PROTOCOLO REGISTRO DE SEMILLA PRE-INOCULADA

Tamaño: px
Comenzar la demostración a partir de la página:

Download "PROTOCOLO REGISTRO DE SEMILLA PRE-INOCULADA"

Transcripción

1 Dirección General de Servicios Agrícolas Ministerio de Ganadería, Agricultura y Pesca República Oriental del Uruguay Av. Millán 4703, Montevideo. CP Teléfono: (598) Web: PROTOCOLO REGISTRO DE SEMILLA PRE-INOCULADA 1. Determinación de rizobios viables sobre la semilla en función del tiempo. El número de rizobios sobre la semilla se determinará a tiempo 0 y cada 7 días post inoculación mientras se mantenga la carga mínima de ufc/semilla requerida para cada tipo de semilla.se utilizará la técnica de recuento de viables en placa. Tomar 90 semillas de la muestra de pre inoculado en frascos con 90 ml de solución fisiológica estéril y 360 μl de solución dispersante (Tween % p/v). Agitar durante 15 minutos en agitador de golpes. Extraer 1 ml y diluir en solución fisiológica estéril sucesivamente, hasta completar la dilución Sembrar 0.1 ml de cada dilución por triplicado y por extensión en superficie con espátula de Drygalski sobre medio YEM. El medio YEM base contiene: K 2 HPO 4, 0.5g; MgSO 4.7H 2 0, 0.2g; NaCl, 0.1g; manitol, 10g; extracto de levadura, 0.5g; FeCl 3.6H 2 0, una gota de solución al 10%; MnSO 4, una gota de solución al 10%; Rojo Congo, 5 ml.l -1 de una solución 1/400; H 2 O csp 1L, agar, 15g.l -1 ; ph 6.8. Este medio se modifica por el agregado vancomicina (1mg.l -1 ) cuando corresponda (Penna et al. 2011). Mantener las placas invertidas en estufa a 28ºC de 7 a 10 días, finalizado el período de incubación contar aquellas que presenten entre 30 y 300 colonias verificando la proporcionalidad entre diluciones y promediando los resultados de las tres repeticiones. 2. Identificación de los microorganismos. Lisado Celular Tocar con la punta de un tip estéril una colonia bacteriana aislada y resuspender en 25 µl de buffer de lisis (0.05 % NaOH, 0.25 % SDS). Incubar a 95ºC por 10 min en baño seco. Agregar 225 µl de H2O mq estéril-filtrada y centrifugar por 5 min a rpm. Conservar el sobrenadante a -20ºC.

2 El buffer de lisis se guarda a temperatura ambiente Protocolo para PCR La reacción de PCR se lleva a cabo en un volumen total de 25μl conteniendo 2,5μl buffer-pcr 10X, 0,5 μl dntps 10mM, 0,5μl MgCl2 25mM, 1,25μl Primer BOX 10 μm, 0,5 μl BSA 50 mg.ml -1, 0,2μl Dream Taq polimerasa 5U.µl -1 y 2,0μl del lisado celular. El programa utilizado para la reacción de amplificación es: desnaturalización inicial por 7 min a 94ºC, seguido de 35 ciclos de 1 min a 94ºC, 1 min a 48ºC y 5 min a 72ºC, por último se realiza un ciclo de extensión final de 15 min a 72ºC. El tiempo total del ciclado es de 5 horas aprox. Los reactivos utilizados son marca Thermo Scientific (o Fermentas). La secuencia del Primer BOX es: 5` CTACGGCAAGGCGACGCTGACG Electroforesis Los productos de amplificación obtenidos se visualizan mediante electroforesis en gel de agarosa 2% (p/v) en buffer TBE 0,5% (Tris-Ácido bórico-edta), utilizando una cuba con 35 cm de distancia entre electrodos. El marcador de peso molecular utilizado es de 100pb marca Thermo Scientific (o Fermentas). Los geles se tiñen con Goodview y se exponen a la luz UV para su visualización. El tiempo total de la electroforesis es de 3-4 horas aprox. 3. Validación de la nodulación. Número más probable (NMP) diluciones e infección en plantas. El método involucra la inoculación de diluciones crecientes de la suspensión obtenida a partir de semilla pre-inoculada. A partir de los resultados positivos o negativos se estimará el número de células viables capaces de infectar un huésped específico en condiciones controladas. Seleccionar semillas de tamaño uniforme y desinfectarlas superficialmente (Vincent, 1970). Pregerminar en placas conteniendo agar-agua al 0.8% en estufa a 28ºC. Leguminosas forrajeras: sembrar una/dos (según tamaño de semilla) semillas pregerminadas en tubos con 20 ml de medio libre de nitrógeno (Jensen, 1942) para

3 crecimiento de plantas (Vincent, 1975). Siete días posteriores a la siembra inocular las plantas con 1 ml de cada dilución por duplicado. Mantener las plantas en condiciones controladas de fotoperíodo (12h luz) y temperatura entre 18ºC/20ºC (noche /día). La lectura definitiva se realizará a las 4 semanas post-siembra. La estimación del NMP se realizará a partir de la presencia o ausencia de nódulos en la serie de diluciones estudiadas (Somasegaran y Hoben, 1985). Leguminosas de grano (soja): Sembrar una semilla pregerminada en frascos adaptados con 400 ml de solución nutritiva para crecimiento de plantas (Somasegaran y Hoben, 1985) y papel absorbente poroso como soporte (Hungría y Araujo, 1994). Inocular las plantas dos días posteriores a la siembra con 1ml de cada dilución por triplicado. Mantener las plantas en condiciones controladas de fotoperiodo (14h luz) y temperatura entre 24ºC/26ºC (noche/día). La lectura definitiva se realizará a las 4 semanas post-siembra. La estimación del NMP se realizará a partir de la presencia o ausencia de nódulos en la serie de diluciones estudiadas (Hungría y Araujo, 1994). 4. Determinación de parámetros de nodulación y producción de biomasa aérea en condiciones controladas. Leguminosas forrajeras: Determinar la producción de biomasa aérea del tratamiento pre-inoculado (PI) en cada uno de los tiempos evaluados. Sembrar tubos conteniendo 20 ml de medio libre de nitrógeno (Jensen, 1942) para crecimiento de plantas (Vincent, 1975) con una/dos semillas del tratamiento mencionado. Incluir en todos los tiempos evaluados un tratamiento con inoculación convencional (Inoc Conv) con inoculante turba (2 x10 9 UFC/g) y adherente formulado en base a metilcelulosa tratado en el momento de la siembra, un testigo (T) sin inocular y un tratamiento sin inocular con N no limitante (KNO3 0.05%). Utilizar una dosis de 200 g de inoculante cada 25 kg de semilla. Emplear un diseño completamente al azar con 10 repeticiones. Mantener las plantas en condiciones controladas de fotoperíodo (12h luz) y temperatura entre 18ºC/20ºC (noche/día). Cosechar 30 días post-siembra y evaluar producción de biomasa aérea. Secar el material vegetal en estufa a 60ºC hasta peso constante. Realizar análisis de varianza por ANOVA-1 para determinar diferencias entre las medias de los tratamientos. Leguminosas de grano (soja): Determinar parámetros de nodulación y producción de biomasa aérea del tratamiento pre-inoculado en cada una de los tiempos evaluados. Sembrar cinco semillas del tratamiento mencionado (luego raleadas a tres) en macetas

4 con 700 g de arena lavada y neutralizada estéril. Incluir en todos los tiempos evaluados un tratamiento con inoculación convencional (Inoc Conv) con inoculante turba (2 x10 9 UFC/g) y adherente formulado en base a metilcelulosa tratado en el momento de la siembra y un testigo (T) sin inocular. Utilizar una dosis de 200 g de inoculante cada 50 kg de semilla. Emplear un diseño completamente al azar con 5 repeticiones. Regar las plantas periódicamente con solución nutritiva libre de nitrógeno (Somasegaran y Hoben, 1985) y mantener en condiciones controladas de fotoperíodo (14h luz) y temperatura entre 24ºC/26ºC (noche/día). Cosechar 35 días post-siembra. Evaluar nodulación (número y peso seco de nódulos) y producción de biomasa aérea. Secar el material vegetal en estufa a 60ºC hasta peso constante. Realizar análisis de varianza por ANOVA-1 para determinar diferencias entre las medias de los tratamientos. 5. Determinación de eficiencia agronómica a campo Es la etapa final del proceso de registro, tiene por objetivo verificar los efectos declarados por el fabricante. Tecnologías de inoculación: La validación de nuevas tecnologías que involucra la sobrevivencia de las bacterias en la semilla deberán ser sometidas a ensayos de laboratorio de sobrevivencia en semilla de acuerdo con la metodología antes descrita. El tiempo de sobrevivencia post-inoculación otorgado con pruebas de laboratorio deberá ser comparada en campo con un tratamiento testigo inoculado el mismo día de la siembra, para proteger a la bacteria de factores estresantes. Podrán ser realizados por terceras instituciones públicas o privadas. Este Departamento fiscalizará la instalación de los ensayos, realizará los muestreos correspondientes y evaluará la información presentada a los efectos del registro. Consideraciones: Se deben tener en cuenta las siguientes consideraciones: a) vehículo utilizado en la formulación del inoculante, b) agregado de aditivos o adyuvantes para eficiencia de adhesión del inoculante a la semilla, c) cuidados especiales luego de la preparación de la semilla inoculada durante la fase de pre-siembra (evitar exposición al sol, contacto con agrotóxicos, garantizar condiciones adecuadas de almacenamiento). Diseño experimental.- Los ensayos seguirán un diseño de bloques al azar con 4 repeticiones en parcelas o en líneas según el caso. Se tomarán recaudos respecto a contaminación y muestreos destructivos

5 Se instalaran como mínimo 2 ensayos a campo en suelos representativos de diferentes áreas agroecológicas, Se respetará el marco agronómico de la leguminosa considerada. Se pondrá especial atención a la presencia y características de las poblaciones nativas o naturalizadas de rizobios. Tratamientos.- Los ensayos tendrán controles sin inocular con y sin el agregado de N mineral no limitante, y controles activos con inoculante base turba formulado con las cepas recomendadas y aplicado de acuerdo a las recomendaciones de este Dpto, además del tratamiento con la tecnología a registrar. Parámetros a evaluar.- Población nativa o naturalizada de Caracterización química y física del suelo rizobios en suelo. a- Leguminosas de grano: Nodulación: Colectar 5 plantas por parcela con las raíces intactas inmediatamente antes de la floración (en caso de soja a los días pos emergencia) en las líneas centrales en las cabeceras de las parcelas: determinar número de nódulos por planta (no/planta) y Masa seca de nódulos por planta (mg/planta). Rendimiento de Grano: La recolección de granos se realizará en las 4 líneas centrales de cada parcela, descartándose un metro de cada cabecera. El rendimiento de granos debe ser corregido para 13% de humedad y expresado en kg/ha. b- Leguminosas forrajeras: Nodulación: Colectar 20 plantas por tratamiento elegidas al azar y extraídas cuidadosamente a las 4-6 semanas (o más si es necesario para una mejor diferenciación) de aquella parte de parcela no involucrada en la evaluación a cosecha. Se registrará la presencia o ausencia de nódulos, su localización sobre raíz primaria o secundaria y apariencia (grandes o pequeños, rosados o blancos). Evaluación progresiva: el cultivo debe ser evaluado visualmente por el vigor y color de las plantas varias veces durante el principal periodo de crecimiento. Cosecha: A los fines de determinar rendimiento se cosechará el total de una porción conveniente de cada tratamiento. Se determinará peso seco en horno (hasta peso

6 constante). La naturaleza detallada de la recolección dependerá de si se está trabajando con especies perennes o anuales. Para las anuales puede bastar una sola determinación. Para las perennes son necesarias recolecciones sucesivas. Análisis estadístico.- Los resultados serán sometidos a análisis de varianza y cuando el test F sea significativo al 5%, las medias de los tratamientos deberán compararse por el test t o test de Duncan también a nivel 5% de significancia. Si el test F no fuese significativo al 5% pero si al 10%, las medias de los tratamientos deberán ser comparadas por el test t o de Duncan a 10% de significancia. 6. Interpretación de los resultados y presentación. Para la obtención del registro de semilla pre-inoculada se deberán obtener recuentos de UFC/semilla iguales o superiores a los descritos en la Tabla adjunta según el tamaño de semilla. Estos se deberán corresponder con los recuentos obtenidos a partir de la técnica de NMP y no deberán presentar diferencias significativas respecto a la Inoc Conv para los parámetros número, peso seco de nódulos y/o producción de materia seca en los ensayos en condiciones controladas. En los ensayos de eficiencia agronómica en campo las tecnologías a validar deberán presentar respuesta igual o superior a la inoculación patrón u otras tecnologías ya recomendadas, y superior al control sin inoculación en los 2 ensayos. En caso de tener un mayor número de ensayos, el número de casos positivos debe representar por lo menos el 70% del total.

7 Tabla: Concentraciones mínimas de rizobios en semilla preinoculada, durante los tiempos evaluados. Tipo de semilla semilla pequeña: alfalfa, tréboles pequeños (ej:t. blanco), Lotus, Ornithopus, etc semilla mediana: arveja, chicharo,vicias, tréboles medianos (ej: T. incarnatum), etc. semilla grande: soja, poroto UFC/semill a

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO

ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO 5 TRABAJO PRÁCTICO ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO OBJETIVOS: 1 Observar y comprender la diversidad bacteriana que coexiste en un mismo nicho en un dado ecosistema y las interrelaciones

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

V MATERIALES Y MÉTODOS

V MATERIALES Y MÉTODOS V MATERIALES Y MÉTODOS 5.1 Aislamiento de bacterias e identificación 5.1.1 Cepas tomadas del cepario de la Universidad de las Américas-Puebla En el cepario del Departamento de Química y Biología hay algunas

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua destilada utilizando Dióxido de Titanio dopado con Nitrógeno,

Más detalles

CAPÍTULO III MATERIALES Y MÉTODOS. El propósito de este capitulo es describir a detalle cada uno de los procedimientos y

CAPÍTULO III MATERIALES Y MÉTODOS. El propósito de este capitulo es describir a detalle cada uno de los procedimientos y CAPÍTULO III MATERIALES Y MÉTODOS El propósito de este capitulo es describir a detalle cada uno de los procedimientos y técnicas de laboratorio utilizadas en este proyecto para evaluar la eficiencia de

Más detalles

TRABAJO PRÁCTICO N 2: TÉCNICAS DE ESTERILIZACIÓN Y CULTIVO DE MICROORGANISMOS Objetivos:

TRABAJO PRÁCTICO N 2: TÉCNICAS DE ESTERILIZACIÓN Y CULTIVO DE MICROORGANISMOS Objetivos: TRABAJO PRÁCTICO N 2: TÉCNICAS DE ESTERILIZACIÓN Y CULTIVO DE MICROORGANISMOS Objetivos: -Conocer las metodologías actuales de control y eliminación de microorganismos. -Obtener dominio de los métodos

Más detalles

CONVENIO ENTORN QUÍMIC - UAB

CONVENIO ENTORN QUÍMIC - UAB Bellaterra, 30 de mayo de 2005 CONVENIO ENTORN QUÍMIC - UAB Informe completo: Análisis y cuantificación bacteriana, identificación proteica y determinación Persona de contacto: José Aguilera Personal técnico

Más detalles

RECUENTO BACTERIANO. Lic. Leticia Diana Área de Bacteriología. Departamento de Ciencias Microbiológicas Facultad de Veterinaria UdelaR 2015

RECUENTO BACTERIANO. Lic. Leticia Diana Área de Bacteriología. Departamento de Ciencias Microbiológicas Facultad de Veterinaria UdelaR 2015 RECUENTO BACTERIANO Lic. Leticia Diana Área de Bacteriología. Departamento de Ciencias Microbiológicas Facultad de Veterinaria UdelaR 2015 Generalidades Replicación bacteriana: fisión binaria (bipartición).

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

Métodos de inoculación

Métodos de inoculación Métodos de inoculación Curso: Métodos en fitopatología Unidad de Fitopatología Dto. de Protección Vegetal Facultad de Agronomía. Dr. Pedro Mondino Inoculación en plantas La inoculación en plantas la realizamos

Más detalles

FISIOLOGÍA BACTERIANA 2015 TÉCNICAS BÁSICAS DE MICROBIOLOGIA - TÉCNICAS ASÉPTICAS - SIEMBRA Y AISLAMIENTO

FISIOLOGÍA BACTERIANA 2015 TÉCNICAS BÁSICAS DE MICROBIOLOGIA - TÉCNICAS ASÉPTICAS - SIEMBRA Y AISLAMIENTO FISIOLOGÍA BACTERIANA 2015 1 TRABAJO PRÁCTICO TÉCNICAS BÁSICAS DE MICROBIOLOGIA - TÉCNICAS ASÉPTICAS - SIEMBRA Y AISLAMIENTO OBJETIVOS: Conocer la importancia de la esterilización y familiarizarse con

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

TRABAJO PRACTICO PRODUCCION DE ACIDO GLUCONICO Y SUS DERIVADOS

TRABAJO PRACTICO PRODUCCION DE ACIDO GLUCONICO Y SUS DERIVADOS TRABAJO PRACTICO PRODUCCION DE ACIDO GLUCONICO Y SUS DERIVADOS El ácido glucónico (pentahidroxicaproico) es el producto de oxidación de la D-glucosa en el C 1. CO Este ácido presenta un pka = 3.7 En soluciones

Más detalles

PRACTICA Núm. 16 RECUENTO DE BACTERIAS MESOFILAS AEROBIAS EN AGUA PARA CONSUMO HUMANO

PRACTICA Núm. 16 RECUENTO DE BACTERIAS MESOFILAS AEROBIAS EN AGUA PARA CONSUMO HUMANO PRACTICA Núm. 16 RECUENTO DE BACTERIAS MESOFILAS AEROBIAS EN AGUA PARA CONSUMO HUMANO I. OBJETIVO Determinar la presencia de bacterias Mesófilas Aerobias en una muestra de agua potable por la técnica de

Más detalles

Evaluación del desafío de nuevas formulaciones de curasemillas para soja con Phytium sp.

Evaluación del desafío de nuevas formulaciones de curasemillas para soja con Phytium sp. Evaluación del desafío de nuevas formulaciones de curasemillas para soja con Phytium sp. Guillermo Arrospide; Federico Acosta; Matías Muñoz; Departamento de desarrollo de Calister S.A. La mezcla de principios

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia

Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia Unidad Temática 3 Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia Introducción En un sistema biológico se define al crecimiento como el aumento ordenado de las estructuras y los constituyentes

Más detalles

Control de calidad de productos biológicos.

Control de calidad de productos biológicos. Control de calidad de productos biológicos. CONTROLAR Y ASEGURAR LA CALIDAD La calidad se produce y se asegura Mediante medidas tomadas en el proceso de producción. Para esto se deben cumplir con una serie

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

COMO ABORDAR Y RESOLVER ASPECTOS PRÁCTICOS DE MICROBIOLOGÍA

COMO ABORDAR Y RESOLVER ASPECTOS PRÁCTICOS DE MICROBIOLOGÍA COMO ABORDAR Y RESOLVER ASPECTOS PRÁCTICOS DE MICROBIOLOGÍA 3. CÁLCULOS DE BIOMASA Inés Arana, Maite Orruño e Isabel Barcina Departamento Inmunología, Microbiología y Parasitología Universidad del País

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

1. CARACTERÍSTICAS TÉCNICAS DEL EQUIPAMIENTO

1. CARACTERÍSTICAS TÉCNICAS DEL EQUIPAMIENTO PLIEGO DE PRESCRIPCIONES TÉCNICAS QUE HABRÁ DE REGIR LA LICITACIÓN, MEDIANTE PROCEDIMIENTO ABIERTO, PARA LA CONTRATACIÓN DEL SUMINISTRO, INSTALACIÓN Y PUESTA EN MARCHA DEL EQUIPAMIENTO CIENTÍFICO DE LA

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

III. METODOLOGÍA EXPERIMENTAL. La metodología empleada se muestra en el diagrama de flujo de la Figura 4 y se presenta en las siguientes secciones:

III. METODOLOGÍA EXPERIMENTAL. La metodología empleada se muestra en el diagrama de flujo de la Figura 4 y se presenta en las siguientes secciones: III. METODOLOGÍA EXPERIMENTAL La metodología empleada se muestra en el diagrama de flujo de la Figura 4 y se presenta en las siguientes secciones: 1. Área de Estudio y Recolecta de las Muestras (sección

Más detalles

NOMBRE DE LA ASIGNATURA: TECNOLOGIA FARMACEUTICA II

NOMBRE DE LA ASIGNATURA: TECNOLOGIA FARMACEUTICA II FACULTAD: CIENCIAS DE LA SALUD CARRERA PROFESIONAL: FARMACIA Y BIOQUIMICA CENTRO ULADECH CATÓLICA: TRUJILLO NOMBRE DE LA ASIGNATURA: TECNOLOGIA FARMACEUTICA II CICLO ACADÉMICO: IX DOCENTE: Q.F. GOMEZ VEJARANO

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

Escuela Superior Politécnica del Litoral. Calidad del Agua

Escuela Superior Politécnica del Litoral. Calidad del Agua Escuela Superior Politécnica del Litoral Instituto de Ciencias Matemáticas Ingeniería en Auditoria y Control de Gestión Celia María Castro Muñoz Calidad del Agua Profesor: Ing. José Chang Coliformes Totales

Más detalles

EFECTO FUNGICIDA DEL SULFATO DE COBRE Y DEL EXTRACTO DE CANELA FRENTE A Fulvia fulva, AGENTE CAUSAL DE LA CLADOSPORIOSIS DEL TOMATE.

EFECTO FUNGICIDA DEL SULFATO DE COBRE Y DEL EXTRACTO DE CANELA FRENTE A Fulvia fulva, AGENTE CAUSAL DE LA CLADOSPORIOSIS DEL TOMATE. EFECTO FUNGICIDA DEL SULFATO DE COBRE Y DEL EXTRACTO DE CANELA FRENTE A Fulvia fulva, AGENTE CAUSAL DE LA CLADOSPORIOSIS DEL TOMATE. M De Cara, F Heras, M Santos, *D Palmero, F Carretero, F Marín, M Alcázar,

Más detalles

UNIVERSIDAD TECNOLOGICA NACIONAL

UNIVERSIDAD TECNOLOGICA NACIONAL UNIVERSIDAD TECNOLOGICA NACIONAL FACULTAD REGIONAL ROSARIO DEPARTAMENTO DE INGENIERIA QUIMICA CATEDRA DE BIOTECNOLOGIA Trabajo práctico n 3 Siembra y recuento de microorganismos. 2009 Jefe de Cátedra:

Más detalles

PROCEDIMIENTO METODO DE RECUENTO EN PLACA DIRECTO STAPHYLOCOCCUS AUREUS BAM ON LINE 2001

PROCEDIMIENTO METODO DE RECUENTO EN PLACA DIRECTO STAPHYLOCOCCUS AUREUS BAM ON LINE 2001 PRT-712.02-024 Página 1 de 13 1. OBJETIVO Detectar el número de unidades formadoras de colonias (ufc.) de S. aureus presentes en muestras de alimentos y agua 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este

Más detalles

Resumen Bioluminiscencia

Resumen Bioluminiscencia Curso de biología molecular CIMAT 2007 Resumen Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

ENUMERACION BACTERIANA: EL NUMERO MAS PROBABLE

ENUMERACION BACTERIANA: EL NUMERO MAS PROBABLE CUARTA PARTE ENUMERACION BACTERIANA: EL NUMERO MAS PROBABLE EL METODO DE NUMERO MAS PROBABLE (NMP) es una estrategia efeciente de estimación de densidades poblacionales especialmente cuando una evaluación

Más detalles

Manejo del hongo en el laboratorio

Manejo del hongo en el laboratorio Guía Práctica 8 Sclerotium rolfsii Manejo del hongo en el laboratorio Contenido Guillermo Castellanos, Experto en Investigación 2 Carlos Jara, Ing. Agr. M.Sc., Asociado en Investigación Gloria Mosquera,

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Avances en la utilización de ensilados ácidos en alimentos extruidos para pacú. (Piaractus mesopotamicus)

Avances en la utilización de ensilados ácidos en alimentos extruidos para pacú. (Piaractus mesopotamicus) Avances en la utilización de ensilados ácidos en alimentos extruidos para pacú (Piaractus mesopotamicus) RESUMEN Se presentan los resultados de una experiencia de engorde de pacú realizada en sistema semi-intensivo

Más detalles

EVALUACIÓN N DE EFICACIA. 15.1. Introducción

EVALUACIÓN N DE EFICACIA. 15.1. Introducción 15.1. Introducción PRODUCCIÓN N DE ENTOMOPATÓGENOS Y EVALUACIÓN N DE EFICACIA 15.2. Producción de entomopatógenos: 15.3.1. Virus 15.3.2. Bacterias 15.3.3. Hongos 15.3.4. Nematodos 15.3. Formulación y aplicación

Más detalles

ASPECTOS DE LA GERMINACIÓN

ASPECTOS DE LA GERMINACIÓN ASPECTOS DE LA GERMINACIÓN in vitro EN GERMOPLASMA DE CAFETO SOMETIDO A DIFERENTES PERIODOS DE CONSERVACION María Esther González 1, J. Lacerra 2, M. Ferrer 2, Y. Castilla 1, R. Ramos 3, M. Valcarcel 1,

Más detalles

Cuenta en placa de bacterias

Cuenta en placa de bacterias Análisis Microbiológico de Alimentos. 2ª ed. Facultad de Química,. México. Cuenta en placa de bacterias OBJETIVOS Realizar adecuadamente la técnica de cuenta en placa para diversos grupos microbianos de

Más detalles

CAPÍTULO III MATERIALES Y MÉTODOS

CAPÍTULO III MATERIALES Y MÉTODOS CAPÍTULO III MATERIALES Y MÉTODOS 3.1. Descripción del área donde se realizó el experimento La investigación se efectuó de enero del 2009 a septiembre del 2010, en la zona La Playita del valle del Chota-Imbabura

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

FACULTAD DE MEDICINA DE SEVILLA. PRACTICAS DE MICROBIOLOGÍA MÉDICA. SEGUNDO CICLO.

FACULTAD DE MEDICINA DE SEVILLA. PRACTICAS DE MICROBIOLOGÍA MÉDICA. SEGUNDO CICLO. FACULTAD DE MEDICINA DE SEVILLA. PRACTICAS DE MICROBIOLOGÍA MÉDICA. SEGUNDO CICLO. - DIAGNÓSTICO DIRECTO DE LAS ENFERMEDADES INFECCIOSAS DE ETIOLOGÍA FÚNGICA. - DIAGNOSTICO INDIRECTO DE LAS ENFERMEDADES

Más detalles

Biología Celular y Molecular. Guía de TP Nro. 3. Ensayos de proliferación, adhesión y migración celular in vitro.

Biología Celular y Molecular. Guía de TP Nro. 3. Ensayos de proliferación, adhesión y migración celular in vitro. Biología Celular y Molecular. Guía de TP Nro. 3 Ensayos de proliferación, adhesión y migración celular in vitro. Introducción La valoración de la proliferación celular y la citotoxicidad in vitro es, muchas

Más detalles

UNIVERSIDAD DE MAYORES PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA Y BIOTECNOLOGÍA MICROBIOLOGÍA I

UNIVERSIDAD DE MAYORES PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA Y BIOTECNOLOGÍA MICROBIOLOGÍA I UNIVERSIDAD DE MAYORES PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA Y BIOTECNOLOGÍA MICROBIOLOGÍA I DRAS. MARÍA LUISA ORTIZ Y ANA PEDREGOSA 1 PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA

Más detalles

D.- La investigación ha sido presentada en otros eventos (ferias o muestras) científicos?

D.- La investigación ha sido presentada en otros eventos (ferias o muestras) científicos? C. Dónde han investigado? Mencione si se ha desarrollado parte, o toda la investigación en otras instituciones distintas a su Establecimiento Educacional. La fase práctica del proyecto fue desarrollada

Más detalles

UNIVERSIDAD TECNOLOGICA NACIONAL

UNIVERSIDAD TECNOLOGICA NACIONAL UNIVERSIDAD TECNOLOGICA NACIONAL FACULTAD REGIONAL ROSARIO DEPARTAMENTO DE INGENIERIA QUIMICA CATEDRA DE BIOTECNOLOGIA Trabajo práctico n 1 Preparación de medios de cultivo 2009 Jefe de Cátedra: Ing. Eduardo

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

Guía de Problemas. Espectrofotometría: Técnicas de Muestreo, Análisis e Interpretación de Datos Ingeniería Ambiental

Guía de Problemas. Espectrofotometría: Técnicas de Muestreo, Análisis e Interpretación de Datos Ingeniería Ambiental Guía de Problemas Espectrofotometría: 1- La absortividad molar de una solución del complejo formado por Bi(III) y tiourea es 9,32x10 3 L/mol x cm a 470 nm. Cuál es la absorbancia de una solución 3,79x10-5

Más detalles

RECOPILADO POR: EL PROGRAMA UNIVERSITARIO DE ALIMENTOS

RECOPILADO POR: EL PROGRAMA UNIVERSITARIO DE ALIMENTOS NMX-F-310-1978. DETERMINACIÓN DE CUENTA DE STAPHYLOCOCCUS AUREUS COAGULASA POSITIVA, EN ALIMENTOS. METHOD OF TEST FOR COUNT OF STAPHYLOCOCCUS AUREUS IN FOOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS.

Más detalles

El trabajo se realizó en la Ciudad de Lima Metropolitana entre los meses de Junio y Diciembre del año 2000.

El trabajo se realizó en la Ciudad de Lima Metropolitana entre los meses de Junio y Diciembre del año 2000. III.- MATERIAL Y MÉTODOS El trabajo se realizó en la Ciudad de Lima Metropolitana entre los meses de Junio y Diciembre del año 2000. Se tomó en consideración el agua de consumo humano que proviene de las

Más detalles

METODO DE FILTRACIÓN POR MEMBRANA PARA DETERMINACION DE COLIFORMES Y E. coli EN AGUA

METODO DE FILTRACIÓN POR MEMBRANA PARA DETERMINACION DE COLIFORMES Y E. coli EN AGUA PRT-712.03-009 Página 1 de 7 1. OBJETIVO Este método se utiliza para medir la calidad sanitaria del agua potable. 2. CAMPO DE APLICACIÓN Y ALCANCE Se aplica a agua clorada o agua naturales de muy baja

Más detalles

Hibridación In Situ en secciones gruesas de vibratomo

Hibridación In Situ en secciones gruesas de vibratomo Hibridación In Situ en secciones gruesas de vibratomo (Vicente Herranz Pérez, Unitat de Genetica Molecular, IBV) (Se va trabajar con ARN, por lo que se ha de ser muy estricto y cuidadoso para evitar las

Más detalles

32. Estudio cinético de la actividad invertasa de levadura de panadería.

32. Estudio cinético de la actividad invertasa de levadura de panadería. 32. Estudio cinético de la actividad invertasa de levadura de panadería. Manuel Tena Aldave, Jesús V. Jorrín Novo Departamento de Bioquímica y Biología Molecular, Campus Universitario de Rabanales, Edificio

Más detalles

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación.

I. 15microlitros de agua esteril, perforar el pozo y diluir. II. Se tomaron 2 microlitros para la primera transformación. 23 de agosto 2007 Se comenzó la elaboración de la bitácora Medio LB Broth, Billar (Luria-Bertani) 25gr/litro Se preparó 500 mililitros agregando 12.5 gramos Se diluyó y esterilizó por autoclave Medio LB

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE

DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE DETERMINACIÓN DE GLUTEN EN ALIMENTOS PARA CELÍACOS INDICE 1 Objetivo 2 2 Alcance 2 3 Desarrollo 2 4 Anexo 8 1.0. Objetivo Determinación de gluten en alimentos para celíacos. 2.0. Alcance Este método analítico

Más detalles

GRASAS Y ACEITES. 1) Peso específico

GRASAS Y ACEITES. 1) Peso específico GRASAS Y ACEITES Aceites - Se consideran aceites alimenticios o comestibles los admitidos como aptos para la alimentación por el presente y los que en el futuro sean aceptados como tales por la autoridad

Más detalles

INFORME TÉCNICO EVALUACIÓN DEL BIOESTABILIZADO COMO FUENTE DE FERTILIZACIÓN EN DIFERENTES CONDICIONES DE CULTIVOS, CLIMAS Y SUELOS TEMPORADA 2010 2011

INFORME TÉCNICO EVALUACIÓN DEL BIOESTABILIZADO COMO FUENTE DE FERTILIZACIÓN EN DIFERENTES CONDICIONES DE CULTIVOS, CLIMAS Y SUELOS TEMPORADA 2010 2011 INFORME TÉCNICO EVALUACIÓN DEL BIOESTABILIZADO COMO FUENTE DE FERTILIZACIÓN EN DIFERENTES CONDICIONES DE CULTIVOS, CLIMAS Y SUELOS TEMPORADA 2010 2011 INFORME FINAL CONVENIO DE INVESTIGACIÓN INIA SERVICIOS

Más detalles

Aislamiento de Microorganismos Diversidad Metabólica

Aislamiento de Microorganismos Diversidad Metabólica Trabajo Práctico Nº4 Aislamiento de Microorganismos Diversidad Metabólica Objetivo del Trabajo Práctico Aislamiento de microorganismos partir de distintos inóculos 1)Enriquecimiento-Selección 2)Selección-Diferenciación

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

No. Los sistemas Silvopastoriles Dormancia en semillas Valor cultural en Semillas La especie del mes Buzón de preguntas Marzo 2011 El nitrógeno es considerado, después del agua, el más importante factor

Más detalles

EFICACIA DE IMIDACLOPRID CALISTER COMO CURASEMILLA PARA CONTROL DE INSECTOS DE SUELO EN TRIGO, AVENA, RAIGRAS Y CEBADILLA

EFICACIA DE IMIDACLOPRID CALISTER COMO CURASEMILLA PARA CONTROL DE INSECTOS DE SUELO EN TRIGO, AVENA, RAIGRAS Y CEBADILLA Ing. Agr. Willy Chiaravalle Ing. Agr. Guillermo Aznárez EFICACIA DE IMIDACLOPRID CALISTER COMO CURASEMILLA PARA CONTROL DE INSECTOS DE SUELO EN TRIGO, AVENA, RAIGRAS Y CEBADILLA Soriano, 26 1 METODOLOGIA

Más detalles

Evaluación del efecto de inoculación con Bioprom Az39 y Rhanella sp. EMA -83 en Maíz*

Evaluación del efecto de inoculación con Bioprom Az39 y Rhanella sp. EMA -83 en Maíz* Evaluación del efecto de inoculación con Bioprom Az39 y Rhanella sp. EMA -83 en Maíz* Ing. Agr. MARCOS M. MARTINO Validación y Desarrollo de Tecnologías *Realizado para CALISTER SA, 2008 OBJETIVO Evaluar

Más detalles

METODOS DE ANALISIS BIOMEDICOS

METODOS DE ANALISIS BIOMEDICOS METODOS DE ANALISIS BIOMEDICOS 2010 Profesora a cargo: Dra. Viviana Lepek PARTE PRÁCTICA Jefe de T.P.: Dra. Mara Roset Ayudantes: Dra. Ines Marchesini Lic. Lucas Bukata Dr. Juan Mucci Dr. Adrián Mutto

Más detalles

PRACTICA 3 TECNICAS BASICAS DE CULTIVO

PRACTICA 3 TECNICAS BASICAS DE CULTIVO PRACTICA 3 TECNICAS BASICAS DE CULTIVO OBJETIVOS DE APRENDIZAJE: Cuando haya realizado el experimento, usted deberá ser capaz de: 1. Llevar a cabo la técnica de transferencia aséptica de microorganismos

Más detalles

RESULTADOS Y DISCUSION. Los datos para la variable número de hojas por planta. Se recolectaron en 4 puntos al azar

RESULTADOS Y DISCUSION. Los datos para la variable número de hojas por planta. Se recolectaron en 4 puntos al azar IX. RESULTADOS Y DISCUSION 9.1. Número de hojas por planta Los datos para la variable número de hojas por planta. Se recolectaron en 4 puntos al azar por parcela en la parcela útil, muestreando 3 plantas

Más detalles

Cultivos in vitro de tejidos vegetales

Cultivos in vitro de tejidos vegetales Desde hace 50 años se ha demostrado el avance en el desarrollo de la biotecnología vegetal, principalmente en la propagación de especies vegetales. Para este propósito existe toda una tecnología biológica

Más detalles

PRÁCTICA No. 7 DETERMINACIÓN DE COLIFORMES TOTALES Y FECALES EN AGUA RESIDUAL POR EL MÉTODO DEL NUMERO MAS PROBABLE (NMP)

PRÁCTICA No. 7 DETERMINACIÓN DE COLIFORMES TOTALES Y FECALES EN AGUA RESIDUAL POR EL MÉTODO DEL NUMERO MAS PROBABLE (NMP) PRÁCTICA No. 7 DETERMINACIÓN DE COLIFORMES TOTALES Y FECALES EN AGUA RESIDUAL POR EL MÉTODO DEL NUMERO MAS PROBABLE (NMP) I. OBJETIVO Determinar la presencia de coliformes totales y fecales en el efluente

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

producto de una colaboración entre la autoridad sanitaria e industria.

producto de una colaboración entre la autoridad sanitaria e industria. LA RECOLECCION DE MUESTRAS EN Ix)S ANALiW DE ALIMENTOS De la forma como se toma una muestra y del tratamiento posterior de la muestra extraída, depende esencialmente que los resultados de los análisis

Más detalles

Ciclo celular y crecimiento de poblaciones microbianas

Ciclo celular y crecimiento de poblaciones microbianas Ciclo celular y crecimiento de poblaciones microbianas Crecimiento a nivel individual. Crecimiento de poblaciones: medida de masa y nº de células. Crecimiento balanceado. Cinética de crecimiento. Curva

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

OBTENCIÓN DE MUTANTES

OBTENCIÓN DE MUTANTES OBTENCIÓN DE MUTANTES parp::hyg DE Fusarium oxysporum f. sp. lycopersici MEDIANTE LA TÉCNICA PCR DE DOBLE FUSIÓN. Gallegos Almanza I. A. (1) ; Martínez Cadena M. G. (2) ; Ferrel Cano L. E. (2). (1) Facultad

Más detalles

CONTROL HIGIENICO DE PRODUCTOS NO OBLIGATORIAMENTE ESTERILES. FUENTE: Centro de Documentación e Información del Ministerio de Economía - Argentina

CONTROL HIGIENICO DE PRODUCTOS NO OBLIGATORIAMENTE ESTERILES. FUENTE: Centro de Documentación e Información del Ministerio de Economía - Argentina CONTROL HIGIENICO DE PRODUCTOS NO OBLIGATORIAMENTE ESTERILES FUENTE: Centro de Documentación e Información del Ministerio de Economía - Argentina En este artículo se especifican los ensayos necesarios

Más detalles

PRÁCTICA 3 DETERMINACIÓN DE LA DUREZA DEL AGUA POR VALORACIÓN CON EDTA

PRÁCTICA 3 DETERMINACIÓN DE LA DUREZA DEL AGUA POR VALORACIÓN CON EDTA PRÁCTICA DETERMINACIÓN DE LA DUREZA DEL AGUA POR VALORACIÓN CON EDTA INTRODUCCIÓN El contenido salino de las aguas potables es debido principalmente a las sales de calcio y magnesio y, por esta razón,

Más detalles

AGUA. DETERMINACIÓN DEL NÚMERO TOTAL DE BACTERIAS EN PLACAS

AGUA. DETERMINACIÓN DEL NÚMERO TOTAL DE BACTERIAS EN PLACAS Quito - Ecuador NORMA TÉCNICA ECUATORIANA NTE INEN 1205:2013 Primera revisión AGUA. DETERMINACIÓN DEL NÚMERO TOTAL DE BACTERIAS EN PLACAS Primera edición WATER. DETERMINATION OF TOTAL NUMBER OF BACTERIA

Más detalles

Método 13. Ramón Varela

Método 13. Ramón Varela Método 13 Determinación de CloroFILA a y Feopigmentos Ramón Varela Introducción La determinación de clorofila a se emplea para estimar la biomasa de los productores primarios (fitoplancton) que se encuentran

Más detalles

3M Placas Petrifilm TM para el Recuento de Aerobios

3M Placas Petrifilm TM para el Recuento de Aerobios 3M Placas Petrifilm TM para el Recuento de Aerobios Recomendaciones de uso Para detallar información sobre PRECAUCIONES, COMPENSACIONES POR GARANTÍA / GARANTÍA LIMITADA, LIMITACIONES POR RESPONSABILIDAD

Más detalles

DEPARTAMENTO DE MEDICINA INTERNA HOSPITAL DE EXPLORACIÓN COLEGIO UNIVERSITARIO YONSEI DE MEDICINA 1- Test: Efectos de bloqueo por el filtro nasal Nosk, en la penetración de alérgenos. 2- Resumen: Certificamos

Más detalles

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS.

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. ASUNTO Con fundamento en lo dispuesto en los Artículos

Más detalles

PROCEDIMIENTO RECUENTO MOHOS Y LEVADURAS EN ALIMENTOS NORMA ISO 7954. 1. OBJETIVO Conocer el número de Mohos y Levaduras que contiene un alimento.

PROCEDIMIENTO RECUENTO MOHOS Y LEVADURAS EN ALIMENTOS NORMA ISO 7954. 1. OBJETIVO Conocer el número de Mohos y Levaduras que contiene un alimento. PRT- 712.02-031 Página 1 de 14 1. OBJETIVO Conocer el número de Mohos y Levaduras que contiene un alimento. 2. CAMPO DE APLICACIÓN Y ALCANCE Este procedimiento se aplica a todos los alimentos de consumos

Más detalles