PROTOCOLO REGISTRO DE SEMILLA PRE-INOCULADA

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "PROTOCOLO REGISTRO DE SEMILLA PRE-INOCULADA"

Transcripción

1 Dirección General de Servicios Agrícolas Ministerio de Ganadería, Agricultura y Pesca República Oriental del Uruguay Av. Millán 4703, Montevideo. CP Teléfono: (598) Web: PROTOCOLO REGISTRO DE SEMILLA PRE-INOCULADA 1. Determinación de rizobios viables sobre la semilla en función del tiempo. El número de rizobios sobre la semilla se determinará a tiempo 0 y cada 7 días post inoculación mientras se mantenga la carga mínima de ufc/semilla requerida para cada tipo de semilla.se utilizará la técnica de recuento de viables en placa. Tomar 90 semillas de la muestra de pre inoculado en frascos con 90 ml de solución fisiológica estéril y 360 μl de solución dispersante (Tween % p/v). Agitar durante 15 minutos en agitador de golpes. Extraer 1 ml y diluir en solución fisiológica estéril sucesivamente, hasta completar la dilución Sembrar 0.1 ml de cada dilución por triplicado y por extensión en superficie con espátula de Drygalski sobre medio YEM. El medio YEM base contiene: K 2 HPO 4, 0.5g; MgSO 4.7H 2 0, 0.2g; NaCl, 0.1g; manitol, 10g; extracto de levadura, 0.5g; FeCl 3.6H 2 0, una gota de solución al 10%; MnSO 4, una gota de solución al 10%; Rojo Congo, 5 ml.l -1 de una solución 1/400; H 2 O csp 1L, agar, 15g.l -1 ; ph 6.8. Este medio se modifica por el agregado vancomicina (1mg.l -1 ) cuando corresponda (Penna et al. 2011). Mantener las placas invertidas en estufa a 28ºC de 7 a 10 días, finalizado el período de incubación contar aquellas que presenten entre 30 y 300 colonias verificando la proporcionalidad entre diluciones y promediando los resultados de las tres repeticiones. 2. Identificación de los microorganismos. Lisado Celular Tocar con la punta de un tip estéril una colonia bacteriana aislada y resuspender en 25 µl de buffer de lisis (0.05 % NaOH, 0.25 % SDS). Incubar a 95ºC por 10 min en baño seco. Agregar 225 µl de H2O mq estéril-filtrada y centrifugar por 5 min a rpm. Conservar el sobrenadante a -20ºC.

2 El buffer de lisis se guarda a temperatura ambiente Protocolo para PCR La reacción de PCR se lleva a cabo en un volumen total de 25μl conteniendo 2,5μl buffer-pcr 10X, 0,5 μl dntps 10mM, 0,5μl MgCl2 25mM, 1,25μl Primer BOX 10 μm, 0,5 μl BSA 50 mg.ml -1, 0,2μl Dream Taq polimerasa 5U.µl -1 y 2,0μl del lisado celular. El programa utilizado para la reacción de amplificación es: desnaturalización inicial por 7 min a 94ºC, seguido de 35 ciclos de 1 min a 94ºC, 1 min a 48ºC y 5 min a 72ºC, por último se realiza un ciclo de extensión final de 15 min a 72ºC. El tiempo total del ciclado es de 5 horas aprox. Los reactivos utilizados son marca Thermo Scientific (o Fermentas). La secuencia del Primer BOX es: 5` CTACGGCAAGGCGACGCTGACG Electroforesis Los productos de amplificación obtenidos se visualizan mediante electroforesis en gel de agarosa 2% (p/v) en buffer TBE 0,5% (Tris-Ácido bórico-edta), utilizando una cuba con 35 cm de distancia entre electrodos. El marcador de peso molecular utilizado es de 100pb marca Thermo Scientific (o Fermentas). Los geles se tiñen con Goodview y se exponen a la luz UV para su visualización. El tiempo total de la electroforesis es de 3-4 horas aprox. 3. Validación de la nodulación. Número más probable (NMP) diluciones e infección en plantas. El método involucra la inoculación de diluciones crecientes de la suspensión obtenida a partir de semilla pre-inoculada. A partir de los resultados positivos o negativos se estimará el número de células viables capaces de infectar un huésped específico en condiciones controladas. Seleccionar semillas de tamaño uniforme y desinfectarlas superficialmente (Vincent, 1970). Pregerminar en placas conteniendo agar-agua al 0.8% en estufa a 28ºC. Leguminosas forrajeras: sembrar una/dos (según tamaño de semilla) semillas pregerminadas en tubos con 20 ml de medio libre de nitrógeno (Jensen, 1942) para

3 crecimiento de plantas (Vincent, 1975). Siete días posteriores a la siembra inocular las plantas con 1 ml de cada dilución por duplicado. Mantener las plantas en condiciones controladas de fotoperíodo (12h luz) y temperatura entre 18ºC/20ºC (noche /día). La lectura definitiva se realizará a las 4 semanas post-siembra. La estimación del NMP se realizará a partir de la presencia o ausencia de nódulos en la serie de diluciones estudiadas (Somasegaran y Hoben, 1985). Leguminosas de grano (soja): Sembrar una semilla pregerminada en frascos adaptados con 400 ml de solución nutritiva para crecimiento de plantas (Somasegaran y Hoben, 1985) y papel absorbente poroso como soporte (Hungría y Araujo, 1994). Inocular las plantas dos días posteriores a la siembra con 1ml de cada dilución por triplicado. Mantener las plantas en condiciones controladas de fotoperiodo (14h luz) y temperatura entre 24ºC/26ºC (noche/día). La lectura definitiva se realizará a las 4 semanas post-siembra. La estimación del NMP se realizará a partir de la presencia o ausencia de nódulos en la serie de diluciones estudiadas (Hungría y Araujo, 1994). 4. Determinación de parámetros de nodulación y producción de biomasa aérea en condiciones controladas. Leguminosas forrajeras: Determinar la producción de biomasa aérea del tratamiento pre-inoculado (PI) en cada uno de los tiempos evaluados. Sembrar tubos conteniendo 20 ml de medio libre de nitrógeno (Jensen, 1942) para crecimiento de plantas (Vincent, 1975) con una/dos semillas del tratamiento mencionado. Incluir en todos los tiempos evaluados un tratamiento con inoculación convencional (Inoc Conv) con inoculante turba (2 x10 9 UFC/g) y adherente formulado en base a metilcelulosa tratado en el momento de la siembra, un testigo (T) sin inocular y un tratamiento sin inocular con N no limitante (KNO3 0.05%). Utilizar una dosis de 200 g de inoculante cada 25 kg de semilla. Emplear un diseño completamente al azar con 10 repeticiones. Mantener las plantas en condiciones controladas de fotoperíodo (12h luz) y temperatura entre 18ºC/20ºC (noche/día). Cosechar 30 días post-siembra y evaluar producción de biomasa aérea. Secar el material vegetal en estufa a 60ºC hasta peso constante. Realizar análisis de varianza por ANOVA-1 para determinar diferencias entre las medias de los tratamientos. Leguminosas de grano (soja): Determinar parámetros de nodulación y producción de biomasa aérea del tratamiento pre-inoculado en cada una de los tiempos evaluados. Sembrar cinco semillas del tratamiento mencionado (luego raleadas a tres) en macetas

4 con 700 g de arena lavada y neutralizada estéril. Incluir en todos los tiempos evaluados un tratamiento con inoculación convencional (Inoc Conv) con inoculante turba (2 x10 9 UFC/g) y adherente formulado en base a metilcelulosa tratado en el momento de la siembra y un testigo (T) sin inocular. Utilizar una dosis de 200 g de inoculante cada 50 kg de semilla. Emplear un diseño completamente al azar con 5 repeticiones. Regar las plantas periódicamente con solución nutritiva libre de nitrógeno (Somasegaran y Hoben, 1985) y mantener en condiciones controladas de fotoperíodo (14h luz) y temperatura entre 24ºC/26ºC (noche/día). Cosechar 35 días post-siembra. Evaluar nodulación (número y peso seco de nódulos) y producción de biomasa aérea. Secar el material vegetal en estufa a 60ºC hasta peso constante. Realizar análisis de varianza por ANOVA-1 para determinar diferencias entre las medias de los tratamientos. 5. Determinación de eficiencia agronómica a campo Es la etapa final del proceso de registro, tiene por objetivo verificar los efectos declarados por el fabricante. Tecnologías de inoculación: La validación de nuevas tecnologías que involucra la sobrevivencia de las bacterias en la semilla deberán ser sometidas a ensayos de laboratorio de sobrevivencia en semilla de acuerdo con la metodología antes descrita. El tiempo de sobrevivencia post-inoculación otorgado con pruebas de laboratorio deberá ser comparada en campo con un tratamiento testigo inoculado el mismo día de la siembra, para proteger a la bacteria de factores estresantes. Podrán ser realizados por terceras instituciones públicas o privadas. Este Departamento fiscalizará la instalación de los ensayos, realizará los muestreos correspondientes y evaluará la información presentada a los efectos del registro. Consideraciones: Se deben tener en cuenta las siguientes consideraciones: a) vehículo utilizado en la formulación del inoculante, b) agregado de aditivos o adyuvantes para eficiencia de adhesión del inoculante a la semilla, c) cuidados especiales luego de la preparación de la semilla inoculada durante la fase de pre-siembra (evitar exposición al sol, contacto con agrotóxicos, garantizar condiciones adecuadas de almacenamiento). Diseño experimental.- Los ensayos seguirán un diseño de bloques al azar con 4 repeticiones en parcelas o en líneas según el caso. Se tomarán recaudos respecto a contaminación y muestreos destructivos

5 Se instalaran como mínimo 2 ensayos a campo en suelos representativos de diferentes áreas agroecológicas, Se respetará el marco agronómico de la leguminosa considerada. Se pondrá especial atención a la presencia y características de las poblaciones nativas o naturalizadas de rizobios. Tratamientos.- Los ensayos tendrán controles sin inocular con y sin el agregado de N mineral no limitante, y controles activos con inoculante base turba formulado con las cepas recomendadas y aplicado de acuerdo a las recomendaciones de este Dpto, además del tratamiento con la tecnología a registrar. Parámetros a evaluar.- Población nativa o naturalizada de Caracterización química y física del suelo rizobios en suelo. a- Leguminosas de grano: Nodulación: Colectar 5 plantas por parcela con las raíces intactas inmediatamente antes de la floración (en caso de soja a los días pos emergencia) en las líneas centrales en las cabeceras de las parcelas: determinar número de nódulos por planta (no/planta) y Masa seca de nódulos por planta (mg/planta). Rendimiento de Grano: La recolección de granos se realizará en las 4 líneas centrales de cada parcela, descartándose un metro de cada cabecera. El rendimiento de granos debe ser corregido para 13% de humedad y expresado en kg/ha. b- Leguminosas forrajeras: Nodulación: Colectar 20 plantas por tratamiento elegidas al azar y extraídas cuidadosamente a las 4-6 semanas (o más si es necesario para una mejor diferenciación) de aquella parte de parcela no involucrada en la evaluación a cosecha. Se registrará la presencia o ausencia de nódulos, su localización sobre raíz primaria o secundaria y apariencia (grandes o pequeños, rosados o blancos). Evaluación progresiva: el cultivo debe ser evaluado visualmente por el vigor y color de las plantas varias veces durante el principal periodo de crecimiento. Cosecha: A los fines de determinar rendimiento se cosechará el total de una porción conveniente de cada tratamiento. Se determinará peso seco en horno (hasta peso

6 constante). La naturaleza detallada de la recolección dependerá de si se está trabajando con especies perennes o anuales. Para las anuales puede bastar una sola determinación. Para las perennes son necesarias recolecciones sucesivas. Análisis estadístico.- Los resultados serán sometidos a análisis de varianza y cuando el test F sea significativo al 5%, las medias de los tratamientos deberán compararse por el test t o test de Duncan también a nivel 5% de significancia. Si el test F no fuese significativo al 5% pero si al 10%, las medias de los tratamientos deberán ser comparadas por el test t o de Duncan a 10% de significancia. 6. Interpretación de los resultados y presentación. Para la obtención del registro de semilla pre-inoculada se deberán obtener recuentos de UFC/semilla iguales o superiores a los descritos en la Tabla adjunta según el tamaño de semilla. Estos se deberán corresponder con los recuentos obtenidos a partir de la técnica de NMP y no deberán presentar diferencias significativas respecto a la Inoc Conv para los parámetros número, peso seco de nódulos y/o producción de materia seca en los ensayos en condiciones controladas. En los ensayos de eficiencia agronómica en campo las tecnologías a validar deberán presentar respuesta igual o superior a la inoculación patrón u otras tecnologías ya recomendadas, y superior al control sin inoculación en los 2 ensayos. En caso de tener un mayor número de ensayos, el número de casos positivos debe representar por lo menos el 70% del total.

7 Tabla: Concentraciones mínimas de rizobios en semilla preinoculada, durante los tiempos evaluados. Tipo de semilla semilla pequeña: alfalfa, tréboles pequeños (ej:t. blanco), Lotus, Ornithopus, etc semilla mediana: arveja, chicharo,vicias, tréboles medianos (ej: T. incarnatum), etc. semilla grande: soja, poroto UFC/semill a

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

39. Aislamiento y purificación del DNA de un plásmido recombinante

39. Aislamiento y purificación del DNA de un plásmido recombinante 39. Aislamiento y purificación del DNA de un plásmido recombinante Aurora Galván Cejudo, Manuel Tejada, Antonio Camargo, José Javier Higuera, Vicente Mariscal, Emilio Fernández Reyes Departamento de Bioquímica

Más detalles

V MATERIALES Y MÉTODOS

V MATERIALES Y MÉTODOS V MATERIALES Y MÉTODOS 5.1 Aislamiento de bacterias e identificación 5.1.1 Cepas tomadas del cepario de la Universidad de las Américas-Puebla En el cepario del Departamento de Química y Biología hay algunas

Más detalles

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua

C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O. Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua C A P Í T U L O 3 M A T E R I A L E S Y M É T O D O Se ejecutaron varias pruebas para la inactivación de Escherichia Coli ATCC 25922 en agua destilada utilizando Dióxido de Titanio dopado con Nitrógeno,

Más detalles

ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO

ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO 5 TRABAJO PRÁCTICO ECOLOGÍA MICROBIANA Y COMPORTAMIENTO BACTERIANO COMUNITARIO OBJETIVOS: 1 Observar y comprender la diversidad bacteriana que coexiste en un mismo nicho en un dado ecosistema y las interrelaciones

Más detalles

TRABAJO PRÁCTICO N 2: TÉCNICAS DE ESTERILIZACIÓN Y CULTIVO DE MICROORGANISMOS Objetivos:

TRABAJO PRÁCTICO N 2: TÉCNICAS DE ESTERILIZACIÓN Y CULTIVO DE MICROORGANISMOS Objetivos: TRABAJO PRÁCTICO N 2: TÉCNICAS DE ESTERILIZACIÓN Y CULTIVO DE MICROORGANISMOS Objetivos: -Conocer las metodologías actuales de control y eliminación de microorganismos. -Obtener dominio de los métodos

Más detalles

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones

DANAGENE SALIVA KIT. Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones DANAGENE SALIVA KIT Ref.0603.4 50 Extracciones / Ref.0603.41 160 Extracciones 1.INTRODUCCION DANAGENE SALIVA Kit provee un método para la extracción de ADN genómico de alta calidad a partir de muestras

Más detalles

Validación de los métodos microbiológicos PROTOCOLO DE VALIDACIÓN

Validación de los métodos microbiológicos PROTOCOLO DE VALIDACIÓN Validación de los métodos microbiológicos PROTOCOLO DE VALIDACIÓN Norma ISO 17025 Bqca. QM Alicia I. Cuesta, Consultora Internacional de la FAO Objetivos a desarrollar Validación de métodos: Intentamos

Más detalles

Métodos de inoculación

Métodos de inoculación Métodos de inoculación Curso: Métodos en fitopatología Unidad de Fitopatología Dto. de Protección Vegetal Facultad de Agronomía. Dr. Pedro Mondino Inoculación en plantas La inoculación en plantas la realizamos

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

Evaluación del desafío de nuevas formulaciones de curasemillas para soja con Phytium sp.

Evaluación del desafío de nuevas formulaciones de curasemillas para soja con Phytium sp. Evaluación del desafío de nuevas formulaciones de curasemillas para soja con Phytium sp. Guillermo Arrospide; Federico Acosta; Matías Muñoz; Departamento de desarrollo de Calister S.A. La mezcla de principios

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

PROTOCOLO DE TOMA DE MUESTRAS A CAMPO Y SU POSTERIOR MANEJO EN LABORATORIO PARA LA OBTENCIÓN DE DATOS DE NODULACIÓN.

PROTOCOLO DE TOMA DE MUESTRAS A CAMPO Y SU POSTERIOR MANEJO EN LABORATORIO PARA LA OBTENCIÓN DE DATOS DE NODULACIÓN. PROTOCOLO DE TOMA DE MUESTRAS A CAMPO Y SU POSTERIOR MANEJO EN LABORATORIO PARA LA OBTENCIÓN DE DATOS DE NODULACIÓN. Santa Cruz de la Sierra BOLIVIA Marzo de 2006 Importante: Las muestras que arriban de

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

PRACTICA Núm. 16 RECUENTO DE BACTERIAS MESOFILAS AEROBIAS EN AGUA PARA CONSUMO HUMANO

PRACTICA Núm. 16 RECUENTO DE BACTERIAS MESOFILAS AEROBIAS EN AGUA PARA CONSUMO HUMANO PRACTICA Núm. 16 RECUENTO DE BACTERIAS MESOFILAS AEROBIAS EN AGUA PARA CONSUMO HUMANO I. OBJETIVO Determinar la presencia de bacterias Mesófilas Aerobias en una muestra de agua potable por la técnica de

Más detalles

METODO DE FILTRACIÓN POR MEMBRANA PARA DETERMINACION DE COLIFORMES Y E. coli EN AGUA

METODO DE FILTRACIÓN POR MEMBRANA PARA DETERMINACION DE COLIFORMES Y E. coli EN AGUA PRT-712.03-009 Página 1 de 7 1. OBJETIVO Este método se utiliza para medir la calidad sanitaria del agua potable. 2. CAMPO DE APLICACIÓN Y ALCANCE Se aplica a agua clorada o agua naturales de muy baja

Más detalles

UNIVERSIDAD DE MAYORES PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA Y BIOTECNOLOGÍA MICROBIOLOGÍA I

UNIVERSIDAD DE MAYORES PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA Y BIOTECNOLOGÍA MICROBIOLOGÍA I UNIVERSIDAD DE MAYORES PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA Y BIOTECNOLOGÍA MICROBIOLOGÍA I DRAS. MARÍA LUISA ORTIZ Y ANA PEDREGOSA 1 PRÁCTICAS DE MICROBIOLOGÍA DEPARTAMENTO DE BIOMEDICINA

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

CONVENIO ENTORN QUÍMIC - UAB

CONVENIO ENTORN QUÍMIC - UAB Bellaterra, 30 de mayo de 2005 CONVENIO ENTORN QUÍMIC - UAB Informe completo: Análisis y cuantificación bacteriana, identificación proteica y determinación Persona de contacto: José Aguilera Personal técnico

Más detalles

PRODUCCIÓN Y EFICIENCIA DE UN INSECTICIDA BOTÁNICO A PARTIR DE SEMILLAS DE NARANJA EN EL PARQUE METROPOLITANO GÜANGÜILTAGUA

PRODUCCIÓN Y EFICIENCIA DE UN INSECTICIDA BOTÁNICO A PARTIR DE SEMILLAS DE NARANJA EN EL PARQUE METROPOLITANO GÜANGÜILTAGUA RESUMEN EJECUTIVO PRODUCCIÓN Y EFICIENCIA DE UN INSECTICIDA BOTÁNICO A PARTIR DE SEMILLAS DE NARANJA EN EL PARQUE METROPOLITANO GÜANGÜILTAGUA Andrea Aguirre Moreno. Antecedentes. La utilización de un insecticida

Más detalles

ITINERARIO FORMATIVO DE ANALISTA DE LABORATORIO. Competencia general: DURACIÓN: 130 horas MÓDULOS:

ITINERARIO FORMATIVO DE ANALISTA DE LABORATORIO. Competencia general: DURACIÓN: 130 horas MÓDULOS: ITINERARIO FORMATIVO DE ANALISTA DE LABORATORIO (*) SEGÚN CERTIFICACIÓN PROFESIONAL DURACIÓN: 130 horas MÓDULOS: - Organización del laboratorio (20 horas) - Técnicas de análisis físico y físico- químico

Más detalles

Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia

Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia Unidad Temática 3 Crecimiento Bacteriano Benintende, Silvia y Sanchez, Cecilia Introducción En un sistema biológico se define al crecimiento como el aumento ordenado de las estructuras y los constituyentes

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

RECUENTO BACTERIANO. Lic. Leticia Diana Área de Bacteriología. Departamento de Ciencias Microbiológicas Facultad de Veterinaria UdelaR 2015

RECUENTO BACTERIANO. Lic. Leticia Diana Área de Bacteriología. Departamento de Ciencias Microbiológicas Facultad de Veterinaria UdelaR 2015 RECUENTO BACTERIANO Lic. Leticia Diana Área de Bacteriología. Departamento de Ciencias Microbiológicas Facultad de Veterinaria UdelaR 2015 Generalidades Replicación bacteriana: fisión binaria (bipartición).

Más detalles

EVALUACIÓN N DE EFICACIA. 15.1. Introducción

EVALUACIÓN N DE EFICACIA. 15.1. Introducción 15.1. Introducción PRODUCCIÓN N DE ENTOMOPATÓGENOS Y EVALUACIÓN N DE EFICACIA 15.2. Producción de entomopatógenos: 15.3.1. Virus 15.3.2. Bacterias 15.3.3. Hongos 15.3.4. Nematodos 15.3. Formulación y aplicación

Más detalles

Curso de biología molecular CIMAT 2010

Curso de biología molecular CIMAT 2010 Curso de biología molecular CIMAT 2010 INTRODUCCIÓN Este curso-taller tiene como propósito mostrar de manera teórica y práctica algunos principios básicos de biología molecular e ingeniería genética. Conocerás

Más detalles

III. METODOLOGÍA EXPERIMENTAL. La metodología empleada se muestra en el diagrama de flujo de la Figura 4 y se presenta en las siguientes secciones:

III. METODOLOGÍA EXPERIMENTAL. La metodología empleada se muestra en el diagrama de flujo de la Figura 4 y se presenta en las siguientes secciones: III. METODOLOGÍA EXPERIMENTAL La metodología empleada se muestra en el diagrama de flujo de la Figura 4 y se presenta en las siguientes secciones: 1. Área de Estudio y Recolecta de las Muestras (sección

Más detalles

ENUMERACION BACTERIANA: EL NUMERO MAS PROBABLE

ENUMERACION BACTERIANA: EL NUMERO MAS PROBABLE CUARTA PARTE ENUMERACION BACTERIANA: EL NUMERO MAS PROBABLE EL METODO DE NUMERO MAS PROBABLE (NMP) es una estrategia efeciente de estimación de densidades poblacionales especialmente cuando una evaluación

Más detalles

COMO ABORDAR Y RESOLVER ASPECTOS PRÁCTICOS DE MICROBIOLOGÍA

COMO ABORDAR Y RESOLVER ASPECTOS PRÁCTICOS DE MICROBIOLOGÍA COMO ABORDAR Y RESOLVER ASPECTOS PRÁCTICOS DE MICROBIOLOGÍA 3. CÁLCULOS DE BIOMASA Inés Arana, Maite Orruño e Isabel Barcina Departamento Inmunología, Microbiología y Parasitología Universidad del País

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

ASPECTOS DE LA GERMINACIÓN

ASPECTOS DE LA GERMINACIÓN ASPECTOS DE LA GERMINACIÓN in vitro EN GERMOPLASMA DE CAFETO SOMETIDO A DIFERENTES PERIODOS DE CONSERVACION María Esther González 1, J. Lacerra 2, M. Ferrer 2, Y. Castilla 1, R. Ramos 3, M. Valcarcel 1,

Más detalles

VALIDACIÓN DEL CONTROL HIGIÉNICO DE PRODUCTOS FARMACÉUTICOS NO OBLIGATORIAMENTE ESTERILES

VALIDACIÓN DEL CONTROL HIGIÉNICO DE PRODUCTOS FARMACÉUTICOS NO OBLIGATORIAMENTE ESTERILES VALIDACIÓN DEL CONTROL HIGIÉNICO DE PRODUCTOS FARMACÉUTICOS NO OBLIGATORIAMENTE ESTERILES Validación del Control Higiénico de Productos Farmacéuticos No obligatoriamente estériles Objetivo de la validación

Más detalles

MATERIALES Y MÉTODOS. Cepas Utilizadas

MATERIALES Y MÉTODOS. Cepas Utilizadas MATERIALES Y MÉTODOS Cepas Utilizadas Para el presente trabajo se utilizaron tres cepas Tipo: Mycobacterium aviumintracellulare (proporcionada al Laboratorio Estatal de Salud Pública por el Instituto Nacional

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

El trabajo se realizó en la Ciudad de Lima Metropolitana entre los meses de Junio y Diciembre del año 2000.

El trabajo se realizó en la Ciudad de Lima Metropolitana entre los meses de Junio y Diciembre del año 2000. III.- MATERIAL Y MÉTODOS El trabajo se realizó en la Ciudad de Lima Metropolitana entre los meses de Junio y Diciembre del año 2000. Se tomó en consideración el agua de consumo humano que proviene de las

Más detalles

TRABAJO PRACTICO PRODUCCION DE ACIDO GLUCONICO Y SUS DERIVADOS

TRABAJO PRACTICO PRODUCCION DE ACIDO GLUCONICO Y SUS DERIVADOS TRABAJO PRACTICO PRODUCCION DE ACIDO GLUCONICO Y SUS DERIVADOS El ácido glucónico (pentahidroxicaproico) es el producto de oxidación de la D-glucosa en el C 1. CO Este ácido presenta un pka = 3.7 En soluciones

Más detalles

CAPÍTULO III MATERIALES Y MÉTODOS. El propósito de este capitulo es describir a detalle cada uno de los procedimientos y

CAPÍTULO III MATERIALES Y MÉTODOS. El propósito de este capitulo es describir a detalle cada uno de los procedimientos y CAPÍTULO III MATERIALES Y MÉTODOS El propósito de este capitulo es describir a detalle cada uno de los procedimientos y técnicas de laboratorio utilizadas en este proyecto para evaluar la eficiencia de

Más detalles

PRÁCTICA No. 7 DETERMINACIÓN DE COLIFORMES TOTALES Y FECALES EN AGUA RESIDUAL POR EL MÉTODO DEL NUMERO MAS PROBABLE (NMP)

PRÁCTICA No. 7 DETERMINACIÓN DE COLIFORMES TOTALES Y FECALES EN AGUA RESIDUAL POR EL MÉTODO DEL NUMERO MAS PROBABLE (NMP) PRÁCTICA No. 7 DETERMINACIÓN DE COLIFORMES TOTALES Y FECALES EN AGUA RESIDUAL POR EL MÉTODO DEL NUMERO MAS PROBABLE (NMP) I. OBJETIVO Determinar la presencia de coliformes totales y fecales en el efluente

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

1. CARACTERÍSTICAS TÉCNICAS DEL EQUIPAMIENTO

1. CARACTERÍSTICAS TÉCNICAS DEL EQUIPAMIENTO PLIEGO DE PRESCRIPCIONES TÉCNICAS QUE HABRÁ DE REGIR LA LICITACIÓN, MEDIANTE PROCEDIMIENTO ABIERTO, PARA LA CONTRATACIÓN DEL SUMINISTRO, INSTALACIÓN Y PUESTA EN MARCHA DEL EQUIPAMIENTO CIENTÍFICO DE LA

Más detalles

UNIVERSIDAD TECNOLOGICA NACIONAL

UNIVERSIDAD TECNOLOGICA NACIONAL UNIVERSIDAD TECNOLOGICA NACIONAL FACULTAD REGIONAL ROSARIO DEPARTAMENTO DE INGENIERIA QUIMICA CATEDRA DE BIOTECNOLOGIA Trabajo práctico n 1 Preparación de medios de cultivo 2009 Jefe de Cátedra: Ing. Eduardo

Más detalles

FISIOLOGÍA BACTERIANA 2015 TÉCNICAS BÁSICAS DE MICROBIOLOGIA - TÉCNICAS ASÉPTICAS - SIEMBRA Y AISLAMIENTO

FISIOLOGÍA BACTERIANA 2015 TÉCNICAS BÁSICAS DE MICROBIOLOGIA - TÉCNICAS ASÉPTICAS - SIEMBRA Y AISLAMIENTO FISIOLOGÍA BACTERIANA 2015 1 TRABAJO PRÁCTICO TÉCNICAS BÁSICAS DE MICROBIOLOGIA - TÉCNICAS ASÉPTICAS - SIEMBRA Y AISLAMIENTO OBJETIVOS: Conocer la importancia de la esterilización y familiarizarse con

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Electrodo selectivo de cianuro

Electrodo selectivo de cianuro 96 53 Electrodo selectivo de cianuro - CN Electrodo selectivo de cianuro. Manual del usuario. Garantía El plazo de validez es de 6 meses a partir de la fecha de expedición del electrodo. La garantía cubre

Más detalles

Calidad del agua - Muestreo Parte 10 Muestreo de aguas residuales Recolección y manejo de las muestras

Calidad del agua - Muestreo Parte 10 Muestreo de aguas residuales Recolección y manejo de las muestras Calidad del agua - Muestreo Parte 10 Muestreo de aguas residuales Recolección y manejo de las muestras Romina Rojas Opazo Ingeniero Civil Químico Instituto de Investigación Pesquera Control y fiscalización

Más detalles

Cultivos in vitro de tejidos vegetales

Cultivos in vitro de tejidos vegetales Desde hace 50 años se ha demostrado el avance en el desarrollo de la biotecnología vegetal, principalmente en la propagación de especies vegetales. Para este propósito existe toda una tecnología biológica

Más detalles

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN

NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN NORMAS DE TRABAJO EN BIOLOGÍA MOLECULAR Y GUÍA DE PROBLEMAS HABITUALES Y SU SOLUCIÓN 1. PROCEDIMIENTOS BÁSICOS: En este apartado pretendemos detallar algunos factores muy importantes a la hora de realizar

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now.

Easy PDF Creator is professional software to create PDF. If you wish to remove this line, buy it now. Unidad Curricular: Virología y Micología Veterinaria 1 TRABAJO PRÁCTICO No. 3 AMPLIFICACIÓN DE GENES VIRALES Reacción en Cadena de la Polimerasa, conocida como PCR (por sus siglas en inglés: Polimerase

Más detalles

METODOLOGÍA PARA VALIDACIÓN INTERNA DE METODOS DE ENSAYO MICROBIOLOGICOS ALTERNATIVOS EN ALIMENTOS EJERCICIOS PRÁCTICOS CON RESPUESTAS

METODOLOGÍA PARA VALIDACIÓN INTERNA DE METODOS DE ENSAYO MICROBIOLOGICOS ALTERNATIVOS EN ALIMENTOS EJERCICIOS PRÁCTICOS CON RESPUESTAS METODOLOGÍA PARA VALIDACIÓN INTERNA DE METODOS DE ENSAYO MICROBIOLOGICOS ALTERNATIVOS EN EJERCICIOS PRÁCTICOS CON RESPUESTAS ACHIPIA Mº AGRICULTURA GOBIERNO DE CHILE Santiago de Chile 26 y 27 de Marzo

Más detalles

EFICACIA DE IMIDACLOPRID CALISTER COMO CURASEMILLA PARA CONTROL DE INSECTOS DE SUELO EN TRIGO, AVENA, RAIGRAS Y CEBADILLA

EFICACIA DE IMIDACLOPRID CALISTER COMO CURASEMILLA PARA CONTROL DE INSECTOS DE SUELO EN TRIGO, AVENA, RAIGRAS Y CEBADILLA Ing. Agr. Willy Chiaravalle Ing. Agr. Guillermo Aznárez EFICACIA DE IMIDACLOPRID CALISTER COMO CURASEMILLA PARA CONTROL DE INSECTOS DE SUELO EN TRIGO, AVENA, RAIGRAS Y CEBADILLA Soriano, 26 1 METODOLOGIA

Más detalles

BATATA. Genero y especie: Ipomoea batatas. Familia: Convolvulaceae. Otros nombres: Boniato, camote, papa dulce, sweet potato

BATATA. Genero y especie: Ipomoea batatas. Familia: Convolvulaceae. Otros nombres: Boniato, camote, papa dulce, sweet potato BATATA Genero y especie: Ipomoea batatas Familia: Convolvulaceae Otros nombres: Boniato, camote, papa dulce, sweet potato Se consume la raíz de almacenamiento o falso tubérculo LA PRODUCCION DE BATATA

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

Biología Celular y Molecular. Guía de TP Nro. 3. Ensayos de proliferación, adhesión y migración celular in vitro.

Biología Celular y Molecular. Guía de TP Nro. 3. Ensayos de proliferación, adhesión y migración celular in vitro. Biología Celular y Molecular. Guía de TP Nro. 3 Ensayos de proliferación, adhesión y migración celular in vitro. Introducción La valoración de la proliferación celular y la citotoxicidad in vitro es, muchas

Más detalles

Área de Ciencias de los Alimentos

Área de Ciencias de los Alimentos Área de Ciencias de los Alimentos En la presente área del conocimiento se incluyen los Planes de estudio de Maestría en Ciencias de los Alimentos y Especialización en Calidad e Inocuidad Alimentaria. Asignaturas

Más detalles

1 MATERIALES Y MÉTODOS

1 MATERIALES Y MÉTODOS 1 MATERIALES Y MÉTODOS El presente protocolo experimental contempla la amplificación del DNA de las bacterias y virus causantes de las ETS Neisseria gonorrhoeae, Chlamydia trachomatis y VPH mediante PCR

Más detalles

ANÁLISIS DE AGUAS: Metodología

ANÁLISIS DE AGUAS: Metodología FTTM06 Rev-2,21/11/2013 INSTITUTO DE TOXICOLOGÍA DE LA DEFENSA Hospital Central de la Defensa. Glorieta del Ejército s/n. 28047 MADRID. Tel.: 914222625. Fax: 914222624 E- mail : toxicologia@oc.mde.es Web

Más detalles

COD. GL PL 03. Celian Obregon Apoyo a procesos. REV. No. DESCRIPCION ELABORÓ REVISÓ APROBÓ FECHA APROBADO:

COD. GL PL 03. Celian Obregon Apoyo a procesos. REV. No. DESCRIPCION ELABORÓ REVISÓ APROBÓ FECHA APROBADO: COD. GL PL 03 3 2 1 Se cambió la imagen institucional 0 Documento inicial Celian Obregon Apoyo a procesos Martha García Ing. Química Loida Zamora Dir. SILAB Carlos Doria Coordinador lab. de Calidad Ambiental

Más detalles

D.- La investigación ha sido presentada en otros eventos (ferias o muestras) científicos?

D.- La investigación ha sido presentada en otros eventos (ferias o muestras) científicos? C. Dónde han investigado? Mencione si se ha desarrollado parte, o toda la investigación en otras instituciones distintas a su Establecimiento Educacional. La fase práctica del proyecto fue desarrollada

Más detalles

Normalización de soluciones de NaOH 0,1N y HCl 0,1N.

Normalización de soluciones de NaOH 0,1N y HCl 0,1N. Laboratorio N 1: Normalización de soluciones de NaOH 0,1N y HCl 0,1N. Objetivos: - Determinar la normalidad exacta de una solución de hidróxido de sodio aproximadamente 0,1 N, utilizando biftalato de potasio

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

INFORME TÉCNICO EVALUACIÓN DEL BIOESTABILIZADO COMO FUENTE DE FERTILIZACIÓN EN DIFERENTES CONDICIONES DE CULTIVOS, CLIMAS Y SUELOS TEMPORADA 2010 2011

INFORME TÉCNICO EVALUACIÓN DEL BIOESTABILIZADO COMO FUENTE DE FERTILIZACIÓN EN DIFERENTES CONDICIONES DE CULTIVOS, CLIMAS Y SUELOS TEMPORADA 2010 2011 INFORME TÉCNICO EVALUACIÓN DEL BIOESTABILIZADO COMO FUENTE DE FERTILIZACIÓN EN DIFERENTES CONDICIONES DE CULTIVOS, CLIMAS Y SUELOS TEMPORADA 2010 2011 INFORME FINAL CONVENIO DE INVESTIGACIÓN INIA SERVICIOS

Más detalles

MOLECULAR DIAGNOSTIC KITS CATALOGUE

MOLECULAR DIAGNOSTIC KITS CATALOGUE MOLECULAR DIAGNOSTIC KITS CATALOGUE KITS DE DIAGNÓSTICO MOLECULAR IELAB le presenta, enmarcada dentro de su línea de productos de diagnóstico molecular, una nueva gama de kits de diagnóstico, que han sido

Más detalles

Cuenta en placa de bacterias

Cuenta en placa de bacterias Análisis Microbiológico de Alimentos. 2ª ed. Facultad de Química,. México. Cuenta en placa de bacterias OBJETIVOS Realizar adecuadamente la técnica de cuenta en placa para diversos grupos microbianos de

Más detalles

OBTENCIÓN DE CULTIVOS PUROS

OBTENCIÓN DE CULTIVOS PUROS Introducción Objetivo Fundamento Trabajo Práctico Nº 4 OBTENCIÓN DE CULTIVOS PUROS Procedimiento Resultados Instrucciones para el uso del Sistema Anaeróbico Gaspak Bibliografía INTRODUCCIÓN En los ambientes

Más detalles

UNIVERSIDAD TECNOLOGICA NACIONAL

UNIVERSIDAD TECNOLOGICA NACIONAL UNIVERSIDAD TECNOLOGICA NACIONAL FACULTAD REGIONAL ROSARIO DEPARTAMENTO DE INGENIERIA QUIMICA CATEDRA DE BIOTECNOLOGIA Trabajo práctico n 3 Siembra y recuento de microorganismos. 2009 Jefe de Cátedra:

Más detalles

Dirección Cl Coslada 18 Teléfono 91 356 50 59 Fax 91 356 56 28 28028 MADRID

Dirección Cl Coslada 18 Teléfono 91 356 50 59 Fax 91 356 56 28 28028 MADRID COMITÉ TÉCNICO DE CERTIFICACIÓN PLÁSTICOS SECRETARÍA: ANAIP Dirección Cl Coslada 18 Teléfono 91 356 50 59 Fax 91 356 56 28 28028 MADRID REGLAMENTO PARTICULAR DEL CERTIFICADO DE CONFORMIDAD AENOR PARA SISTEMAS

Más detalles

NycoCard CRP Single Test

NycoCard CRP Single Test NycoCard CRP Single Test ES DESCRIPCION DEL PRODUCTO Aplicaciones NycoCard CRP Single Test es un test de diagnóstico in vitro para medir de una forma rápida la proteína C reactiva (CRP) en la sangre humana.

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

BioSnacky Original Germinador

BioSnacky Original Germinador Página 1 de 2 Página 1 de 2 BioSnacky Original Germinador BioSnacky Original, para cultivar brotes biológicos frescos. Permite la germinación simultánea de hasta 3 tipos de semilla. Enviar a un amigo Información

Más detalles

El sistema de aseguramiento de calidad adecuado para la fabricación de medicamentos debe garantizar que:

El sistema de aseguramiento de calidad adecuado para la fabricación de medicamentos debe garantizar que: II. GENERALIDADES. II.1. CONCEPTOS GENERALES. II.1.1. GESTION DE LA CALIDAD. La gestión de la calidad total es la organización estructurada y funcional de recursos humanos y materiales que tiene por objeto

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

REQUISITOS Y SUGERENCIAS SOBRE EL ENVÍO DE MUESTRAS HACIA LAS SUBGERENCIAS DE EXPERIMENTACIÓN (CHIHUAHUA Y OAXACA) DEL SGM

REQUISITOS Y SUGERENCIAS SOBRE EL ENVÍO DE MUESTRAS HACIA LAS SUBGERENCIAS DE EXPERIMENTACIÓN (CHIHUAHUA Y OAXACA) DEL SGM REQUISITOS GENERALES. 1) Envío de muestras bien empacadas, en cajas o recipientes anticolapsables, y a domicilio. 2) Envío de una solicitud de trabajo (oficio, correo electrónico, fax, etc) que contemple

Más detalles

AURO Colorante pared nº 330

AURO Colorante pared nº 330 FICHA TECNICA Descripción del producto Colorante, PARA PINTURAS VEGETALES, SE PUEDE UTILIZAR COMO COLOR BASE INTENSO. Finalidad Como colorante para AURO pinturas pared, aplicación mediante rodillo o brocha,

Más detalles

CALIDAD DEL AIRE: DETERMINA N CIÓN DE AMONIACO EN EL ENTORNO DE LA

CALIDAD DEL AIRE: DETERMINA N CIÓN DE AMONIACO EN EL ENTORNO DE LA CALIDAD DEL AIRE: DETERMIN ACIÓN NA DE AMONIACO EN EL ENTORNO DE LA U.P.T. AS PONTES Octubre 2014 INDICE 1. INTRODUCCIÓN 3 2. OBJETIVOS 6 3. TÉCNICA DE MUESTREO 7 a. Componentes del sistema de muestreo

Más detalles

SOLUCIONES AGRICULTURA RECOMENDACIONES EN SISTEMAS DE IRRIGACIÓN PARA EL CULTIVO DE MAÍZ

SOLUCIONES AGRICULTURA RECOMENDACIONES EN SISTEMAS DE IRRIGACIÓN PARA EL CULTIVO DE MAÍZ SOLUCIONES AGRICULTURA RECOMENDACIONES EN SISTEMAS DE IRRIGACIÓN PARA EL CULTIVO DE MAÍZ www.azud.com 00000345 El maíz es un cultivo de la familia de las gramíneas procedente de América central y con miles

Más detalles

Avances en la utilización de ensilados ácidos en alimentos extruidos para pacú. (Piaractus mesopotamicus)

Avances en la utilización de ensilados ácidos en alimentos extruidos para pacú. (Piaractus mesopotamicus) Avances en la utilización de ensilados ácidos en alimentos extruidos para pacú (Piaractus mesopotamicus) RESUMEN Se presentan los resultados de una experiencia de engorde de pacú realizada en sistema semi-intensivo

Más detalles

Producción de hongo comestible Pleurotus spp en paja de arroz utilizando carpoforos extraídos de planta de producción

Producción de hongo comestible Pleurotus spp en paja de arroz utilizando carpoforos extraídos de planta de producción Producción de hongo comestible Pleurotus spp en paja de arroz utilizando carpoforos extraídos de planta de producción INSTITUTO NACIONAL DE APRENDIZAJE Núcleo de Formación y Servicios Tecnológicos Agropecuarios

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

página 66 Diagrama de flujo. Elaboración de quesos frescos y quesos curados

página 66 Diagrama de flujo. Elaboración de quesos frescos y quesos curados página 66 Diagrama de flujo. Elaboración de quesos frescos y quesos curados descripción de los procesos de la línea de elaboración de quesos frescos y quesos curados Recogida de la leche En la recogida

Más detalles

Método 13. Ramón Varela

Método 13. Ramón Varela Método 13 Determinación de CloroFILA a y Feopigmentos Ramón Varela Introducción La determinación de clorofila a se emplea para estimar la biomasa de los productores primarios (fitoplancton) que se encuentran

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

RESULTADOS Y DISCUSION. Los datos para la variable número de hojas por planta. Se recolectaron en 4 puntos al azar

RESULTADOS Y DISCUSION. Los datos para la variable número de hojas por planta. Se recolectaron en 4 puntos al azar IX. RESULTADOS Y DISCUSION 9.1. Número de hojas por planta Los datos para la variable número de hojas por planta. Se recolectaron en 4 puntos al azar por parcela en la parcela útil, muestreando 3 plantas

Más detalles

Sobre el capitulo 5, se puede encontrar los tratamientos estadísticos más completos en los

Sobre el capitulo 5, se puede encontrar los tratamientos estadísticos más completos en los Capitulo 5. Superficies de Respuesta Sobre el capitulo 5, se puede encontrar los tratamientos estadísticos más completos en los libros de Cornell (1990), Myers y Montgomery (1995) y en artículos de G.E.P.

Más detalles

32. Estudio cinético de la actividad invertasa de levadura de panadería.

32. Estudio cinético de la actividad invertasa de levadura de panadería. 32. Estudio cinético de la actividad invertasa de levadura de panadería. Manuel Tena Aldave, Jesús V. Jorrín Novo Departamento de Bioquímica y Biología Molecular, Campus Universitario de Rabanales, Edificio

Más detalles

nylosolv A Instrucciones para el ajuste de la relación de mezcla BASF Sistemas de Impresión

nylosolv A Instrucciones para el ajuste de la relación de mezcla BASF Sistemas de Impresión BASF Sistemas de Impresión ADDING VALUE TO YOUR PRODUCTS AGENTES DE LAVADO BASF PARA PLACAS DE IMPRESION FLEXOGRAFICA nylosolv A Instrucciones para el ajuste de la relación de mezcla Introducción nylosolv

Más detalles

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS.

NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. NMX-F-070-1964. MÉTODO DE PRUEBA PARA LA DETERMINACIÓN DE TIAMINA. THIAMINE DETERMINATION. TEST METHOD. NORMAS MEXICANAS. DIRECCIÓN GENERAL DE NORMAS. ASUNTO Con fundamento en lo dispuesto en los Artículos

Más detalles

1.2 En la primera reunión del CICUAE-UNSAM se elegirá un presidente

1.2 En la primera reunión del CICUAE-UNSAM se elegirá un presidente REGLAMENTO DEL COMITÉ INSTITUCIONAL PARA EL CUIDADO Y USO DE LOS ANIMALES EN EXPERIMENTACION DE LA UNIVERSIDAD NACIONAL DE SAN MARTIN (CICUAE- UNSAM) 1 El uso de animales para investigación y enseñanza

Más detalles

PROYECTO DE NORMA MEXICANA

PROYECTO DE NORMA MEXICANA ORGANISMO NACIONAL DE NORMALIZACIÓN DEL COFOCALEC PROYECTO DE NORMA MEXICANA PROY-NMX-F-721-COFOCALEC-2012 SISTEMA PRODUCTO LECHE - ALIMENTOS LÁCTEOS SUERO DE LECHE (LÍQUIDO O EN POLVO) ESPECIFICACIONES

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles