Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:



1 CIENCIA Y VIDA COTIDIANA La clonación, el ADN y cosas de la genética Santiago Torres Martínez Departamento Genética y Microbiología Universidad de Murcia Murcia 25 febrero y 3 marzo, 2008

2 . Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación. Transgénicos. Selección embriones

3 Genética: Parte de la biología que trata de la herencia y de lo relacionado con ella. Diccionario de la lengua española

4 Genética Transmisión Genes Semejanza entre progenitores y descendientes Van Gogh

5 Genética Variación Transmisión Genes porqué nos parecemos? porqué nos diferenciamos?

6 Que dos mellizos nazcan de distinto color es "un caso entre un millón", según algunos expertos. Pero la explicación es sencilla : La madre de los niños es mulata, lo que quiere decir que tiene una mezcla de genes de raza blanca y negra. Por eso pudo producir óvulos de cada color (uno con los genes que indican que la piel será negra, y otros con los genes que indican que será blanca). Dos de estos óvulos fueron fecundados por el padre: óvulo negro + espermatozoide blanco óvulo blanco + espermatozoide blanco


8 Ácido DesoxirriboNucléico



11 A T C G G C T A

12 A T A T C G C G G C G C T A T A

13 A T A T C G C G G C G C T A T A

14 Los genes están en los cromosomas Cromosoma Gen ADN

15 Cariotipo

16 Óvulo recién fertilizado aprox genes

17 espermatozoide óvulo Óvulo recién fertilizado (44 cromosomas + X + X ) (22 cromosomas + X ) (44 cromosomas + X + Y ) (22 cromosomas + X ó Y)

18 ? C C C C C C C C C C C C

19 Mujer óvulo Una célula cigoto embrión Cientos de miles de millones de células : más de 200 tipos distintos de células esperma Hombre Desarrollo embrionario Control genético

20 Una célula Cigoto embrión Cientos de miles de millones de células : más de 200 tipos distintos de células Desarrollo embrionario Control genético: genes

21 Bacterias ( genes) Levaduras ( genes) Gusanos ( genes) Moscas ( genes) Gallo ( genes) Ratón ( genes) Perros ( genes) Chimpancé ( genes) Humanos ( genes) Plantas ( genes)

22 nucleótidos GCAACTTCGGGATTCACTGCCACCT CGTTGAAGCCCTAAGTGACGGTGGA.. aminoácidos aa 1 aa 2 aa 3 aa 4 aa Código genético proteína

23 Febrero 2001

24 Revisado: 12 febrero 2008

25 Nuestro genoma tiene tres mil millones de bases (unos genes) Entre dos personas cualesquiera hay más de 20 millones de nucleótidos de diferencia, que se agrupan en regiones del genoma.



28 7 6 5

29 Genética forense

30 Forensic DNA Analysis

31 Probabilidad de encontrar dos individuos con el mismo perfil: < 10-13

32 A B C D Mancha de sangre 7,9 10,13 7,15 8,8 Sospechoso 1 8,9 10,10 9,10 11,12 Sospechoso 2 10,11 9,13 8,14 9,12 Sospechoso 3 7,9 10,13 7,15 8,8

33 A B C D Mancha de sangre 7,9 10,13 7,15 8,8 Sospechoso 1 8,9 10,10 9,10 11,12 Sospechoso 2 10,11 9,13 8,14 9,12 Sospechoso 3 7,9 10,13 7,15 8,8

34 De dónde se puede obtener ADN? Sangre Semen Saliva Orina Pelos Dientes Huesos Tejidos

35 . Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación. Transgénicos. Selección embriones

36 INGENIERÍA GENÉTICA Conjunto de técnicas que permiten la manipulación y transferencia de DNA de un organismo a otro.

37 Herramientas moleculares: Las enzimas de restricción

38 Los extremos cohesivos (protuberantes) facilitan la obtención de moléculas de DNA recombinante 5 3 G A A T T C C T T A A G G A A T T C C T T A A G A A T T C G G C T T A A A A T T C G G C T T A A 3 5

39 5 3 G C T T A A A A T T C G G A A T T C C T T A A G 3 5 Moléculas recombinantes o quiméricas


41 Dos etapas básicas en la clonación de fragmentos de DNA Digestión DNA foráneo 1. Construcción del DNA recombinante Ligación Inserto Vector

42 Cromosoma bacteria Plásmido recombinante

43 transgénicos


45 transgénicos

46 Vaca transgénica Gen para la proteína de interés Transgén inyectado En el óvulo del animal La vaca transgénica produce la proteína de interés en la leche

47 Se elimina el núcleo Oveja donante de óvulos A óvulo Oveja donante de células Se fusionan el óvulo sin núcleo y la célula célula Óvulo fusionado con la célula embrión Embrión implantado Oveja clónica

48 Preembriones humanos embrión in vitro constituido por el grupo de células resultantes de la división progresiva del ovocito desde que es fecundado hasta 14 días más tarde.

49 totipotentes días: Fertilización (día 1) 2 células 4 células blastocisto 128 células Implantación y formación de la placenta (día 7) mórula 8 células útero oviducto ovario

50 cigoto Células totipotentes embrión

51 Tipos de células Células Descripción Ejemplos Totipotentes Cada célula puede originar un nuevo individuo Células de los embriones tempranos (1-3,4 días)

52 Tipos de células Células Descripción Ejemplos Totipotentes Pluripotentes Cada célula puede originar un nuevo individuo Las células pueden formar cualquier tipo celular (unos 200, aprox.) Células de los embriones tempranos (1-3,4 días) Algunas células del blastocisto (5 a 14 dias)

53 Tipos de células Células Descripción Ejemplos Totipotentes Pluripotentes Cada célula puede originar un nuevo individuo Las células pueden formar cualquier tipo celular (unos 200, aprox.) Células de los embriones tempranos (1-3,4 días) Algunas células del blastocisto (5 a 14 dias)

54 totipotentes pluripotentes días: Fertilización (día 1) 2 células 4 células blastocisto 128 células Implantación y formación de la placenta (día 7) mórula 8 células útero oviducto ovario

55 Tipos de células Células Descripción Ejemplos Totipotentes Pluripotentes Multipotentes Cada célula puede originar un nuevo individuo Las células pueden formar cualquier tipo celular (unos 200, aprox.) Células diferenciadas, pero que pueden originar otros tipos de tejidos Células de los embriones tempranos (1-3,4 días) Algunas células del blastocisto (5 a 14 dias) Tejido fetal, cordón umbilical y células madres de adultos

56 Expresión genes del embrión días: Fertilización (día 1) 2 células 4 células blastocisto 128 células Implantación y formación de la placenta (día 7) mórula 8 células útero oviducto ovario

57 Prevención y tratamiento de enfermedades de origen genético Los centros debidamente autorizados podrán practicar técnicas de diagnóstico preimplantacional (DGP) para: a) La detección de enfermedades hereditarias graves, de aparición precoz y no susceptibles de tratamiento curativo posnatal con arreglo a los conocimientos científicos actuales, con objeto de llevar a cabo la selección embrionaria de los preembriones no afectos para su transferencia. b) La detección de otras alteraciones que puedan comprometer la viabilidad del preembrión

58 Diagnóstico genético preimplantacional (DGP) La técnica consiste en extraer una o dos células de un embrión de más de seis células, para analizar su material genético


60 Se extrae una célula del embrión, para analizar afectado afectado afectado afectado no afectado no afectado Se utilizan sólo los embriones no afectados


62 Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR

63 Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR

64 mujer X Y hombre FISH: hibridación in situ con sondas fluorescentes de ADN


66 ANOMALÍAS CROMOSÓMICAS (cromosomas sexuales) 46, XX normal 46, XY normal 45, X Síndrome Turner 47, XXY Síndrome Klinefelter

67 PGD Monosomía Trisomía

68 ANOMALÍAS CROMOSÓMICAS (autosomas) 46, XX normal 46, XY normal 47, XY, +13 Síndrome de Patou 47, XY, +18 Síndrome de Edwards

69 Qué se puede analizar en las células extraídas de los embriones?. Alteraciones cromosómicas (monosomías, trisomías, triploidías). Enfermedades de base molecular conocida y analizable por PCR


71 Autosómicas recesivas ( ) Fibrosis Quística Talasemias Anemia Falciforme Autosómicas dominantes ( ) Distrofia Miotónica o Enfermedad de Steinert Huntington Recesivas ligadas al cromosoma X Síndrome del X frágil Distrofia Muscular de Duchenne (DMD) XY XX Hemofilia A XY XX XY XX


73 La fibrosis quística (abreviatura FQ), también conocida como mucoviscidosis es una enfermedad hereditaria frecuente que afecta al organismo en forma generalizada, causando discapacidad progresiva y muerte prematura. La dificultad para respirar es el síntoma más común, emergente de infecciones pulmonares crónicas, las cuales pueden mostrarse resistentes al tratamiento con antibióticos y otros fármacos. La FQ es un trastorno multisistémico que causa la formación y acumulación de un moco espeso y pegajoso, afectando fundamentalmente pulmones, intestinos, páncreas e hígado.

74 Aproximadamente, una de cada 25 personas de ascendencia europea es portadora asintomática de un gen para FQ, siendo la enfermedad genética más frecuente entre esta población. I II


76 DGP

77 Se extrae una célula del embrión, para analizar afectado no afectado no afectado afectado Se utilizan sólo los embriones no afectados

78 Clonación terapéutica: células madre

79 diferenciación Células internas (pluripotentes) día 1 óvulo fertilizado día 5,6 blastocisto sangre hígado neuronas páncreas Intestino Células músculo cardíaco Células renales

80 Mujer Quitar núcleo Cigoto clónico Bebé clónico ó Insertar núcleo Embrión clónico día 5,6 blastocisto Célula somática (piel, músculo, etc..) Mujer óvulo cigoto embrión esperma Hombre



83 Mujer Quitar núcleo Cigoto clónico Bebé clónico ó Insertar núcleo Embrión clónico día 5,6 blastocisto Célula somática (piel, músculo, etc..) Clonación reproductiva


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Genética para andar por casa... y 3 Murcia, 17 de diciembre de 2012. Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos.

Más detalles

Y después de la secuencia, qué?

Y después de la secuencia, qué? Y después de la secuencia, qué? Nuestros genomas no son iguales Persona 1 Persona 2 = Variaciones en el ADN Qué tipo de variaciones? Secuencia estándar Variaciones: Cambios de una base por otra: Polimorfismos

Más detalles


ENFERMEDADES GENÉTICAS ENFERMEDADES GENÉTICAS Inicio INDICE 1 Que es una enfermedad genética? 1.1Enfermedades cromosómicas 1.2Enfermedades monogenicas 2. como se heredan? 2.1 Herencia dominante 2.2 Herencia recesiva 2.3 Herencia

Más detalles


UNIDAD 7 LA DIGNIDAD DE LA VIDA UNIDAD 7 LA DIGNIDAD DE LA VIDA A) EL EMBRIÓN: fecundación Espermatozoides llegando al ovocito Concepción La carrera por la vida... "Desde el momento mismo de la fecundación, desde el instante en que a

Más detalles


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Dieta genética para prevenir enfermedades? La clonación, el ADN y otras cosas Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética

Más detalles

Jesús G.C. Colegio Claret Segovia

Jesús G.C. Colegio Claret Segovia 1 UNIDAD 8 Documento elaborado por del de LA R E VO LU CI Ó N G EN É TI CA 1.- El ADN La célula es la unidad morfológica, funcional y genética de todos los seres vivos Todos los seres vivos están formados

Más detalles



Más detalles

Genética, Medicina y Sociedad (Síntesis).

Genética, Medicina y Sociedad (Síntesis). Genética, Medicina y Sociedad (Síntesis). Biología. Curtis, et al. (2008). Editorial Médica Interamericana. 7ª Ed. Cap. 16. Por lo general, los principios de la genética son los mismos para cualquier ser

Más detalles


DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) Las alteraciones genéticas son una importante causa de esterilidad e infertilidad y pueden ser responsables de algunos defectos congénitos. Estas alteraciones

Más detalles

DGP: Para tus hijos, evita riesgos

DGP: Para tus hijos, evita riesgos DGP: Para tus hijos, evita riesgos Ahora, con el Diagnóstico Genético Preimplantacional (DGP) podrás evitar los riesgos genéticos en tu descendencia. Salud de la mujer Dexeus Salud de la mujer Dexeus DEPARTAMENTO

Más detalles


Proyecto GENOMA HUMANO CÉLULAS MADRE Proyecto GENOMA HUMANO PROYECTO GENOMA HUMANO PROYECTO GENOMA HUMANO TIPOS DE ADN EN EL GENOMA HUMANO Intrones, promotores y regiones reguladoras (40 %) DNA intergénico con funciones desconocidas(68,3

Más detalles

BIOLOGÍA MOLECULAR. 1. Niveles de organización

BIOLOGÍA MOLECULAR. 1. Niveles de organización BIOLOGÍA MOLECULAR 1. Niveles de organización Como sabes, los seres humanos son organismos vivos pluricelulares capaces de realizar las funciones vitales de nutrición, relación y reproducción. Para el

Más detalles


NEFROPATÍA POR MUTACIONES EN EL GEN HNF1B 46 NEFROPATÍA POR MUTACIONES EN EL GEN HNF1B 10 Introducción: El gen HNF1b codifica información para la síntesis del factor hepatocitario nuclear 1b, que es un factor de transcripción involucrado en la

Más detalles

Enfermedades asociadas a mutaciones estructurales

Enfermedades asociadas a mutaciones estructurales Enfermedades asociadas a mutaciones estructurales El cariotipo humano A partir de un cultivo de sangre periférica, y posterior tratamiento con Giemsa para obtener un bandeo G, puede obtenerse el cariotipo

Más detalles



Más detalles


ESTUDIAR LOS GENES PARA PREVENIR UNA DISCAPACIDAD GENÉTICA Y HERENCIA ESTUDIAR LOS GENES PARA PREVENIR UNA DISCAPACIDAD En los últimos años nuestra sociedad ha sido testigo de una verdadera revolución científica en el campo de la genética. La posibilidad

Más detalles

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

Iván Ferrer Rodríguez, Ph.D. Catedrático

Iván Ferrer Rodríguez, Ph.D. Catedrático Iván Ferrer Rodríguez, Ph.D. Catedrático La base cromosomal de la herencia Reece, Urry, Cain, Wasserman, Minorsky, Jackson, 2009 Campbell Biology 9 th Edition Chomosomas 2 Base cromosomal de las leyes

Más detalles

Diagnóstico Genético Preimplantacional Indicaciones Actuales. Dr. Joaquín Moreno Valencia Febrero 2009

Diagnóstico Genético Preimplantacional Indicaciones Actuales. Dr. Joaquín Moreno Valencia Febrero 2009 Diagnóstico Genético Preimplantacional Indicaciones Actuales Dr. Joaquín Moreno Valencia Febrero 2009 DGP El diagnóstico Genético Preimplantacional(DGP) se presenta como una forma muy precoz de diagnóstico

Más detalles

CUESTIONES TEMA 4: La revolución genética y la biotecnología.

CUESTIONES TEMA 4: La revolución genética y la biotecnología. CUESTIONES TEMA 4: La revolución genética y la biotecnología. 1. El ADN no puede salir del núcleo: Cómo logra llevar a los ribosomas que están en el citoplasma la información que porta? 2. El individuo

Más detalles

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por

clonación humana Monografías de Comunicación Científica Museos Científicos Coruñeses Una informació n elaborada por Una informació n elaborada por Museos Científicos Coruñeses Monografías de Comunicación Científica 04 Edición realizada con el patrocinio de clonación humana El 13 de febrero de 2004 todos los medios de

Más detalles

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano

Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano Trabajo realizado por : Álvaro Moya Víctor Moya Fran Moyano ÍNDICE ADN - Historia del ADN - Qué es el ADN? - De qué está formado? - Qué función tiene? Ingeniería genética - Qué es la ingeniería genética?

Más detalles

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA

Biología y Geología Genética Humana 4º ESO ACTIVIDADES FINALES: GENÉTICA HUMANA ACTIVIDADES FINALES: GENÉTICA HUMANA 1.- Un varón de ojos azules, cuyos padres tenían ojos oscuros, se casa con una mujer de ojos oscuros, cuyo padre tenía ojos azules. Esta mujer tiene un hermano de ojos

Más detalles


BIOTECNOLOGIA PECUARIA 1ro9ber4to5 BIOTECNOLOGIA PECUARIA La demanda por productos animales ha crecido constantemente y es necesario incrementar la cantidad y calidad de estos productos. En este contexto, en los últimos 20 años

Más detalles

Actividades de clase para realizar con ordenador:

Actividades de clase para realizar con ordenador: 4º E.S.O. Biología y Geología - Unidad 5.- La herencia biológica Actividades de clase para realizar con ordenador: Alumno/a... Fecha... 1.- Completa: Todos los seres vivos tienen

Más detalles


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Genética para andar por casa. Santiago Torres Martínez Catedrático de Genética Departamento de Genética y Microbiología Murcia, 7 de octubre de 2013 Genética: Parte de la biología

Más detalles



Más detalles

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante.

Curso: Ingeniería genética Agropecuaria Unidad 1: Conceptos y perspectiva histórica de la tecnología del ADN recombinante. Temáticas que se revisarán: Universidad Nacional Abierta y a Distancia Especialización en Mejoramiento Genético Ingeniería genética Agropecuaria Luz Mery Bernal Parra Curso: Ingeniería genética Agropecuaria

Más detalles



Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Su clínica local: Herencia Ligada al Cromosoma X sta-aegh-2005-servicios-degenetica-clinica.pdf Elaborado

Más detalles

Fig. 3: En la F2 encontró machos y hembras con ojos color rojo y solamente machos con ojos color blanco.

Fig. 3: En la F2 encontró machos y hembras con ojos color rojo y solamente machos con ojos color blanco. Padres Escolapios Depto. De Ciencias - Biología. Nivel: 3ero medio Unidad 0 Guía 2 Marzo de 2010 1 Capítulo III: Herencia ligada al Sexo: Existen características determinadas por genes que se encuentran

Más detalles


TEMA 4 CMC BIOTECNOLOGÍA Conceptos Tema 4 TEMA 4 CMC BIOTECNOLOGÍA Células eucariotas: Células con núcleo. Núcleo: Un compartimento en el interior de la célula que alberga el material genético. Citoplasma: En una célula eucariota,

Más detalles

El diagnóstico genético preimplantacional (DGP), una oportunidad en cáncer hereditario?

El diagnóstico genético preimplantacional (DGP), una oportunidad en cáncer hereditario? Se han revisado sus beneficios y limitaciones en una jornada de Unidades de Consejo Genético en Cáncer Familiar, organizada por la SEOM con el apoyo del Instituto Roche El diagnóstico genético preimplantacional

Más detalles

Cultura Cientí fica 1 Bachillerato

Cultura Cientí fica 1 Bachillerato Cultura Cientí fica 1 Bachillerato 3. La revolución genética: biotecnología Actividades de consolidación 1. Cualquier molécula de ADN formada por la unión de segmentos de ADN de origen diferente es: a)

Más detalles

Herencia Ligada al Cromosoma X

Herencia Ligada al Cromosoma X 12 Herencia Ligada al Cromosoma X Elaborado a partir de folletos originales de Guy s and St Thomas Hospital, Londres y London IDEAS Genetic Knowledge Park. Enero de 2008 Este trabajo se ha realizado bajo

Más detalles


EL MATERIAL GENÉTICO: LA HUELLA GENÉTICA: PRUEBAS DE PATERNIDAD E IDENTIFICACIÓN INTRODUCCIÓN: En éstos últimos años, se ha popularizado a través de los medios de comunicación la expresión: identificación través de pruebas

Más detalles


UNIDAD 13: LA REPRODUCCIÓN HUMANA UNIDAD 13: LA REPRODUCCIÓN HUMANA 1. FECUNDACIÓN Y DESARROLLO EMBRIONARIO En los humanos la fecundación es interna, es decir, ocurre dentro del cuerpo de la mujer después de realizar el acto sexual. Tiene

Más detalles

Tipos de células madre

Tipos de células madre Biología Bachillerato IES Fuentesnuevas 1 CÉLULAS MADRE O TRONCALES (STEM CELLS) Las células madre son células que tienen capacidad de renovarse continuamente por sucesivas divisiones por mitosis y de

Más detalles


EL COMIENZO DE LA GENÉTICA Después de Mendel DOMINANCIA INCOMPLETA TEMA 5 (2) EL COMIENZO DE LA GENÉTICA Después de Mendel Dominancia incompleta Series alelicas Herencia de los grupos sanguíneos Herencia ligada al sexo Mutaciones DOMINANCIA INCOMPLETA Muchas características

Más detalles


CAP ITULO XII HERENCIA CAP ITULO XII HERENCIA Algunas enfermedades son genéticas en origen y por lo tanto son transmitidas en familias. La mayoría de las enfermedades de inmunodeficiencia son heredades en alguno de los dos diferentes

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros)

EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Departamento de Biología Ambiental y Salud Pública EL CUERPO HUMANO (Anatomía, fisiología, higiene y salud para maestros) Acabo de nacer: Qué haya suerte! Todo se lo debo a mis padres: fecundación y formación

Más detalles

Genealogías y clonación.

Genealogías y clonación. Curso: Biología Mención Material Nº 6 Unidad V. Variabilidad y Herencia. Genealogías y clonación.. GENEALOGÍAS. El hombre, sin haber tenido conocimiento alguno de genética, siempre se ha preocupado de

Más detalles

Diagnóstico Preimplantacional. La mejor solución?

Diagnóstico Preimplantacional. La mejor solución? Diagnóstico Preimplantacional. La mejor solución? María José Trujillo Tiebas. Servicio de Genética Fundación Jiménez Díaz, Madrid. CONSULTA GENÉTICA: Antecedentes familiares Edades de los padres Consanguinidad

Más detalles

Gen: Fragmento de ADN que contiene la información para la construcción de una proteína. Es la unidad biológica de la herencia.

Gen: Fragmento de ADN que contiene la información para la construcción de una proteína. Es la unidad biológica de la herencia. RESUMEN DÉCIMO Conceptos de genética: Genética: Rama de la biología que estudia la transmisión de los caracteres hereditarios o herencia Código genético: Es la secuencia de bases nitrogenadas que existe

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

Tema 22.- HERENCIA MENDELIANA. Introducción a la Genética Humana: tipos de herencia. Herencia monogénica mendeliana

Tema 22.- HERENCIA MENDELIANA. Introducción a la Genética Humana: tipos de herencia. Herencia monogénica mendeliana BIBLIOGRAFÍA Jorde, Carey, Bamshad. Genética médica. Editorial Elsevier Mosby, 4ª Ed. (2011) Nussbaum, McInnes, Willard. (Thompson&Thompson). Genética en medicina. Editorial Elservier Masson, 5ª/7ª Ed.

Más detalles

Conocimiento del medio 6.º > Unidad 3 > La función de reproducción _

Conocimiento del medio 6.º > Unidad 3 > La función de reproducción _ Conocimiento del medio 6.º > Unidad 3 > La función de reproducción _ 1. Explica brevemente cuáles son las etapas en la vida de una persona. Para ello, indica cómo se denomina cada período, qué edad abarca,

Más detalles



Más detalles

Resolución problemas

Resolución problemas Resolución problemas 1. En cierta especie de plantas los colores de las flores pueden ser rojos, blancos o rosas. Se sabe que este carácter está determinado por dos genes alelos, rojo (C R ) y blanco (C

Más detalles


TEMA 8: REPRODUCCIÓN HUMANA TEMA 8: REPRODUCCIÓN HUMANA 1. Define reproducción. 2. Existen dos formas de reproducción. Cuáles son? Explica sus características. 3. Qué es un gameto? 4. Existen dos tipos de gametos. Escribe cuáles

Más detalles


GUÍA DE ESTUDIO #1 (15%) APELLIDOS: NOMBRES: CÉDULA: SECCIÓN: NÚMERO DE LISTA: República Bolivariana de Venezuela Ministerio del Poder Popular para la Educación U.E. Colegio Santo Tomás de Villanueva Departamento de Ciencias Cátedra: Ciencias Biológicas Año: 3 A, B y C Prof. Luis

Más detalles

LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA

LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA Fecha: 13 de Abril de 2011 Nombre: Dra. Ana Cardo Maza R3 Tipo de Sesión: Seminario LEY 14/2006 del 26 de mayo, sobre TÉCNICAS DE REPRODUCCIÓN ASISTIDA CAPÍTULO 1- DISPOSICIONES GENERALES Objeto de la

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

Técnicas de ADN recombinante: la manipulación genética

Técnicas de ADN recombinante: la manipulación genética Técnicas de ADN recombinante: la manipulación genética A partir de los años 70 se desarrollaron las herramientas de la biología molecular o la ingeniería genética o lo que se ha llamado técnicas del ADN

Más detalles

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia

GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia GENÉTICA: Herencia, Expresión génica, Replicación, biotecnología Selectividad: herencia 5 JUN9.- Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran

Más detalles



Más detalles

Registro de la Sociedad Española de Fertilidad: Técnicas de reproducción asistida (IA y FIV/ICSI). Año 2.013

Registro de la Sociedad Española de Fertilidad: Técnicas de reproducción asistida (IA y FIV/ICSI). Año 2.013 Registro SEF Registro de la Sociedad Española de Fertilidad: Técnicas de reproducción asistida (IA y FIV/ICSI). Año 2.013 Informe estadístico final INDICE 1 Introducción... 3 2 Población en estudio...

Más detalles

Fecundación in vitro con óvulos donados

Fecundación in vitro con óvulos donados MEDICINA DE LA REPRODUCCIÓN FECUNDACIÓN IN VITRO Fecundación in vitro con óvulos donados Una oportunidad de vivir la experiencia del embarazo Salud de la mujer Dexeus ATENCIÓN INTEGRAL EN OBSTETRICIA,

Más detalles


ACTIVIDADES DE RECUPERACIÓN 2ª EVALUACIÓN (4º ESO) ACTIVIDADES DE RECUPERACIÓN 2ª EVALUACIÓN (4º ESO) Estas cuestiones de refuerzo a realizar se dividirán en dos partes: - Una primera parte que pretenderá la revisión de conceptos, y que supondrá una calificación

Más detalles


PROBLEMAS DE GENÉTICA 2013 PROBLEMAS DE GENÉTICA 2013 A. Primera y segunda ley de Mendel. Retrocruzamiento 1. Cobayas negras heterocigotas (Bb) se aparearon con cobayas blancas recesivas homocigotas (bb).indicar las proporciones

Más detalles


TEMA 5.- LA HERENCIA BIOLÓGICA. TEMA 5.- LA HERENCIA BIOLÓGICA. 1 Hay caracteres que no se transmiten a la descendencia, es decir no son heredables. (ej : el corte de orejas a los perros). Otros caracteres si son heredables, es decir

Más detalles


INGENIERÍA GENÉTICA 5 GAATTC 3 3 CTTAAG 5 INGENIERÍA GENÉTICA 1. Fundamentos básicos de la ingeniería genética 2. Desnaturalización e hibridación del ADN 3. Reacción en cadena de la polimerasa (PCR) 4. Nuevas disciplinas surgidas de la ingeniería

Más detalles

Guía de Preparación de Prueba: Aparato Reproductor Femenino, Fecundación y Embarazo NM2-2º Año Medio Alumno:... Fecha:...

Guía de Preparación de Prueba: Aparato Reproductor Femenino, Fecundación y Embarazo NM2-2º Año Medio Alumno:... Fecha:... Guía de Preparación de Prueba: Aparato Reproductor Femenino, Fecundación y Embarazo NM2-2º Año Medio Alumno:... Fecha:... APARATO REPRODUCTOR FEMENINO: Ovarios o gónadas femeninas: Son dos órganos pequeños,

Más detalles

MUTACIONES. Son cambios en la información hereditaria como consecuencia de alteraciones en el material genético: ADN, genes, cromosomas, cariotipo,

MUTACIONES. Son cambios en la información hereditaria como consecuencia de alteraciones en el material genético: ADN, genes, cromosomas, cariotipo, MUTACIONES Son cambios en la información hereditaria como consecuencia de alteraciones en el material genético: ADN, genes, cromosomas, cariotipo, Pueden afectar a secuencias génicas o a secuencias reguladoras,

Más detalles



Más detalles



Más detalles

Tema 5 Quién puede ser donante? La legislación Española !! Riesgos del transplante Rechazo inmunológico: Escasez de órganos:

Tema 5 Quién puede ser donante? La legislación Española !! Riesgos del transplante Rechazo inmunológico: Escasez de órganos: Tema 5 Quién puede ser donante? Suelen ser personas en muerte cerebral o alguien vivo La legislación Española Muerte cerebral Respeto a la voluntad del fallecido Diagnóstico de muerte hecho por otro equipo

Más detalles


CONTENIDOS PRUEBA DE CIENCIA CONTENIDOS PRUEBA DE CIENCIA CONTENIDOS DE BIOLOGÍA PRIMERO MEDIO I Organización, Estructura y Actividad Celular 1 La célula como unidad funcional a. Estructuras y funciones comunes a células animales

Más detalles

12. Cómo pueden diferenciarse dos individuos, uno homocigótico de otro heterocigótico, que presentan el mismo fenotipo. Razonar la respuesta

12. Cómo pueden diferenciarse dos individuos, uno homocigótico de otro heterocigótico, que presentan el mismo fenotipo. Razonar la respuesta PROBLEMAS DE GENÉTICA: PRIMERA Y SEGUNDA LEYES DE MENDEL 1. En cierta especie de plantas el color azul de la flor, (A), domina sobre el color blanco (a) Cómo podrán ser los descendientes del cruce de plantas

Más detalles

Problemas de genética mendeliana. Herencia de un carácter

Problemas de genética mendeliana. Herencia de un carácter Problemas de genética mendeliana Herencia de un carácter 1. Razona la veracidad o falsedad de la siguiente afirmación: El color de tipo común del cuerpo de la Drosophila está determinado por el gen dominante

Más detalles

Materia: Biología 3. Curso: 3 ro. Media. Proyecto Nº 1. Mes: Agosto-Septiembre. Año: 2015-2016. Prof.: Lic. Manuel B. Noboa G.

Materia: Biología 3. Curso: 3 ro. Media. Proyecto Nº 1. Mes: Agosto-Septiembre. Año: 2015-2016. Prof.: Lic. Manuel B. Noboa G. Materia: Biología 3. Curso: 3 ro. Media. Proyecto Nº 1. Mes: Agosto-Septiembre. Año: 2015-2016. Prof.: Lic. Manuel B. Noboa G. Cuál es la relación existente entre el origen del Universo y de la Tierra

Más detalles

I. En qué consiste? FECUNDACIÓN IN VITRO

I. En qué consiste? FECUNDACIÓN IN VITRO FECUNDACIÓN IN VITRO I. En qué consiste? La Fecundación in Vitro es un tratamiento que consta de procedimientos médicos y biológicos destinados a facilitar la unión de óvulos (ovocitos) y espermatozoides

Más detalles

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D.

Formación de una nueva vida:concepción,herencia y ambiente. Janette Orengo Puig,Ed.D. Formación de una nueva vida:concepción,herencia y ambiente Janette Orengo Puig,Ed.D. Cambios en la teoría de concepción Concepción- (fertilización)-es el proceso por medio del cual el espermatozoide y

Más detalles

1. Los individuos que manifiestan un carácter recesivo, Son homocigotos o heterocigotos para el carácter? Por qué?

1. Los individuos que manifiestan un carácter recesivo, Son homocigotos o heterocigotos para el carácter? Por qué? 1. Los individuos que manifiestan un carácter recesivo, Son homocigotos o heterocigotos para el carácter? Por qué? 2. La acondroplasia es una forma de enanismo debida a un crecimiento anormalmente pequeño

Más detalles



Más detalles

A la vanguardia en la prevención de enfermedades genéticas

A la vanguardia en la prevención de enfermedades genéticas MEDICINA GENÓMICA TEST GENÉTICO DE PORTADORES A la vanguardia en la prevención de enfermedades genéticas Ref. 167/ Abril 2013 Si quieres recibir información más detallada, ponte en contacto con nuestro

Más detalles

Genética III: Genética humana

Genética III: Genética humana Genética III: Genética humana 1. Genética humana Los pedigrís se utilizan para mostrar la transmisión hereditaria de enfermedades humanas de base genética. En un pedigrí, se puede trazar el patrón de herencia

Más detalles



Más detalles

Problema 1: Southern Blot. Problema 2: Paternidad.

Problema 1: Southern Blot. Problema 2: Paternidad. Problema 1: Southern Blot. En el análisis de DNA Fingerprint mediante la técnica de "Southern" Blot: A- El RNA celular es separado electroforéticamente y transferido a una membrana. Luego la membrana se

Más detalles

La reproducción en el ser humano

La reproducción en el ser humano UNIDAD DIDÁCTICA 7 La reproducción en el ser humano Cati Pérez Aparicio Curso 2011-2012 DOS SEXOS PARA LA REPRODUCCIÓN Todos nosotros hemos nacido del vientre materno,

Más detalles

Genética de las Neurofibromatosis

Genética de las Neurofibromatosis Genética de las Neurofibromatosis Cuaderno núm. 3 El texto de este cuaderno, ha sido cedido por The Neurofibromatosis Association (UK) y traducido por la Asociación Catalana de las Neurofibromatosis (Barcelona

Más detalles


APARATO REPRODUCTOR MASCULINO APARATO REPRODUCTOR MASCULINO El aparato reproductor masculino consta de varios órganos: Los testículos o gónadas: se hallan situados dentro de una bolsa

Más detalles

Con relación al Proyecto Productivo, continuamos en la Fase III: la ejecución.

Con relación al Proyecto Productivo, continuamos en la Fase III: la ejecución. Al estudiar la herencia y apreciar cómo los avances tecnológicos alcanzan velocidades asombrosas, nos maravillamos con cada descubrimiento y nos atemoriza el saber que la imaginación es el límite. La clonación

Más detalles


Asignatura: DISFUNCIONES SEXUALES ORGANICAS Universidad de Salamanca Facultad de Medicina Asignatura: DISFUNCIONES SEXUALES ORGANICAS Tema: Técnicas de reproducción asistida Dra. Carmen Lopez Sosa Medica sexóloga

Más detalles

Opción Múltiple Revisión Genética Mendeliana y Patrones de Herencia

Opción Múltiple Revisión Genética Mendeliana y Patrones de Herencia Opción Múltiple Revisión Genética Mendeliana y 1. Jean-Baptiste Lamarck introdujo una teoría acerca de la herencia a principios de 1800. Cuál de las siguientes describe con precisión su Teoría de los caracteres

Más detalles


PREGUNTAS TEST DE LOS TEMAS 11 AL 15 PREGUNTAS TEST DE LOS TEMAS 11 AL 15 1. El número diploide de la especie humana se restablece durante la: a. Gametogénesis. b. Fecundación del óvulo por el espermatozoide. c. Mitosis. d. Meiosis. 2. El

Más detalles


DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE DE LA FECUNDACIÓ IN VITRO A LES CÈL LULES MARE Anna Veiga Servei de Medicina de la Reproducció - Institut Universitari Dexeus Centre de Medicina Regenerativa de Barcelona Barcelona HISTORIA 1878 Primeros

Más detalles

Antes del embarazo Pre - concepción

Antes del embarazo Pre - concepción Antes del embarazo Pre - concepción Cariotipo en la pareja con dificultades para concebir Qué es un cariotipo? Es el estudio que permite detectar anomalías en el número o en la forma de los cromosomas.

Más detalles

Paralelismo entre cromosomas y la teoria de Mendel

Paralelismo entre cromosomas y la teoria de Mendel Paralelismo entre cromosomas y la teoria de Mendel Cromosomas sexuales Autosomas Herencia ligada al sexo Cromosomas heteromorfos Nettie Stevens, 1909 Estudios en Drosophila, mosca del vinagre Thomas Hunt

Más detalles

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8

Evolución de la donación de órganos en España. Europa: 19,2 EEUU: 25,8 Evolución de la donación de órganos en España Europa: 19,2 EEUU: 25,8 REQUISITOS PARA EL TRASPLANTE Muerte encefálica Criterios médicos distribución Equipo médico independiente del trasplante Donación

Más detalles

Fecha de impresión : Jueves, 09 de Julio 2009. Distrofia muscular. Definición. Diagnóstico

Fecha de impresión : Jueves, 09 de Julio 2009. Distrofia muscular. Definición. Diagnóstico Fecha de impresión : Jueves, 09 de Julio 2009 Distrofia muscular Definición Diagnóstico Qué le pasa al bebé? Distrofia muscular miotónica: Distrofia muscular de Duchenne: Distrofia muscular de Becker:

Más detalles


PROYECTO: BASES GENÉTICAS DE LA ENFERMEDAD DE BEHÇET. Norberto Ortego Centeno PROYECTO: BASES GENÉTICAS DE LA ENFERMEDAD DE BEHÇET Norberto Ortego Centeno La herencia en las enfermedades Son enfermedades hereditarias las que se transmiten de padres a hijos La información viaja en

Más detalles


COMPLEMENTACION CONTENIDOS 2 MEDIO DEPTO. DE BIOLOGÍA. Anormalidades cromosómicas COMPLEMENTACION CONTENIDOS 2 MEDIO DEPTO. DE BIOLOGÍA Anormalidas cromosómicas Ciertas enfermedas genéticas son causadas por anormalidas en el número o en la estructura los cromosomas que son tan graves,

Más detalles

Secundarios - CBC - Universitarios - Informática - Idiomas. Apunte Nro 0742. Mendel. Ejercicios de genética.

Secundarios - CBC - Universitarios - Informática - Idiomas. Apunte Nro 0742. Mendel. Ejercicios de genética. Mendel. Ejercicios de genética. 1) La segunda ley de Mendel no se cumpliría si: a) los genes considerados estuvieran ubicados en distintos cromosomas b) los genes considerados estuvieran ubicados en un

Más detalles

Diagnóstico genético de preimplantación (DGP)

Diagnóstico genético de preimplantación (DGP) Avances EFICAZ OPCIÓN PARA PACIENTES QUE PRESENTAN ALTO RIESGO DE INFERTILIDAD O ESTERILIDAD Diagnóstico genético de preimplantación (DGP) Equipo Diagnóstico Genético de Preimplantación Dra Claudia Perandones

Más detalles

con número de expediente MIDTF/2011/212

con número de expediente MIDTF/2011/212 La investigación biomédica es una actividad necesaria para el éxito de cualquier estrategia que se proponga mejorar la salud de los ciudadanos. En este sentido, IVI VALENCIA, S.L. apuesta fuertemente por

Más detalles

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes:

En función de la relación existente entre el donante y el receptor se diferencian varios tipos de trasplantes: TEMA 4: AVANCES BIOMÉDICOS 1.- TRASPLANTES DE ÓRGANOS Trasplante o injerto en medicina es un tratamiento médico complejo que consiste en trasladar órganos, tejidos o células de una persona a otra. El órgano

Más detalles

GENÉTICA. 4º de ESO Mercedes Macías

GENÉTICA. 4º de ESO Mercedes Macías GENÉTICA 4º de ESO Mercedes Macías Contenidos Los cromosomas: Cromosomas homólogos Autosomas y heterocromosomas, el cariotipo Anomalías cromosómicas. Las mutaciones. Los genes: Los alelos: Dominantes,

Más detalles

Métodos de Reproducción Asistida más Usados

Métodos de Reproducción Asistida más Usados Métodos de Reproducción Asistida más Usados Entendemos por métodos de reproducción asistida, al conjunto de técnicas médicas, que tienen la finalidad de facilitar o substituir, los procesos naturales que

Más detalles