ambos reflejan fielmente la filogenia microbiana. El gen de ARN ribosómico 23S presenta zonas con gran variabilidad entre microorganismos distintos mientras que las diferencias encontradas entre genes ARN ribosómicos 16S son menores debido a su menor tamaño. El gen 23S ARN ribosómico ofrece por tanto más posibilidades para la diferenciación de microorganismos distintos y mayores opciones para el diseño de oligonucleotidos específicos para la detección de microorganismos determinados y, concretamente, para el análisis de la diversidad microbiana. En contrapartida, el trabajo de secuencia- 2

3 ción del 16S es más fácil que el del 23S por ser aquel más corto y esta es la razón por la que hasta el momento el gen ARN ribosómico 16S sea el gen más utilizado. En la presente invención se han diseñado primers y sondas que permiten la detección del gen ARN ribosómico 23S de las Acidobacterias. Referencias Amann R, Fuchs BM, Behrens S. 01. The identification of microorganisms by fluorescence in situ hybridisation. Curr Opin Biotechnol 12: DeLong EF, Wickham GS, Pace NR Phylogenetic stains: ribosomal RNA based probes for the identification of single cells. Science 243: Hugenholtz, P., Goebel, B.M., and Pace, N.R Impact of Culture-Independent Studies on the Emerging Phylogenetic View of Bacterial Diversity. J Bacteriol 180: Loy A, Horn M, Wagner M. 03. ProbeBase: an online resource for rrna-targeted oligonucleotide probes. Nucleic Acids Res 31: Moter A, Gdbel UB. 00. Fluorescence in situ hybridization (FISH) for direct visualization of microorganisms. J Microbiol Methods 41: Peplies J, Glockner F0, Amann R. 03. Optimization strategies for DNA microarray-based detection of bacteria with 16S rrna-targeting oligonucleotide probes. Appl Environ Microbiol. 69: Zimmermann, J., W. Ludwig, K.-H. Schleifer. 01. DNA polynucleotide probes generated from representatives of the genus Acinetobacter and their application in fluorescence in situ hybridization of environmental samples. System. Appl. Microbiol. 24: Breve descripción Tal como se ha mencionado previamente se hace necesaria una tecnología capaz de detectar a los microorganismos pertenecientes al grupo de las Acidobacterias, de la manera más rápida, fiable y precisa posible, y a su vez distinguirlas de otros microorganismos. La presente invención se refiere a la detección de Acidobacterias, utilizando secuencias de nucleótidos como sondas o primers (cebadores), y su aplicación en búsquedas de presencia, cuantificación y/o identificación de Acidobacterias. 4 0 La presente invención describe una sonda y oligonucleótido de ADN específico diseñado para la detección de las Acidobacterias basándose en el gen ARN ribosómico 23S; más concretamente, utilizando el oligonucleótido propuesto ACIPHY631 en la presente invención que es específico para Acidobacterias, o su complementario. Constituye, por tanto, un objeto de la presente invención una secuencia aislada de nucleótidos útil para la detección, cuantificación y/o identificación de Acidobacterias que comprende la secuencia complementaria inversa a una secuencia parcial del gen ARN ribosómico 23S de Acidobacterias de ACIPHY631 o su complementaria, en adelante la secuencia. Asimismo, constituye otro objeto de la presente invención un kit de detección, cuantificación y/o identificación de Acidobacterias caracterizado porque comprende la secuencia o sonda mencionada anteriormente. El método de detección, cuantificación, e identificación de Acidobacterias que utiliza al menos la secuencia, o sonda, o un kit de los mencionados anteriormente, constituye igualmente un objeto de la invención. La presente invención presenta el diseño de una secuencia de oligonucleótidos para la detección bien como primer o sonda de Acidobacterias en aplicaciones como por ejemplo, pero no restringido a, la amplificación por PCR, FISH, microarrays de ADN o reacciones de transcripción inversa a partir de ARN, así como el empleo de esos oligonucleótidos como reactivo o método para la detección de Acidobacterias. Estos oligonucleótidos van dirigidos a detectar específicamente las Acidobacterias utilizando secuencias únicas del gen de ARN ribosómico 23S de estos microorganismos. La utilización de estos oligonucleótidos permite la detección rápida de Acidobacterias sin necesidad de cultivar estos microorganismos con la utilización de técnicas moleculares (PCR, FISH, microarrays). 6 Otro aspecto de la presente invención se relaciona con la utilización de la secuencia, o sonda, o kits, objetos de la presente invención, en la detección, identificación y/o cuantificación de Acidobacterias en cualquier tipo de muestras, preferentemente en muestras ambientales, biológicas y/o médicas. 3

4 Descripción de las figuras Figura Análisis electroforético en gel de agarosa que muestra los productos de PCR obtenidos con la utilización del primer propuesto ACIPHY631 (reverse) y el primer universal 616 (forward). La detección positiva de acidobacterias se comprueba rápidamente por la presencia de producto ( muestra positiva ) y su ausencia denota la ausencia de acidobacterias ( muestra negativa ) en otra muestra analizada. Se presenta el resultado de un gradiente de temperatura de hibridación de los primers al ADN molde durante la PCR (desde 3 hasta 62.3ºC) para cada muestra. Figura 2 Microfotografías mostrando la detección de Acidobacterias. La técnica utilizada es FISH con la sonda de ADN propuesta ACIPHY631. A, fotografía utilizando luz de excitación verde con el colorante Cy3 unido a la sonda mencionada que muestra la presencia de los filamentos correspondientes a Acidobacterias. B, fotografía utilizando luz de excitación azul y el colorante SYBR Green I que tiñe inespecíficamente ADN mostrando todas las bacterias presentes en la muestra. C, fotografía en contraste de fases de la misma muestra de A y B. Las flechas indican las células de Acidobacteria a las que se dirigía la sonda. Descripción detallada de la invención Un objeto de la presente invención una secuencia aislada de nucleótidos útil para la detección, cuantificación y/o identificación de Acidobacterias que comprende la secuencia complementaria inversa a una secuencia parcial del gen ARN ribosómico 23S de Acidobacterias de ACIPHY631 o su complementaria, en adelante la secuencia. La invención se relaciona con el diseño de una secuencia de oligonucleótidos dirigida a detectar específicamente las Acidobacterias en cualquier tipo de muestra. Este oligonucleótido utiliza una secuencia única del gen ARN ribosómico 23S de estos microorganismos y puede ser empleada como primers para la amplificación de fragmentos del gen ARN ribosómico 23S de las Acidobacterias (por PCR o cualquier otro método de amplificación de ácidos nucleicos), como sonda de ADN para análisis por FISH, o microarrays de ADN. Tras realizar análisis exhaustivos de las secuencias conocidas y otras obtenidas durante los experimentos, se ha observado que la utilización del gen de ARN ribosómico 23S proporciona una secuencia de mayor longitud que la del gen ARN ribosómico 16S y existe un gran número de posiciones en esta secuencia que ofrecen gran interés para el diseño de sondas de hibridación y oligómeros o primers para su amplificación. Estas secuencias han sido utilizadas para el diseño de primers que permiten la amplificación de fragmentos del gen de ARN ribosómico 23S de Acidobacterias y de sondas de ADN que marcadas con colorantes fluorescentes sirven para la rápida detección de Acidobacterias en cualquier tipo de muestras. Constituye por tanto otro objeto de la presente invención, una sonda de ácido nucleico que comprende la secuencia mencionada anteriormente. Utilizando la secuencia y sonda propuesta en la presente invención se puede detectar y distinguir cualquier Acidobacteria entre un grupo de microorganismos. TABLA 1 Secuencia de oligonucleótidos propuesta y localización en el gen ARN ribosómico 23S de Acidobacterium capsulatum 6 Constituye, asimismo, otro objeto de la presente invención un kit de detección, cuantificación y/o identificación de Acidobacterias caracterizado porque comprende la secuencia o sonda de mencionada anteriormente. Otro objeto de la invención lo constituye un método de detección, cuantificación, e identificación de Acidobacterias en el que se utiliza la secuencia, o una sonda, o un kit mencionado anteriormente. 4

5 Otro aspecto de la presente invención se relaciona con la utilización de la secuencia, o sonda, o kit, objeto de la presente invención, en la detección, identificación y/o cuantificación de Acidobacterias en cualquier tipo de muestras, preferentemente en muestras ambientales, biológicas y/o médicas. Ejemplo de realización de la invención Ejemplo Detección de la presencia de Acidobacterias tras amplificación por PCR de fragmentos del gen ARN ribosómico 23S a partir de muestras ambientales Una muestra de la pared de la cueva de Altamira se recogió en un tubo de 1. ml estéril. La muestra se congeló hasta su posterior análisis. Se extrajo el ADN con el kit dé extracción Nucleospin food (Macherey-Nagel, Alemania). Un microlitro de la solución de ADN se utilizó en una reacción de PCR siguiendo el procedimiento estandard. Se utilizó la taq ADN polimerasa Extaq (Takara) y las condiciones recomendadas para esta enzima en su manual de utilización. Los primers utilizados fueron el oligonucleótido propuesto ACIPHY631 en la presente invención (Tabla 1) específico para Acidobacterias y el primer universal 616F ( - AGA GTT TGA TYM TGG CTC AG). Se ensayaron una muestra positiva (con Acidobacterias) y otra negativa (sin Acidobacterias). Los productos de amplificación se observaron en geles de agarosa (1.% agarosa en TAE 0.x) siguiendo procedimientos establecidos en laboratorios de Biología Molecular. Los resultados se muestran en la Figura 1. Se observa que la presencia de Acidobacterias se revela por la obtención de un producto de PCR del tamaño esperado (muestra positiva) mientras que la ausencia de Acidobacterias (o presencia por debajo del nivel de detección) resulta en la ausencia de producto de amplificación y por tanto en la ausencia de la banda esperada (muestra negativa) en el gel de agarosa. Así, queda demostrada la utilidad del oligonucleótido propuesto en la detección de Acidobacterias. Ejemplo 2 Detección de Acidobacterias por FISH utilizando el oligonucleótido propuesto como sonda de ADN 3 4 Una muestra de la pared de la cueva de Altamira se recogió en un tubo de 1. ml estéril. La muestra se suspendió en paraformaldehido (PFA) al 4% y se mantuvo a 4ºC durante 4 horas. Se centrifugó a.000 x g durante minutos, se retiró el sobrenadante y se suspendió en solución de PBS (Phosphate Buffered Solution). El PBS se eliminó tras centrifugación, la muestra se resuspendió nuevamente en PBS y se almacenó a -ºC hasta que fue hibridada a las sondas fluorescentes. La preparación de la muestra sobre un portaobjetos y su hibridación con una sonda de ADN marcada fluorescentemente se realizó tal y como lo describió Zimmermann et al. (01) siguiendo el protocolo estandard para FISH. La astringencia idónea para cada sonda de ADN se obtuvo tras comparar el mismo procedimiento llevado a cabo a distintas concentraciones de formamida tal y como ha sido previamente descrito (por ejemplo, Zimmermann et al. 01). La observación de las muestras hibridadas se realizó con un microscopio de epifluorescencia Zeiss Axiophot. La sonda diseñada fue sintetizada con el marcaje fluorescente Cy3 por Thermos Corporation (Alemania). La secuencia de nucleótidos correspondiente a la sonda utilizada (ACIPHY631) se muestra en la Tabla 1. Este ejemplo demuestra que con la sonda utilizada podemos detectar Acidobacterias in situ por microscopía. 0 6

6 REIVINDICACIONES Secuencia aislada de nucleótidos útil para la detección, cuantificación y/o identificación de Acidobacterias caracterizada porque comprende la secuencia complementaria inversa a una secuencia parcial del gen ARN ribosómico 23S de Acidobacterias de SEQ ACIPHY631 (SEQ.ID.NO1) o su complementaria. 2. Sonda de ácido nucleico útil para la detección, cuantificación y/o identificación de Acidobacterias caracterizada porque comprende al menos una secuencia de nucleótidos según la reivindicación Kit útil para la detección, cuantificación y/o identificación de Acidobacterias caracterizado porque comprende al menos una secuencia según la reivindicación Kit de detección, cuantificación y/o identificación de Acidobacterias caracterizado porque comprende al menos una sonda según la reivindicación 2.. Método de detección, cuantificación, e identificación de Acidobacterias caracterizado porque utiliza al menos una secuencia según la reivindicación 1, o una sonda según la reivindicación 2, o un kit según las reivindicaciones 3 y Utilización de una o más secuencias según la reivindicación 1 como cebador o primer, para la amplificación, secuenciación y/o hibridación de secuencias de Acidobacterias. 7. Utilización de una o más secuencias según la reivindicación 1 como cebador o primer, en reacciones de PCR u otras reacciones de amplificación, FISH, micro y macroarrays. 8. Utilización de una o más secuencias según la reivindicación 1 para la detección, identificación y/o cuantificación de Acidobacterias en cualquier tipo de muestras. 9. Utilización de una o más sondas o cebadores (primers) según la reivindicación 2 para la detección y/o cuantificación de Acidobacterias.. Utilización de un kit según las reivindicaciones 3 y 4 para la detección, cuantificación y/o la identificación precisa de Acidobacterias. 11. Utilización de un kit según las reivindicaciones 3 y 4 caracterizada porque la detección, cuantificación y/o identificación de Acidobacterias se lleva a cabo en muestras ambientales, biológicas y/o médicas

7 7

8 8

9 <1> Consejo Superior de Investigacines Científicas LISTA DE SECUENCIAS <1> OLIGONUCLEÓTIDOS DIRIGIDOS AL ARN RIBOSÓMICO 23S DE ACIDOBACTERIAS. SU UTILI- ZACIÓN COMO PRIMER O SONDA EN PROCEDIMIENTOS DE DETECCIÓN <1> oligonucleótidos de Acidobacterias ARN ribosómico 23S <1> 22 1 <170> PatentIn version 3.1 <2> 1 <211> 18 <212> DNA <213> División Acidobacteria <0> 1 2 aactagccrg ctcattat

10 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 ES Nº de solicitud: Fecha de presentación de la solicitud: Fecha de prioridad: INFORME SOBRE EL ESTADO DE LA TÉCNICA 1 Int. Cl.: C12Q 1/68 (06.01) DOCUMENTOS RELEVANTES Categoría Documentos citados Reivindicaciones afectadas X ZIMMERMANN, J., GONZALEZ, J. M., SAIZ-JIMENEZ, C. Detection and 1-11 phylogenetic relationships of highly diverse uncultured Acidobacerial communities in Altamira Cave using 23S rrna sequence analyses. Geomicrobiology Journal. Octubre-Noviembre 0, Vol. 22, Nº 7-8, páginas ISSN X LUDWIG, W., DORN, S., SPRINGER, N. et al. PCR-based preparation 1-11 of 23S rrna-targeted group-specific polynucleotide probes. Applied and Environmental Microbiology. Septiembre 1994, Vol., Nº 9, páginas ISSN A PANKRATOV, T. A., BELOVA, S. E., DEDYSH, S. N. Evaluation of the 1-11 phylogenetic diversity of prokaryotic microorganisms in Sphagnum peat bogs by means of fluorescence in situ hybridization (FISH). Microbiology. Noviembre 0, Vol. 74, Nº 6, páginas ISSN Categoría de los documentos citados X: de particular relevancia Y: de particular relevancia combinado con otro/s de la misma categoría A: refleja el estado de la técnica El presente informe ha sido realizado para todas las reivindicaciones O: referido a divulgación no escrita P: publicado entre la fecha de prioridad y la de presentación de la solicitud E: documento anterior, pero publicado después de la fecha de presentación de la solicitud para las reivindicaciones nº: Fecha de realización del informe Examinador Página E. Relaño Reyes 1/1

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

APLICADAS A LA ECOLOGÍA MICROBIANA

APLICADAS A LA ECOLOGÍA MICROBIANA TÉCNICAS MOLECULARES APLICADAS A LA ECOLOGÍA MICROBIANA Áreas de estudio tradicionales en la Ecología Microbiana: - Estudio de la diversidad microbiana, incluye aislamiento, identificación y cuantificación

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

La Biología Molecular Aplicada a la detección de patógenos en alimentos

La Biología Molecular Aplicada a la detección de patógenos en alimentos La Biología Molecular Aplicada a la detección de patógenos en alimentos La detección fiable y rápida de microorganismos patógenos en el mercado alimentario es de especial importancia no sólo por sus efectos

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón

Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Diagnóstico Virológico PCR y pruebas rápidas: Gripe A. Carlos Artaza Alvarez MIR 4 Hospital Universitario Fundación Alcorcón Reacción en Cadena de la INTRODUCCION: Polimerasa (RCP) Década de los 70: Grandes

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

ES 2 357 821 A1 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación: 2 357 821. 21 Número de solicitud: 200930425

ES 2 357 821 A1 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA. 11 Número de publicación: 2 357 821. 21 Número de solicitud: 200930425 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 37 821 21 Número de solicitud: 0942 1 Int. Cl.: C12Q 1/68 (06.01) 12 SOLICITUD DE PATENTE A1 22 Fecha de presentación: 07.07.09

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada

La PCR. La Reacción en Cadena de la Polimerasa es la herramienta más utilizada La PCR La Reacción en Cadena de la Polimerasa es la herramienta más utilizada PCR- Ventajas y Usos Amplificación ilimitada de secuencias de interés. Rápida, Sencilla y Eficaz. Técnica altamente sensible

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

TÉCNICAS MOLECULARES DE DETECCIÓN DE PATÓGENOS Y DE SUS FACTORES DE VIRULENCIA

TÉCNICAS MOLECULARES DE DETECCIÓN DE PATÓGENOS Y DE SUS FACTORES DE VIRULENCIA TÉCNICAS MOLECULARES DE DETECCIÓN DE PATÓGENOS Y DE SUS FACTORES DE VIRULENCIA TÉCNICAS MOLECULARES:VENTAJAS 1- RAPIDEZ 2- SENSIBILIDAD 3- NO NECESITAN MICROORGANISMO VIABLE 4- DETECTAN MICRORGANISMOS

Más detalles

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx)

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13

Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares. Técnicas Moleculares. Técnicas Moleculares 8/13/13 8/13/13 Usos de Herramientas Moleculares en Agricultura: Marcadores Moleculares CAF516 O Recursos Genéticos y Biotecnología 14 Agosto 2013 Técnicas Moleculares Aplicaciones en muchas disciplinas Generan

Más detalles

PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD PROGRAMA

PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD PROGRAMA PRINCIPIOS DE LAS INVESTIGACIONES EPIDEMIOLOGICAS Y MEDICIÓN DE EFECTO-CAUSALIDAD Curso: 25 Hrs. Asistentes: 25 Costo: $15,000 (Quince Mil Pesos 00/100 M.N) OBJETIVO: Conocer algunos conceptos básicos

Más detalles

DETECCIÓN DE ÁCIDOS NUCLEICOS Y NANOTECNOLOGÍA: EL GRAN POTENCIAL DE LOS ENSAYOS A PEQUEÑA ESCALA

DETECCIÓN DE ÁCIDOS NUCLEICOS Y NANOTECNOLOGÍA: EL GRAN POTENCIAL DE LOS ENSAYOS A PEQUEÑA ESCALA DETECCIÓN DE ÁCIDOS NUCLEICOS Y NANOTECNOLOGÍA: EL GRAN POTENCIAL DE LOS ENSAYOS A PEQUEÑA ESCALA Keith Harshman Departamento de Inmunología y Oncología Centro Nacional de Biotecnología/CSIC. Madrid INTRODUCCIÓN

Más detalles

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ

Biotina: se usa uno de los dntps biotinilado. Detección: Streptavidina conjugada con enzima (ALP) o anti-biotina. Usos: NB, SB, hibridación in situ Northern blot Marcación no radioactiva: Digoxigenina: se usa uno de los dntps marcado con digoxigenina Detección: Anticuerpo conjugado con enzima (ALP) o fluorocromo Biotina: se usa uno de los dntps

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

LAS EFICACES TÉCNICAS MOLECULARES DE IDENTIFICACIÓN Y CUANTIFICACIÓN DE LAS LEVADURAS ENOLÓGICAS

LAS EFICACES TÉCNICAS MOLECULARES DE IDENTIFICACIÓN Y CUANTIFICACIÓN DE LAS LEVADURAS ENOLÓGICAS LAS EFICACES TÉCNICAS MOLECULARES DE IDENTIFICACIÓN Y CUANTIFICACIÓN DE LAS LEVADURAS ENOLÓGICAS Antonio Palacios*; David Carrillo*; Jesús Iruzubieta*; Stéphane Boutou**; Antoine Fleury**; Dominique Labadie**

Más detalles

UNIVERSIDAD DE LOS ANDES FACULTAD DE MEDICINA INSTITUTO DE INMUNOLOGIA CLINICA HERRAMIENTAS MODERNAS PARA EL DIAGNÓSTICO

UNIVERSIDAD DE LOS ANDES FACULTAD DE MEDICINA INSTITUTO DE INMUNOLOGIA CLINICA HERRAMIENTAS MODERNAS PARA EL DIAGNÓSTICO UNIVERSIDAD DE LOS ANDES FACULTAD DE MEDICINA INSTITUTO DE INMUNOLOGIA CLINICA HERRAMIENTAS MODERNAS PARA EL DIAGNÓSTICO Dra. Haydeé Urdaneta Romero. Junio 2007 ABORDAJES DIAGNÓSTICOS IDENTIFICACIÓN MORFOLÓGICA

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS

PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago

1. Motivación. 2. Introducción. Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Universidad Técnica Federico Santa María Departamento de Informática Campus Santiago Classification of Normal and Tumor Colon Tissues Using Linear Classifiers and Microarray Data Análisis Inteligente de

Más detalles

La expresión fenotípica de las

La expresión fenotípica de las Panorama Métodos Rápidos y Automatizados Aplicados al Análisis Microbiológico de los Alimentos Rosario Martín de Santos* Se describen los métodos rápidos susceptibles de atomatización y que emplean las

Más detalles

- Clonar un gen (molde ADN o ARN)

- Clonar un gen (molde ADN o ARN) APLICACIONES PCR Aplicaciones de la PCR - Clonar un gen (molde ADN o ARN) - Secuencia conocida - Genes homólogos en especies próximas (primers degenerados) - Información de secuencia proteica (primers

Más detalles

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas

El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas El laboratorio de Microbiología y Parasitología en el diagnóstico de las enfermedades tropicales importadas Juan Carlos Rodríguez S. Microbiología Hospital General Universitario de Alicante Universidad

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

GUÍA DOCENTE 2015-2016 Técnicas de Genética Molecular para el Control de la Calidad y Seguridad Alimentarias

GUÍA DOCENTE 2015-2016 Técnicas de Genética Molecular para el Control de la Calidad y Seguridad Alimentarias GUÍA DOCENTE 2015-2016 Técnicas de Genética Molecular para el Control de la Calidad y Seguridad Alimentarias 1. Denominación de la asignatura: Técnicas de Genética Molecular para el Control de la Calidad

Más detalles

FILOGENIA BACTERIANA MEDIANTE EL ANÁLISIS DEL RRNA 16S

FILOGENIA BACTERIANA MEDIANTE EL ANÁLISIS DEL RRNA 16S FILOGENIA BACTERIANA MEDIANTE EL ANÁLISIS DEL RRNA 16S J. MAURICIO M. HERRERA CUADRA Carrera de Biología, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de México, Tlalnepantla,

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

Clonación molecular. Clonar significa hacer copias idénticas

Clonación molecular. Clonar significa hacer copias idénticas INGENIERÍA GENÉTICA Clonación molecular Clonar significa hacer copias idénticas Este término originalmente fue aplicado al procedimiento de aislar una célula y permitirle reproducirse creando una población

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

PCR Punto de No Retorno de la Biología Molecular

PCR Punto de No Retorno de la Biología Molecular TÉCNICAS DE ANÁLISIS EN BIOLOGÍA MOLECULAR CURSO DE BIOTECNOLOGÍA ELEMENTAL Biotechnology Explorer Julio 2012 PCR Punto de No Retorno de la Biología Molecular Qué es un gen Técnicas de aislamiento y estudio

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

VALIDACIÓN Y CONTROL DE CALIDAD DE LOS MÉTODOS DE REACCIÓN EN CADENA DE LA POLIMERASA UTILIZADOS PARA EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS

VALIDACIÓN Y CONTROL DE CALIDAD DE LOS MÉTODOS DE REACCIÓN EN CADENA DE LA POLIMERASA UTILIZADOS PARA EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS CAPÍTULO 1.1.3 VALIDACIÓN Y CONTROL DE CALIDAD DE LOS MÉTODOS DE REACCIÓN EN CADENA DE LA POLIMERASA UTILIZADOS PARA EL DIAGNÓSTICO DE ENFERMEDADES INFECCIOSAS RESUMEN El diagnóstico de las enfermedades

Más detalles

FORMATO 1. ASIGNATURA

FORMATO 1. ASIGNATURA FORMATO 1. ASIGNATURA Nombre de la asignatura: MCBA-0707-ITEL Técnicas Biotecnológicas de Diagnóstico Línea de investigación o trabajo: Biotecnología en Ciencia Animal - Horas prácticas - Horas trabajo

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

11 Número de publicación: 2 335 179. 21 Número de solicitud: 200802665. 51 Int. Cl.: 74 Agente: Pons Ariño, Ángel

11 Número de publicación: 2 335 179. 21 Número de solicitud: 200802665. 51 Int. Cl.: 74 Agente: Pons Ariño, Ángel 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 33 179 21 Número de solicitud: 080266 1 Int. Cl.: C12Q 1/68 (06.01) 12 PATENTE DE INVENCIÓN B1 22 Fecha de presentación: 19.09.08

Más detalles

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias.

Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Metodologías basadas en la identificación del ADN: PCR, hibridación, secuenciación y análisis de secuencias. Dra. Sonia Arduino Dep. de Clínica Estomatología Facultad de Postgrado en Ciencias de la Salud

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA

GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA Página 1 de 16 GUÍA PARA LA SECUENCIACIÓN AUTOMÁTICA DE DNA SERVICIO DE SECUENCIACIÓN-S.C.S.I.E. UNIVERSITAT DE VALÈNCIA Página 2 de 16 CONTENIDOS: 1.- Secuenciación automática de DNA 2.- Tipos de molde

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR

Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR Oferta tecnológica: Método para detectar inserciones de espaciadores en estructuras CRISPR. RESUMEN Las repeticiones

Más detalles

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares.

Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. Método de extracción de adn en nematodos para su aplicación en el diagnóstico por técnicas moleculares. INTRODUCCIÓN La determinación morfológica y morfométrica de nematodos fitopatógenos en los laboratorios

Más detalles

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain

Técnica de PCR. Beatriz Bellosillo. Servei de Patologia, Hospital del Mar, Barcelona, Spain Técnica de PCR Beatriz Bellosillo Servei de Patologia, Hospital del Mar, Barcelona, Spain Biología Molecular Estudio de los procesos que se desarrollan en los seres vivos desde un punto de vista molecular

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

CAPÍTULO III. Metodología e instrumentación de análisis celular

CAPÍTULO III. Metodología e instrumentación de análisis celular CAPÍTULO III Metodología e instrumentación de análisis celular 1.- Hemocitómetro y test de exclusión de colorante Trypan blue 2.- Citometría de flujo 3.- PCR 4.- Electroforesis en gel 5.- Secuenciación

Más detalles

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Virus del Papiloma Humano- HPV

Más detalles

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS

I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS I.S.P.I. N 9009 San Juan Bautista de La Salle INTRODUCCIÓN A LA BIOTECNOLOGÍA Y TECNOLOGÍAS ESPECÍFICAS Asignatura: Frecuencia: Docente a cargo: Destinatarios: Anual 5 horas por semana Lic. César R. Olsina

Más detalles

Estudio de microorganismos causantes de biodeterioro mediante técnicas de biología molecular en el IAPH

Estudio de microorganismos causantes de biodeterioro mediante técnicas de biología molecular en el IAPH proyectos y actuaciones Estudio de microorganismos causantes de biodeterioro mediante técnicas de biología molecular en el IAPH Víctor M. Menguiano Chaparro Laboratorio de Biología, IAPH José Román Pérez

Más detalles

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina

Detección de microorganismos patógenos en los alimentos. Prof. Dr. Luis M. Medina Detección de microorganismos patógenos en los alimentos Prof. Dr. Luis M. Medina ANÁLISIS MICROBIOLÓGICOS EN ALIMENTOS Indicadores recuento total (BAM ) enterobacteriáceas totales coliformes totales E.

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

7.012 Serie de ejercicios 5

7.012 Serie de ejercicios 5 Nombre Grupo 7.012 Serie de ejercicios 5 Pregunta 1 Al estudiar los problemas de esterilidad, usted intenta aislar un hipotético gen de conejo que explique la prolífica reproducción de estos animales.

Más detalles

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado

TIPIFICACION HLA. Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado TIPIFICACION HLA Bioq. Eliana Palomino Lab. De Histocompatibilidad Hospital Privado Tipificación HLA: Estudio mediante el cual se determina cuales de todas las variantes conocidas del locus HLA están presentes

Más detalles

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales página 2 Objetivo del Curso El objetivo del «Curso de Técnicas Experimentales en Investigación Biomédica» es proporcionar a los asistentes unas nociones básicas sobre las metodologías y tecnología habitualmente

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR

PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR PROBLEMAS MAS FRECUENTES DURANTE LA SECUENCIACIÓN NO SE PRODUCE REACCION O ESTA DECAE POCO DESPUÉS DE COMENZAR Las causas pueden ser las siguientes: No hay ADN o se encuentra en muy baja concentración.

Más detalles

Catálogo de Servicios GenXPro

Catálogo de Servicios GenXPro Catálogo de Servicios GenXPro Aplicando las mejores y más sensibles técnicas de preparación de muestras, en combinación con las técnicas más modernas de secuenciación de última generación, GenXPro ofrece

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

Soluciones de la serie de ejercicios 3 (Curso 7.012)

Soluciones de la serie de ejercicios 3 (Curso 7.012) Soluciones de la serie de ejercicios 3 (Curso 7.012) Stardate 7.012.10.4.00 Diario personal del Médico militar del USS Hackerprise Al regresar de una misión en Europa, su compañero de tripulación, Noslen,

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

CURSO ACADÉMICO 2012-2013

CURSO ACADÉMICO 2012-2013 TITULACIÓN: BIOLOGÍA CURSO ACADÉMICO 2012-2013 GENÉTICA APLICADA CÓDIGO: 200810419 Departamento de adscripción: Parasitología, ecología y Genética Área de conocimiento: Genética Ciclo:2º Curso: 4º Tipo:

Más detalles

FILTROS ELECTROPOSITIVOS Y REACCIÓN DE PCR PARA LA CONCENTRACIÓN Y DETECCIÓN SIMULTÁNEA DE VIRUS Y BACTERIAS EN AGUAS. Víctor Ramírez Angulo

FILTROS ELECTROPOSITIVOS Y REACCIÓN DE PCR PARA LA CONCENTRACIÓN Y DETECCIÓN SIMULTÁNEA DE VIRUS Y BACTERIAS EN AGUAS. Víctor Ramírez Angulo FILTROS ELECTROPOSITIVOS Y REACCIÓN DE PCR PARA LA CONCENTRACIÓN Y DETECCIÓN SIMULTÁNEA DE VIRUS Y BACTERIAS EN AGUAS Víctor Ramírez Angulo Coordinación de Tratamiento y Calidad del Agua, Instituto Mexicano

Más detalles

Veamos rápidamente el ciclo celular

Veamos rápidamente el ciclo celular Replicación del adn Veamos rápidamente el ciclo celular Fase G1: Fase de crecimiento celular. Fase G2: la célula ya duplicó su material genético, y se prepara para la mitosis. Fase M: fase de división

Más detalles

11 Número de publicación: 2 257 895. 21 Número de solicitud: 200301290. 51 Int. Cl.: 72 Inventor/es: Frade López, José María. 74 Agente: No consta

11 Número de publicación: 2 257 895. 21 Número de solicitud: 200301290. 51 Int. Cl.: 72 Inventor/es: Frade López, José María. 74 Agente: No consta 19 OFICINA ESPAÑOLA DE PATENTES Y MARCAS ESPAÑA 11 Número de publicación: 2 27 89 21 Número de solicitud: 01290 1 Int. Cl.: C12Q 1/68 (06.01) 12 PATENTE DE INVENCIÓN B1 22 Fecha de presentación:.0.03 43

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

FAQs preguntasfrecuentes

FAQs preguntasfrecuentes FAQs preguntasfrecuentes 1.- Diferencias entre el MethylDetector y el MethylCollector. ir a respuesta 2.- Se puede hacer ChipIT a partir de muestras de tejidos? ir a respuesta 3.- A veces se producen incidencias

Más detalles

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I:

OLIMPÍADA ARGENTINA DE BIOLOGÍA APEB ÁREA DE ACTUALIZACIÓN Y PERFECCIONAMIENTO EN LA ENSEÑANZA DE LA BIOLOGÍA CONTINUIDAD Y CAMBIO DE LAS ESPECIES I: MINISTERIO DE EDUCACIÓN, CIENCIA Y TECNOLOGIA UNIVERSIDAD NACIONAL DE RIO CUARTO FACULTAD DE CIENCIAS EXACTAS, FÍSICO - QUÍMICAS Y NATURALES DEPARTAMENTO DE CIENCIAS NATURALES OLIMPÍADA ARGENTINA DE BIOLOGÍA

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

PRÁCTICAS DE MICROBIOLOGIA CLINICA

PRÁCTICAS DE MICROBIOLOGIA CLINICA PRÁCTICAS DE MICROBIOLOGIA CLINICA Juan Carlos Rodríguez Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiologia-alicante.umh.es CASO CLINICO: Rubéola Evolución

Más detalles