CIENCIA Y VIDA COTIDIANA

Tamaño: px
Comenzar la demostración a partir de la página:

Download "CIENCIA Y VIDA COTIDIANA"

Transcripción

1 CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008

2 . Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación. Transgénicos. Selección embriones

3 Genética: Parte de la biología que trata de la herencia y de lo relacionado con ella. Diccionario de la lengua española

4 Genética Transmisión Genes Semejanza entre progenitores y descendientes Van Gogh

5 Genética Variación Transmisión Genes porqué nos parecemos? porqué nos diferenciamos?

6 Que dos mellizos nazcan de distinto color es "un caso entre un millón", según algunos expertos. Pero la explicación es sencilla : La madre de los niños es mulata, lo que quiere decir que tiene una mezcla de genes de raza blanca y negra. Por eso pudo producir óvulos de cada color (uno con los genes que indican que la piel será negra, y otros con los genes que indican que será blanca). Dos de estos óvulos fueron fecundados por el padre: óvulo negro + espermatozoide blanco óvulo blanco + espermatozoide blanco

7 ADN

8 Ácido DesoxirriboNucléico

9

10

11 A T C G G C T A

12 A T A T C G C G G C G C T A T A

13 A T A T C G C G G C G C T A T A

14 Los genes están en los cromosomas Cromosoma Gen ADN

15 Cariotipo

16 Óvulo recién fertilizado aprox genes

17 espermatozoide óvulo Óvulo recién fertilizado (44 cromosomas + X + X ) (22 cromosomas + X ) (44 cromosomas + X + Y ) (22 cromosomas + X ó Y)

18 ? C C C C C C C C C C C C

19 Mujer óvulo Una célula cigoto embrión Cientos de miles de millones de células : más de 200 tipos distintos de células esperma Hombre Desarrollo embrionario Control genético

20 Una célula Cigoto embrión Cientos de miles de millones de células : más de 200 tipos distintos de células Desarrollo embrionario Control genético: genes

21 Bacterias ( genes) Levaduras ( genes) Gusanos ( genes) Moscas ( genes) Gallo ( genes) Ratón ( genes) Perros ( genes) Chimpancé ( genes) Humanos ( genes) Plantas ( genes)

22 nucleótidos GCAACTTCGGGATTCACTGCCACCT CGTTGAAGCCCTAAGTGACGGTGGA.. aminoácidos aa 1 aa 2 aa 3 aa 4 aa Código genético proteína

23 Febrero 2001

24 Revisado: 12 febrero 2008

25 Nuestro genoma tiene tres mil millones de bases (unos genes) Entre dos personas cualesquiera hay más de 20 millones de nucleótidos de diferencia, que se agrupan en regiones del genoma.

26 GCAACTTCGGGATTCACTGCCACCT CGTTGAAGCCCTAAGTGACGGTGGA.. GCAACTTCGTGATTCACTGCCACCT CGTTGAAGCACTAAGTGACGGTGGA..

27 Genética forense Polimorfismos Persona 1 Persona 2 Persona 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT GCCAGCTAGCTAGCTAGCTAGCTTTCAT GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTTTCAT

28 7 6 5

29 Genética forense

30 Forensic DNA Analysis

31 Probabilidad de encontrar dos individuos con el mismo perfil: < 10-13

32 A B C D Mancha de sangre 7,9 10,13 7,15 8,8 Sospechoso 1 8,9 10,10 9,10 11,12 Sospechoso 2 10,11 9,13 8,14 9,12 Sospechoso 3 7,9 10,13 7,15 8,8

33 A B C D Mancha de sangre 7,9 10,13 7,15 8,8 Sospechoso 1 8,9 10,10 9,10 11,12 Sospechoso 2 10,11 9,13 8,14 9,12 Sospechoso 3 7,9 10,13 7,15 8,8

34 De dónde se puede obtener ADN? Sangre Semen Saliva Orina Pelos Dientes Huesos Tejidos

35 . Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación. Transgénicos. Selección embriones

36 INGENIERÍA GENÉTICA Conjunto de técnicas que permiten la manipulación y transferencia de DNA de un organismo a otro.

37 Herramientas moleculares: Las enzimas de restricción

38 Los extremos cohesivos (protuberantes) facilitan la obtención de moléculas de DNA recombinante 5 3 G A A T T C C T T A A G G A A T T C C T T A A G A A T T C G G C T T A A A A T T C G G C T T A A 3 5

39 5 3 G C T T A A A A T T C G G A A T T C C T T A A G 3 5 Moléculas recombinantes o quiméricas

40 CLONACIÓN = AMPLIFICACIÓN

41 Dos etapas básicas en la clonación de fragmentos de DNA Digestión DNA foráneo 1. Construcción del DNA recombinante Ligación Inserto Vector

42 Cromosoma bacteria Plásmido recombinante

43 transgénicos

44

45 transgénicos

46 Vaca transgénica Gen para la proteína de interés Transgén inyectado En el óvulo del animal La vaca transgénica produce la proteína de interés en la leche

47 Se elimina el núcleo Oveja donante de óvulos A óvulo Oveja donante de células Se fusionan el óvulo sin núcleo y la célula célula Óvulo fusionado con la célula embrión Embrión implantado Oveja clónica

48 Preembriones humanos embrión in vitro constituido por el grupo de células resultantes de la división progresiva del ovocito desde que es fecundado hasta 14 días más tarde.

49 totipotentes días: Fertilización (día 1) 2 células 4 células blastocisto 128 células Implantación y formación de la placenta (día 7) mórula 8 células útero oviducto ovario

50 cigoto Células totipotentes embrión

51 Tipos de células Células Descripción Ejemplos Totipotentes Cada célula puede originar un nuevo individuo Células de los embriones tempranos (1-3,4 días)

52 Tipos de células Células Descripción Ejemplos Totipotentes Pluripotentes Cada célula puede originar un nuevo individuo Las células pueden formar cualquier tipo celular (unos 200, aprox.) Células de los embriones tempranos (1-3,4 días) Algunas células del blastocisto (5 a 14 dias)

53 Tipos de células Células Descripción Ejemplos Totipotentes Pluripotentes Cada célula puede originar un nuevo individuo Las células pueden formar cualquier tipo celular (unos 200, aprox.) Células de los embriones tempranos (1-3,4 días) Algunas células del blastocisto (5 a 14 dias)

54 totipotentes pluripotentes días: Fertilización (día 1) 2 células 4 células blastocisto 128 células Implantación y formación de la placenta (día 7) mórula 8 células útero oviducto ovario

55 Tipos de células Células Descripción Ejemplos Totipotentes Pluripotentes Multipotentes Cada célula puede originar un nuevo individuo Las células pueden formar cualquier tipo celular (unos 200, aprox.) Células diferenciadas, pero que pueden originar otros tipos de tejidos Células de los embriones tempranos (1-3,4 días) Algunas células del blastocisto (5 a 14 dias) Tejido fetal, cordón umbilical y células madres de adultos

56 Expresión genes del embrión días: Fertilización (día 1) 2 células 4 células blastocisto 128 células Implantación y formación de la placenta (día 7) mórula 8 células útero oviducto ovario

57 Prevención y tratamiento de enfermedades de origen genético Los centros debidamente autorizados podrán practicar técnicas de diagnóstico preimplantacional (DGP) para: a) La detección de enfermedades hereditarias graves, de aparición precoz y no susceptibles de tratamiento curativo posnatal con arreglo a los conocimientos científicos actuales, con objeto de llevar a cabo la selección embrionaria de los preembriones no afectos para su transferencia. b) La detección de otras alteraciones que puedan comprometer la viabilidad del preembrión

58 Diagnóstico genético preimplantacional (DGP) La técnica consiste en extraer una o dos células de un embrión de más de seis células, para analizar su material genético

59

60 Se extrae una célula del embrión, para analizar afectado afectado afectado afectado no afectado no afectado Se utilizan sólo los embriones no afectados

61

62 Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR

63 Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR

64 mujer X Y hombre FISH: hibridación in situ con sondas fluorescentes de ADN

65 GCAACTTCGGGATTCACTGCCACCT CGTTGAAGCCCTAAGTGACGGTGGA.. GCAACTTCGGGATTCACTGCCACCT CCTAAGTGACG

66 ANOMALÍAS CROMOSÓMICAS (cromosomas sexuales) 46, XX normal 46, XY normal 45, X Síndrome Turner 47, XXY Síndrome Klinefelter

67 PGD Monosomía Trisomía

68 ANOMALÍAS CROMOSÓMICAS (autosomas) 46, XX normal 46, XY normal 47, XY, +13 Síndrome de Patou 47, XY, +18 Síndrome de Edwards

69 Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR

70 DNA PCR

71 Autosómicas recesivas ( ) Fibrosis Quística Talasemias Anemia Falciforme Autosómicas dominantes ( ) Distrofia Miotónica o Enfermedad de Steinert Huntington Recesivas ligadas al cromosoma X Síndrome del X frágil Distrofia Muscular de Duchenne (DMD) XY XX Hemofilia A XY XX XY XX

72

73 La fibrosis quística (abreviatura FQ), también conocida como mucoviscidosis es una enfermedad hereditaria frecuente que afecta al organismo en forma generalizada, causando discapacidad progresiva y muerte prematura. La dificultad para respirar es el síntoma más común, emergente de infecciones pulmonares crónicas, las cuales pueden mostrarse resistentes al tratamiento con antibióticos y otros fármacos. La FQ es un trastorno multisistémico que causa la formación y acumulación de un moco espeso y pegajoso, afectando fundamentalmente pulmones, intestinos, páncreas e hígado.

74 Aproximadamente, una de cada 25 personas de ascendencia europea es portadora asintomática de un gen para FQ, siendo la enfermedad genética más frecuente entre esta población. I II

75 TAGTATCCTTTGTGGTTTCTACTAT ATCATAGGAAACACCAAAGATGATA.. TAGTATCCTTTGTGGTTACTAT ATCATAGGAAACACCAATGATA.. pérdida de un aminoácido

76 DGP

77 Se extrae una célula del embrión, para analizar afectado no afectado no afectado afectado Se utilizan sólo los embriones no afectados

78 Clonación terapéutica: células madre

79 diferenciación Células internas (pluripotentes) día 1 óvulo fertilizado día 5,6 blastocisto sangre hígado neuronas páncreas Intestino Células músculo cardíaco Células renales

80 Mujer Quitar núcleo Cigoto clónico Bebé clónico ó Insertar núcleo Embrión clónico día 5,6 blastocisto Célula somática (piel, músculo, etc..) Mujer óvulo cigoto embrión esperma Hombre

81

82

83 Mujer Quitar núcleo Cigoto clónico Bebé clónico ó Insertar núcleo Embrión clónico día 5,6 blastocisto Célula somática (piel, músculo, etc..) Clonación reproductiva

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Genética para andar por casa... y 3 Murcia, 17 de diciembre de 2012. Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos.

Más detalles

Y después de la secuencia, qué?

Y después de la secuencia, qué? Y después de la secuencia, qué? Nuestros genomas no son iguales Persona 1 Persona 2 = Variaciones en el ADN Qué tipo de variaciones? Secuencia estándar Variaciones: Cambios de una base por otra: Polimorfismos

Más detalles

Genética, Medicina y Sociedad (Síntesis).

Genética, Medicina y Sociedad (Síntesis). Genética, Medicina y Sociedad (Síntesis). Biología. Curtis, et al. (2008). Editorial Médica Interamericana. 7ª Ed. Cap. 16. Por lo general, los principios de la genética son los mismos para cualquier ser

Más detalles

CIENCIA Y VIDA COTIDIANA

CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Dieta genética para prevenir enfermedades? La clonación, el ADN y otras cosas Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética

Más detalles

ENFERMEDADES GENÉTICAS

ENFERMEDADES GENÉTICAS ENFERMEDADES GENÉTICAS Inicio INDICE 1 Que es una enfermedad genética? 1.1Enfermedades cromosómicas 1.2Enfermedades monogenicas 2. como se heredan? 2.1 Herencia dominante 2.2 Herencia recesiva 2.3 Herencia

Más detalles

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD)

DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) Las alteraciones genéticas son una importante causa de esterilidad e infertilidad y pueden ser responsables de algunos defectos congénitos. Estas alteraciones

Más detalles

CARTERA DE SERVICIOS, TARIFAS Y CÓDIGOS DE FACTURACIÓN 2015

CARTERA DE SERVICIOS, TARIFAS Y CÓDIGOS DE FACTURACIÓN 2015 CARTERA DE SERVICIOS, TARIFAS Y CÓDIGOS DE FACTURACIÓN 2015 Enero 2015 CARTERA DE SERVICIOS, TARIFAS Y CÓDIGOS DE FACTURACIÓN 2015 A) DIAGNÓSTICO GENÉTICO PREIMPLANTACIONAL PARA ANÁLISIS DE ANEUPLOIDÍAS.

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles

UNIDAD 7 LA DIGNIDAD DE LA VIDA

UNIDAD 7 LA DIGNIDAD DE LA VIDA UNIDAD 7 LA DIGNIDAD DE LA VIDA A) EL EMBRIÓN: fecundación Espermatozoides llegando al ovocito Concepción La carrera por la vida... "Desde el momento mismo de la fecundación, desde el instante en que a

Más detalles

ESTUDIAR LOS GENES PARA PREVENIR UNA DISCAPACIDAD

ESTUDIAR LOS GENES PARA PREVENIR UNA DISCAPACIDAD GENÉTICA Y HERENCIA ESTUDIAR LOS GENES PARA PREVENIR UNA DISCAPACIDAD En los últimos años nuestra sociedad ha sido testigo de una verdadera revolución científica en el campo de la genética. La posibilidad

Más detalles

DGP: Para tus hijos, evita riesgos

DGP: Para tus hijos, evita riesgos DGP: Para tus hijos, evita riesgos Ahora, con el Diagnóstico Genético Preimplantacional (DGP) podrás evitar los riesgos genéticos en tu descendencia. Salud de la mujer Dexeus Salud de la mujer Dexeus DEPARTAMENTO

Más detalles

BIOLOGÍA MOLECULAR. 1. Niveles de organización

BIOLOGÍA MOLECULAR. 1. Niveles de organización BIOLOGÍA MOLECULAR 1. Niveles de organización Como sabes, los seres humanos son organismos vivos pluricelulares capaces de realizar las funciones vitales de nutrición, relación y reproducción. Para el

Más detalles

APLICACIONES DE BIOTECNOLOGÍA EN MEDICINA Y REPRODUCCIÓN

APLICACIONES DE BIOTECNOLOGÍA EN MEDICINA Y REPRODUCCIÓN APLICACIONES DE BIOTECNOLOGÍA EN MEDICINA Y REPRODUCCIÓN APLICACIONES EN MEDICINA Y REPRODUCCIÓN TERAPIA GÉNICA CLONACIÓN TERAPÉUTICA CÉLULAS MADRE DIAGNÓSTICO GENÉTICO DIAGNÓSTICO GENÉTICO PREIMPLANTACIONAL

Más detalles

Iván Ferrer Rodríguez, Ph.D. Catedrático

Iván Ferrer Rodríguez, Ph.D. Catedrático Iván Ferrer Rodríguez, Ph.D. Catedrático La base cromosomal de la herencia Reece, Urry, Cain, Wasserman, Minorsky, Jackson, 2009 Campbell Biology 9 th Edition Chomosomas 2 Base cromosomal de las leyes

Más detalles

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano ÍNDICE ADN - Historia del ADN - Qué es el ADN? - De qué está formado? - Qué función tiene? Ingeniería genética - Qué es la ingeniería genética?

Más detalles

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por Una informació n elaborada por Museos Científicos Coruñeses Monografías de Comunicación Científica 04 Edición realizada con el patrocinio de clonación humana El 13 de febrero de 2004 todos los medios de

Más detalles

Proyecto GENOMA HUMANO

Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

Enfermedades asociadas a mutaciones estructurales

Enfermedades asociadas a mutaciones estructurales Enfermedades asociadas a mutaciones estructurales El cariotipo humano A partir de un cultivo de sangre periférica, y posterior tratamiento con Giemsa para obtener un bandeo G, puede obtenerse el cariotipo

Más detalles

BIOTECNOLOGIA PECUARIA

BIOTECNOLOGIA PECUARIA 1ro9ber4to5 BIOTECNOLOGIA PECUARIA La demanda por productos animales ha crecido constantemente y es necesario incrementar la cantidad y calidad de estos productos. En este contexto, en los últimos 20 años

Más detalles

EL COMIENZO DE LA GENÉTICA Después de Mendel DOMINANCIA INCOMPLETA

EL COMIENZO DE LA GENÉTICA Después de Mendel DOMINANCIA INCOMPLETA TEMA 5 (2) EL COMIENZO DE LA GENÉTICA Después de Mendel Dominancia incompleta Series alelicas Herencia de los grupos sanguíneos Herencia ligada al sexo Mutaciones DOMINANCIA INCOMPLETA Muchas características

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Genealogías y clonación.

Genealogías y clonación. Curso: Biología Mención Material Nº 6 Unidad V. Variabilidad y Herencia. Genealogías y clonación.. GENEALOGÍAS. El hombre, sin haber tenido conocimiento alguno de genética, siempre se ha preocupado de

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Su clínica local: www.aegh.org/docs/encuesta-aegh-2005-centros-y-personasde-contacto.pdf Herencia Ligada al Cromosoma X www.aegh.org/docs/encue sta-aegh-2005-servicios-degenetica-clinica.pdf Elaborado

Más detalles

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA

LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA AULA DE MAYORES Y DE LA EXPERIENCIA F.Córdoba, R.Torronteras, A.Canalejo Departamento de Biología Ambiental y Salud Pública LOS RETOS DE LA BIOMEDICINA: ENTRE LA CIENCIA Y LA ÉTICA Tema 1.4. La transmisión

Más detalles

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros)

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Departamento de Biología Ambiental y Salud Pública EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Acabo de nacer: Qué haya suerte! Todo se lo debo a mis padres: fecundación y formación

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Herencia Ligada al Cromosoma X Elaborado a partir de folletos originales de Guy s and St Thomas Hospital, Londres y London IDEAS Genetic Knowledge Park. Enero de 2008 Este trabajo se ha realizado bajo

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/

Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ 4º E.S.O. Biología y Geología - Unidad 5.- La herencia biológica Actividades de clase para realizar con ordenador: http://iessuel.org/ccnn/ Alumno/a... Fecha... 1.- Completa: Todos los seres vivos tienen

Más detalles

Diagnóstico Genético Preimplantacional Indicaciones Actuales. Dr. Joaquín Moreno Valencia Febrero 2009

Diagnóstico Genético Preimplantacional Indicaciones Actuales. Dr. Joaquín Moreno Valencia Febrero 2009 Diagnóstico Genético Preimplantacional Indicaciones Actuales Dr. Joaquín Moreno Valencia Febrero 2009 DGP El diagnóstico Genético Preimplantacional(DGP) se presenta como una forma muy precoz de diagnóstico

Más detalles

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA ACTIVIDADES FINALES: GENÉTICA HUMANA 1.- Un varón de ojos azules, cuyos padres tenían ojos oscuros, se casa con una mujer de ojos oscuros, cuyo padre tenía ojos azules. Esta mujer tiene un hermano de ojos

Más detalles

Diagnóstico Preimplantacional. La mejor solución?

Diagnóstico Preimplantacional. La mejor solución? Diagnóstico Preimplantacional. La mejor solución? María José Trujillo Tiebas. Servicio de Genética Fundación Jiménez Díaz, Madrid. CONSULTA GENÉTICA: Antecedentes familiares Edades de los padres Consanguinidad

Más detalles

PREGUNTAS TEST DE LOS TEMAS 11 AL 15

PREGUNTAS TEST DE LOS TEMAS 11 AL 15 PREGUNTAS TEST DE LOS TEMAS 11 AL 15 1. El número diploide de la especie humana se restablece durante la: a. Gametogénesis. b. Fecundación del óvulo por el espermatozoide. c. Mitosis. d. Meiosis. 2. El

Más detalles

CAP ITULO XII HERENCIA

CAP ITULO XII HERENCIA CAP ITULO XII HERENCIA Algunas enfermedades son genéticas en origen y por lo tanto son transmitidas en familias. La mayoría de las enfermedades de inmunodeficiencia son heredades en alguno de los dos diferentes

Más detalles

El diagnóstico genético preimplantacional (DGP), una oportunidad en cáncer hereditario?

El diagnóstico genético preimplantacional (DGP), una oportunidad en cáncer hereditario? Se han revisado sus beneficios y limitaciones en una jornada de Unidades de Consejo Genético en Cáncer Familiar, organizada por la SEOM con el apoyo del Instituto Roche El diagnóstico genético preimplantacional

Más detalles

NEFROPATÍA POR MUTACIONES EN EL GEN HNF1B

NEFROPATÍA POR MUTACIONES EN EL GEN HNF1B 46 NEFROPATÍA POR MUTACIONES EN EL GEN HNF1B 10 Introducción: El gen HNF1b codifica información para la síntesis del factor hepatocitario nuclear 1b, que es un factor de transcripción involucrado en la

Más detalles

PATIENT EDUCATI The American College of Obstetricians and Gynecologists

PATIENT EDUCATI The American College of Obstetricians and Gynecologists PATIENT EDUCATI N The American College of Obstetricians and Gynecologists WOMEN S HEALTH CARE PHYSICIANS El Embarazo SP094 Los trastornos genéticos La mayoría de los niños en Estados Unidos nacen saludables.

Más detalles

Gen: Fragmento de ADN que contiene la información para la construcción de una proteína. Es la unidad biológica de la herencia.

Gen: Fragmento de ADN que contiene la información para la construcción de una proteína. Es la unidad biológica de la herencia. RESUMEN DÉCIMO Conceptos de genética: Genética: Rama de la biología que estudia la transmisión de los caracteres hereditarios o herencia Código genético: Es la secuencia de bases nitrogenadas que existe

Más detalles

Antes del embarazo Pre - concepción

Antes del embarazo Pre - concepción Antes del embarazo Pre - concepción Cariotipo en la pareja con dificultades para concebir Qué es un cariotipo? Es el estudio que permite detectar anomalías en el número o en la forma de los cromosomas.

Más detalles

CONTENIDOS PRUEBA DE CIENCIA

CONTENIDOS PRUEBA DE CIENCIA CONTENIDOS PRUEBA DE CIENCIA CONTENIDOS DE BIOLOGÍA PRIMERO MEDIO I Organización, Estructura y Actividad Celular 1 La célula como unidad funcional a. Estructuras y funciones comunes a células animales

Más detalles

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante.

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante. Temáticas que se revisarán: Universidad Nacional Abierta y a Distancia Especialización en Mejoramiento Genético Ingeniería genética Agropecuaria Luz Mery Bernal Parra Curso: Ingeniería genética Agropecuaria

Más detalles

TEMA 4 CMC BIOTECNOLOGÍA

TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

I. En qué consiste? FECUNDACIÓN IN VITRO

I. En qué consiste? FECUNDACIÓN IN VITRO FECUNDACIÓN IN VITRO I. En qué consiste? La Fecundación in Vitro es un tratamiento que consta de procedimientos médicos y biológicos destinados a facilitar la unión de óvulos (ovocitos) y espermatozoides

Más detalles

FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA

FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA Departamento de Biología Ambiental y Salud Pública FUNDAMENTOS BIOLÓGICOS DEL APRENDIZAJE Y LA MEMORIA INTRODUCCIÓN. Genes y ambiente. Las cualidades heredadas y los efectos de la experiencia. El sustrato

Más detalles

CUESTIONES TEMA 4: La revolución genética y la biotecnología.

CUESTIONES TEMA 4: La revolución genética y la biotecnología. CUESTIONES TEMA 4: La revolución genética y la biotecnología. 1. El ADN no puede salir del núcleo: Cómo logra llevar a los ribosomas que están en el citoplasma la información que porta? 2. El individuo

Más detalles

Nace, por primera vez en España, un hijo libre de la enfermedad genética CADASIL gracias a un diagnóstico genético preimplantacional previo

Nace, por primera vez en España, un hijo libre de la enfermedad genética CADASIL gracias a un diagnóstico genético preimplantacional previo Dossier de prensa Nace, por primera vez en España, un hijo libre de la enfermedad genética CADASIL gracias a un diagnóstico genético preimplantacional previo Sumario: Páginas 2 y 3: Nota de prensa Página

Más detalles

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D.

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D. Formación de una nueva vida:concepción,herencia y ambiente Janette Orengo Puig,Ed.D. Cambios en la teoría de concepción Concepción- (fertilización)-es el proceso por medio del cual el espermatozoide y

Más detalles

Asignatura: DISFUNCIONES SEXUALES ORGANICAS

Asignatura: DISFUNCIONES SEXUALES ORGANICAS Universidad de Salamanca Facultad de Medicina Asignatura: DISFUNCIONES SEXUALES ORGANICAS Tema: Técnicas de reproducción asistida Dra. Carmen Lopez Sosa Medica sexóloga http://campus.usal.es/~sexologia/

Más detalles

DE LA PEÑA LOZANO, MARÍA MARTÍNEZ MONTERO,TANIA OTERO AMADO, ÁNGELA PÉREZ-CARRASCO LLORENTE, LOLA SEGOVIA PASTOR, ISABEL MARÍA

DE LA PEÑA LOZANO, MARÍA MARTÍNEZ MONTERO,TANIA OTERO AMADO, ÁNGELA PÉREZ-CARRASCO LLORENTE, LOLA SEGOVIA PASTOR, ISABEL MARÍA DE LA PEÑA LOZANO, MARÍA MARTÍNEZ MONTERO,TANIA OTERO AMADO, ÁNGELA PÉREZ-CARRASCO LLORENTE, LOLA SEGOVIA PASTOR, ISABEL MARÍA ÍNDICE INTRODUCCIÓN CROMOSOMA X Patrón clásico de transmisión Dominante/ Recesivo

Más detalles

RESUMEN GAMETOGÉNESIS, FECUNDACIÓN Y DESARROLLO TEMPRANO

RESUMEN GAMETOGÉNESIS, FECUNDACIÓN Y DESARROLLO TEMPRANO LICEO INDUSTRIAL DE SAN MIGUEL AGUSTIN EDWARDS ROSS DEPTO. PEDAGÓGICO RESUMEN GAMETOGÉNESIS, FECUNDACIÓN Y DESARROLLO TEMPRANO En la mayoría de las plantas y animales, cuando ciertas células se dividen,

Más detalles

BASES CROMOSOMICAS DE LA HERENCIA

BASES CROMOSOMICAS DE LA HERENCIA UNIDAD 4 BASES CROMOSOMICAS DE LA HERENCIA Observa el siguiente grafico y responde a las siguientes preguntas Que observas en los diagramas A,B,C, y D Qué sucede con las mariposas desde el diagrama A al

Más detalles

Fig. 3: En la F2 encontró machos y hembras con ojos color rojo y solamente machos con ojos color blanco.

Fig. 3: En la F2 encontró machos y hembras con ojos color rojo y solamente machos con ojos color blanco. Padres Escolapios Depto. De Ciencias - Biología. Nivel: 3ero medio Unidad 0 Guía 2 Marzo de 2010 1 Capítulo III: Herencia ligada al Sexo: Existen características determinadas por genes que se encuentran

Más detalles

Opción Múltiple Revisión Genética Mendeliana y Patrones de Herencia

Opción Múltiple Revisión Genética Mendeliana y Patrones de Herencia Opción Múltiple Revisión Genética Mendeliana y 1. Jean-Baptiste Lamarck introdujo una teoría acerca de la herencia a principios de 1800. Cuál de las siguientes describe con precisión su Teoría de los caracteres

Más detalles

GENÉTICA. 4º de ESO Mercedes Macías

GENÉTICA. 4º de ESO Mercedes Macías GENÉTICA 4º de ESO Mercedes Macías Contenidos Los cromosomas: Cromosomas homólogos Autosomas y heterocromosomas, el cariotipo Anomalías cromosómicas. Las mutaciones. Los genes: Los alelos: Dominantes,

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

Anomalías cromosómicas humanas

Anomalías cromosómicas humanas Anomalías cromosómicas humanas Una anomalía común es la causada por la no disyunción (la falta de segregación) de un cromosoma durante la anafase II de la meiosis. Un gameto al cual le falta un cromosoma

Más detalles

Paralelismo entre cromosomas y la teoria de Mendel

Paralelismo entre cromosomas y la teoria de Mendel Paralelismo entre cromosomas y la teoria de Mendel Cromosomas sexuales Autosomas Herencia ligada al sexo Cromosomas heteromorfos Nettie Stevens, 1909 Estudios en Drosophila, mosca del vinagre Thomas Hunt

Más detalles

GUÍA DE ESTUDIO #1 (15%) APELLIDOS: NOMBRES: CÉDULA: SECCIÓN: NÚMERO DE LISTA:

GUÍA DE ESTUDIO #1 (15%) APELLIDOS: NOMBRES: CÉDULA: SECCIÓN: NÚMERO DE LISTA: República Bolivariana de Venezuela Ministerio del Poder Popular para la Educación U.E. Colegio Santo Tomás de Villanueva Departamento de Ciencias Cátedra: Ciencias Biológicas Año: 3 A, B y C Prof. Luis

Más detalles

BLOQUE 3: LA HERENCIA. GENÉTICA MOLECULAR.

BLOQUE 3: LA HERENCIA. GENÉTICA MOLECULAR. BLOQUE 3: LA HERENCIA. GENÉTICA MOLECULAR. TEMA 7: HERENCIA MENDELIANA. CEA GARCÍA ALIX TRANSMISIÓN DEL MATERIAL HEREDITARIO Tema 7.- Herencia Mendeliana. 1.- Leyes de Mendel (Uniformidad de la primera

Más detalles

UNIDAD 13: LA REPRODUCCIÓN HUMANA

UNIDAD 13: LA REPRODUCCIÓN HUMANA UNIDAD 13: LA REPRODUCCIÓN HUMANA 1. FECUNDACIÓN Y DESARROLLO EMBRIONARIO En los humanos la fecundación es interna, es decir, ocurre dentro del cuerpo de la mujer después de realizar el acto sexual. Tiene

Más detalles

ASPECTOS CIENTÍFICOS SOBRE EL INICIO DE LA VIDA HUMANA

ASPECTOS CIENTÍFICOS SOBRE EL INICIO DE LA VIDA HUMANA ASPECTOS CIENTÍFICOS SOBRE EL INICIO DE LA VIDA HUMANA LAS CÉLULAS DE LA FECUNDACIÓN Los protagonistas de la fecundación son los gametos masculinos y femeninos maduros que han terminado un complejo proceso

Más detalles

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes:

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes: TEMA 4: AVANCES BIOMÉDICOS 1.- TRASPLANTES DE ÓRGANOS Trasplante o injerto en medicina es un tratamiento médico complejo que consiste en trasladar órganos, tejidos o células de una persona a otra. El órgano

Más detalles

CÉLULAS TRONCALES, STEM CELLS, CÉLULAS MADRE

CÉLULAS TRONCALES, STEM CELLS, CÉLULAS MADRE CÉLULAS TRONCALES, STEM CELLS, CÉLULAS MADRE Marcelo Palacios (España) Presidente del Comité Científico de la Sociedad Internacional de Bioética (SIBI) GIJON, ESPAÑA OBTENCIÓN Y CARACTERÍSTICAS De diversos

Más detalles

BIOTECNOLOGÍA Y GENÉTICA MOLECULAR

BIOTECNOLOGÍA Y GENÉTICA MOLECULAR BIOTECNOLOGÍA Y GENÉTICA MOLECULAR Conceptos de biotecnología y genética molecular. Importancia y beneficios de la biotecnología. Genética y Tecnología del DNA recombinante: estrategias de clonación. Enzimas

Más detalles

DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE

DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE Anna Veiga Servei de Medicina de la Reproducció - Institut Universitari Dexeus Centre de Medicina Regenerativa de Barcelona Barcelona HISTORIA 1878 Primeros

Más detalles

Análisis de portadores

Análisis de portadores 16 Análisis de portadores Estamos especialmente agradecidos a las personas que han permitido ser entrevistadas para la realización de este documento. Todos los nombres han sido eliminados para proteger

Más detalles

DESCRIPCIÓN GENERAL DE LAS ANOMALÍAS CROMOSÓMICAS

DESCRIPCIÓN GENERAL DE LAS ANOMALÍAS CROMOSÓMICAS ANOMALÍAS CROMOSÓMICAS INTRODUCCION Cualquier alteración en el número y/o en la morfología de los cromosomas constituye una alteración cromosómica. Cuando existen uno o más juegos de cromosomas completos,

Más detalles

12. Cómo pueden diferenciarse dos individuos, uno homocigótico de otro heterocigótico, que presentan el mismo fenotipo. Razonar la respuesta

12. Cómo pueden diferenciarse dos individuos, uno homocigótico de otro heterocigótico, que presentan el mismo fenotipo. Razonar la respuesta PROBLEMAS DE GENÉTICA: PRIMERA Y SEGUNDA LEYES DE MENDEL 1. En cierta especie de plantas el color azul de la flor, (A), domina sobre el color blanco (a) Cómo podrán ser los descendientes del cruce de plantas

Más detalles

regenerativa Medicina Especial Preguntas frecuentes Número 7 Tipos de células madre Preguntas Frecuentes Glosario

regenerativa Medicina Especial Preguntas frecuentes Número 7 Tipos de células madre Preguntas Frecuentes Glosario Medicina regenerativa Número 7 Tipos de células madre Preguntas Frecuentes Glosario Especial Todos hemos oído hablar de la extraordinaria promesa que constituye la investigación con células madre para

Más detalles

1. Los individuos que manifiestan un carácter recesivo, Son homocigotos o heterocigotos para el carácter? Por qué?

1. Los individuos que manifiestan un carácter recesivo, Son homocigotos o heterocigotos para el carácter? Por qué? 1. Los individuos que manifiestan un carácter recesivo, Son homocigotos o heterocigotos para el carácter? Por qué? 2. La acondroplasia es una forma de enanismo debida a un crecimiento anormalmente pequeño

Más detalles

FORMACIÓN ACADÉMICA TALLER 1 AREA DE CIENCIAS NATURALES Y EDUCACIÓN AMBIENTAL GRADO OCTAVO PERIODO 01 NOMBRE:

FORMACIÓN ACADÉMICA TALLER 1 AREA DE CIENCIAS NATURALES Y EDUCACIÓN AMBIENTAL GRADO OCTAVO PERIODO 01 NOMBRE: FORMACIÓN ACADÉMICA TALLER 1 PFA-01-R04 Versión 01 AREA DE CIENCIAS NATURALES Y EDUCACIÓN AMBIENTAL GRADO OCTAVO PERIODO 01 NOMBRE: CAPACIDADES Razonar lógica y científicamente EJE Celular DESTREZAS Compara

Más detalles

1. CONCEPTOS BÁSICOS EN GENÉTICA CLÁSICA

1. CONCEPTOS BÁSICOS EN GENÉTICA CLÁSICA GENÉTICA MENDELIANA La genética mendeliana o clásica es la ciencia que establece las leyes que explican la herencia biológica, es decir, la forma en que los caracteres de los progenitores aparecen en sus

Más detalles

con número de expediente MIDTF/2011/212

con número de expediente MIDTF/2011/212 La investigación biomédica es una actividad necesaria para el éxito de cualquier estrategia que se proponga mejorar la salud de los ciudadanos. En este sentido, IVI VALENCIA, S.L. apuesta fuertemente por

Más detalles

EL MATERIAL GENÉTICO:

EL MATERIAL GENÉTICO: LA HUELLA GENÉTICA: PRUEBAS DE PATERNIDAD E IDENTIFICACIÓN INTRODUCCIÓN: En éstos últimos años, se ha popularizado a través de los medios de comunicación la expresión: identificación través de pruebas

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles

Diagnóstico genético de preimplantación (DGP)

Diagnóstico genético de preimplantación (DGP) Avances EFICAZ OPCIÓN PARA PACIENTES QUE PRESENTAN ALTO RIESGO DE INFERTILIDAD O ESTERILIDAD Diagnóstico genético de preimplantación (DGP) Equipo Diagnóstico Genético de Preimplantación Dra Claudia Perandones

Más detalles

COMPLEMENTACION CONTENIDOS 2 MEDIO DEPTO. DE BIOLOGÍA. Anormalidades cromosómicas

COMPLEMENTACION CONTENIDOS 2 MEDIO DEPTO. DE BIOLOGÍA. Anormalidades cromosómicas COMPLEMENTACION CONTENIDOS 2 MEDIO DEPTO. DE BIOLOGÍA Anormalidas cromosómicas Ciertas enfermedas genéticas son causadas por anormalidas en el número o en la estructura los cromosomas que son tan graves,

Más detalles

LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA

LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA Fecha: 13 de Abril de 2011 Nombre: Dra. Ana Cardo Maza R3 Tipo de Sesión: Seminario LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA CAPÍTULO 1- DISPOSICIONES GENERALES Objeto de la

Más detalles

DÍAS DEST DÍA S DEST C A ADOS DICIEMBRE 2 ABRIL 2013 012

DÍAS DEST DÍA S DEST C A ADOS DICIEMBRE 2 ABRIL 2013 012 DÍAS DESTACADOS DICIEMBRE 20132012 02 DÍA MUNDIAL DE CONCIENCIACIÓN SOBRE EL AUTISMO 07 DÍA MUNDIAL DE LA SALUD 11 DÍA MUNDIAL DEL PARKINSON 17 DÍA MUNDIAL DE LA HEMOFILIA 24 DÍA NACIONAL DE LA FIBROSIS

Más detalles

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica

Terapia Génica. Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica Terapia Génica Dra. Lizbeth Salazar-Sànchez Escuela de Medicina Universidad de Costa Rica 5/8/2015 Gen Esta en un cromosoma Es la unidad base de la Herencia Codificación, proteína DNA RNA proteins Proteínas,

Más detalles

Introducción. En pocas palabras: sí!

Introducción. En pocas palabras: sí! Novedades en la investigación de la EH. En lenguaje sencillo. Escrito por científicos. Para toda la comunidad EH. Tener hijos: crear una familia, al estilo EH Tener hijos: El artículo de HDBuzz sobre técnicas

Más detalles

Módulo 10 Unidad Temática 10

Módulo 10 Unidad Temática 10 Universidad Nacional del Nordeste Facultad de Medicina Especialización en Bacteriología Clínica Módulo 10 Unidad Temática 10 Fibrosis quística Neumonías atípicas Fibrosis Quística Originalmente se denomina

Más detalles

Fecha de impresión : Jueves, 09 de Julio 2009. Distrofia muscular. Definición. Diagnóstico

Fecha de impresión : Jueves, 09 de Julio 2009. Distrofia muscular. Definición. Diagnóstico Fecha de impresión : Jueves, 09 de Julio 2009 Distrofia muscular Definición Diagnóstico Qué le pasa al bebé? Distrofia muscular miotónica: Distrofia muscular de Duchenne: Distrofia muscular de Becker:

Más detalles

Tema 5 Quién puede ser donante? La legislación Española !! Riesgos del transplante Rechazo inmunológico: Escasez de órganos:

Tema 5 Quién puede ser donante? La legislación Española !! Riesgos del transplante Rechazo inmunológico: Escasez de órganos: Tema 5 Quién puede ser donante? Suelen ser personas en muerte cerebral o alguien vivo La legislación Española Muerte cerebral Respeto a la voluntad del fallecido Diagnóstico de muerte hecho por otro equipo

Más detalles

A la vanguardia en la prevención de enfermedades genéticas

A la vanguardia en la prevención de enfermedades genéticas MEDICINA GENÓMICA TEST GENÉTICO DE PORTADORES A la vanguardia en la prevención de enfermedades genéticas Ref. 167/ Abril 2013 Si quieres recibir información más detallada, ponte en contacto con nuestro

Más detalles

Fibrosis Quística. Qué es la Fibrosis quística?

Fibrosis Quística. Qué es la Fibrosis quística? Fibrosis Quística GUERRERO VAZQUEZ J*, GUERRERO-FDEZ J.** * Pediatra. Algeciras (Cádiz). ** Médico Adjunto de Pediatría. Hospital infantil La Paz. Madrid. Fecha de publicación Octubre de 2002 Qué es la

Más detalles

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8 Evolución de la donación de órganos en España Europa: 19,2 EEUU: 25,8 REQUISITOS PARA EL TRASPLANTE Muerte encefálica Criterios médicos distribución Equipo médico independiente del trasplante Donación

Más detalles

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1

EDUCACION CONTINUADA. Introducción. Caso clínico nº 1 EDUCACION CONTINUADA L. Castaño, J.R. Bilbao, I. Urrutia An Esp Pediatr 1997;46:513-518. Introducción a la biología molecular y aplicación a la pediatría (5): Casos clínicos. Alteraciones genéticas en

Más detalles

Problema 1: Southern Blot. Problema 2: Paternidad.

Problema 1: Southern Blot. Problema 2: Paternidad. Problema 1: Southern Blot. En el análisis de DNA Fingerprint mediante la técnica de "Southern" Blot: A- El RNA celular es separado electroforéticamente y transferido a una membrana. Luego la membrana se

Más detalles

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5

INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles

Genética III: Genética humana

Genética III: Genética humana Genética III: Genética humana 1. Genética humana Los pedigrís se utilizan para mostrar la transmisión hereditaria de enfermedades humanas de base genética. En un pedigrí, se puede trazar el patrón de herencia

Más detalles

1. Genes y caracteres hereditarios.

1. Genes y caracteres hereditarios. 1. Genes y caracteres hereditarios. 1.1. Dos genes para un carácter. Los individuos diploides tienen dos genes alelomórficos (alelos) para un único carácter. Por ejemplo para el color de la piel existen

Más detalles

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia 5 JUN9.- Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran

Más detalles

INSTITUTO TECNICO INDUSTRIAL FRANCISCO JOSE DE CALDAS AREA DE CIENCIAS NATURALES Y EDUCACIÓN AMBIENTAL GRADO 9 TALLER 1 FUNDAMENTOS DE GENETICA

INSTITUTO TECNICO INDUSTRIAL FRANCISCO JOSE DE CALDAS AREA DE CIENCIAS NATURALES Y EDUCACIÓN AMBIENTAL GRADO 9 TALLER 1 FUNDAMENTOS DE GENETICA INSTITUTO TECNICO INDUSTRIAL FRANCISCO JOSE DE CALDAS AREA DE CIENCIAS NATURALES Y EDUCACIÓN AMBIENTAL GRADO 9 TALLER 1 FUNDAMENTOS DE GENETICA La genética es el campo de la biología que busca comprender

Más detalles

Secundarios - CBC - Universitarios - Informática - Idiomas. Apunte Nro 0742. Mendel. Ejercicios de genética.

Secundarios - CBC - Universitarios - Informática - Idiomas. Apunte Nro 0742. Mendel. Ejercicios de genética. Mendel. Ejercicios de genética. 1) La segunda ley de Mendel no se cumpliría si: a) los genes considerados estuvieran ubicados en distintos cromosomas b) los genes considerados estuvieran ubicados en un

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

Registro de la Sociedad Española de Fertilidad: Técnicas de reproducción asistida (IA y FIV/ICSI). Año 2.013

Registro de la Sociedad Española de Fertilidad: Técnicas de reproducción asistida (IA y FIV/ICSI). Año 2.013 Registro SEF Registro de la Sociedad Española de Fertilidad: Técnicas de reproducción asistida (IA y FIV/ICSI). Año 2.013 Informe estadístico final INDICE 1 Introducción... 3 2 Población en estudio...

Más detalles

MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de

MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de MARCO GARNIQUE MONCADA Máster en Reproducción Humana Ginecólogo del Servicio de Medicina Reproductiva del INMP Ginecólogo de CREA, Centro de Reproducción Asistida TRAS LA UNIÓN DE LOS GAMETOS EN ESTADÍO

Más detalles

Métodos de Reproducción Asistida más Usados

Métodos de Reproducción Asistida más Usados Métodos de Reproducción Asistida más Usados Entendemos por métodos de reproducción asistida, al conjunto de técnicas médicas, que tienen la finalidad de facilitar o substituir, los procesos naturales que

Más detalles

Guía de Preparación de Prueba: Aparato Reproductor Femenino, Fecundación y Embarazo NM2-2º Año Medio Alumno:... Fecha:...

Guía de Preparación de Prueba: Aparato Reproductor Femenino, Fecundación y Embarazo NM2-2º Año Medio Alumno:... Fecha:... Guía de Preparación de Prueba: Aparato Reproductor Femenino, Fecundación y Embarazo NM2-2º Año Medio Alumno:... Fecha:... APARATO REPRODUCTOR FEMENINO: Ovarios o gónadas femeninas: Son dos órganos pequeños,

Más detalles