IdentiClone BCL1/JH Translocation Assay Para la Identificación del Linfoma del Manto y de otros Linfomas y Leucemias Para Diagnóstico In Vitro

Tamaño: px
Comenzar la demostración a partir de la página:

Download "IdentiClone BCL1/JH Translocation Assay Para la Identificación del Linfoma del Manto y de otros Linfomas y Leucemias Para Diagnóstico In Vitro"

Transcripción

1 Servicio Técnico: Servicio al Cliente (EUA): Servicio al Cliente (UE): IdentiClone BCL1/JH Translocation Assay Para la Identificación del Linfoma del Manto y de otros Linfomas y Leucemias Para Diagnóstico In Vitro Simbología utilizada Para Diagnóstico In Vitro Número de Catálogo Volumen de Reactivo Número de Lote Condiciones de Almacenamiento Fecha de Vencimiento Representante Autorizado en la Unión Europea Fabricante Consulte las Instrucciones para su Uso Condiciones de almacenamiento: -65 C a -85ºC (Los controles de ADN pueden separarse del resto de los materiales del ensayo y mantenerse a una temperatura entre 2 C y 8 C) Nro. de Catálogo Productos Cantidad IdentiClone BCL1/JH Translocation Assay Gel Detection 33 Reacciones IdentiClone BCL1/JH Translocation Assay MegaKit Gel Detection 330 Reacciones

2 Página 2 de 14 Contenidos 1. MARCA REGISTRADA USO PREVISTO RESUMEN Y DESCRIPCIÓN DEL ENSAYO PRINCIPIOS DEL PROCEDIMIENTO REACCIÓN EN CADENA DE LA POLIMERASA (PCR) DETECCIÓN EN GELES REACTIVOS COMPONENTES PRECAUCIONES Y ADVERTENCIAS ALMACENAMIENTO Y MANIPULACIÓN INSTRUMENTOS TERMOCICLADOR UNIDAD DE ELECTROFORESIS UNIDAD DE ILUMINACIÓN UV RECOGIDA Y PREPARACIÓN DE LA MUESTRA PRECAUCIONES SUSTANCIAS QUE INTERFIEREN REQUERIMIENTOS DE LA MUESTRA Y SU MANIPULACIÓN PREPARACIÓN DE LA MUESTRA CONSERVACIÓN DE LA MUESTRA PROCEDIMIENTO DEL ENSAYO MATERIALES SUMINISTRADOS EN EL KIT MATERIALES REQUERIDOS PERO NO SUMINISTRADOS EN EL KIT PREPARACIÓN DE LOS REACTIVOS AMPLIFICACIÓN DETECCIÓN EN GELES GELES DE AGAROSA TBE CONTROL DE CALIDAD CONTROLES POSITIVOS RECOMENDADOS INTERPRETACIÓN DE LOS RESULTADOS ANÁLISIS INTERPRETACIÓN DE LA MUESTRA PROBLEMA LIMITACIONES DEL ENSAYO VALORES ESPERADOS TAMAÑO ESPERADO DE LOS PRODUCTOS AMPLIFICADOS RESULTADOS DE LA MUESTRA CARACTERÍSTICAS ANALÍTICAS BIBLIOGRAFÍA SERVICIO TÉCNICO Y AL CLIENTE ASPECTOS LEGALES... 14

3 Página 3 de Marca Registrada IdentiClone BCL1/JH Translocation Assay Gel Detection IdentiClone BCL1/JH Translocation Assay MegaKit Gel Detection 2. Uso Previsto El IdentiClone BCL1/JH Translocation Assay, es una prueba diagnóstica in vitro basada en la reacción en cadena de la polimerasa (PCR), diseñada para la identificación de las translocaciónes genéticas BCL1/JH t(11;14)(q13;q32) en pacientes con sospechas de enfermedades linfoproliferativas. Específicamente, el BCL1/JH Translocation Assay puede utilizarse con los siguientes fines: Identificar translocaciónes genéticas BCL1/JH altamente sugestivas de linfoma del manto. Distinguir linfoma de células del manto de otras neoplasias o proliferaciones benignas de células B. Monitorizar y evaluar recurrencias de la enfermedad. 3. Resumen y descripción del ensayo La translocación genética BCL1/JH t(11;14)(q13;q32) está presente principalmente en el linfoma del manto (LCM) (50-70%), pero también suele presentarse en la leucemia prolinfocítica B (LPL-B) (10-20%), en la leucemia de células plasmáticas (LCP), en el linfoma esplénico con linfocitos vellosos (LELV), en la leucemia linfocítica crónica (LLC) (2-5%) y en el mieloma múltiple (MM) (20-25%) 1. La hibridación in situ fluorescente (FISH) con sondas flanqueantes de la región del cluster de puntos de rotura de la translocación BCL1/JH (Bcr) en la banda q13 del cromosoma 11, reveló que todos los linfomas de células del manto (definidos de acuerdo a la clasificacion REAL) tienen la translocación t(11;14)(q13;q32) 2-3. Los puntos de rotura BCL1/JH están dispersos a lo largo de una región de 350 kilobases (kb). Aproximadamente 41% de estos puntos de rotura se agrupan en un locus de solo 1kb de tamaño conocido como la región del Cluster Mayor de Translocación (MTC) BCL1 3. Esta translocación genética aberrante yuxtapone genes de la región de unión (JH) de la cadena pesada de las inmunoglobulinas (IGH) en el cromosoma 14q32 con el gen de la ciclina D1 en el cromosoma 11q13. La yuxtaposición de las secuencias IGH JH resulta en la activación transcripcional de la ciclina D La ciclina D1 está involucrada en la regulación de la progresión de G1 y de la transición G1/S del ciclo celular. La translocación no lleva a la expresión de una proteína de fusión. De hecho, la oncogénesis es debida a un intercambio promotor/potenciador, mientras que el potenciador de los genes de las inmunoglobulinas estimula la expresión de ciclina D1. La sobre-expresión de ciclina D1, en cambio, acelara el pasaje de células transformadas a través de la fase G1. En la clasificación revisada de la OMS la presencia de la translocación t(11;14)(q13;q32)m y/o la sobre-expresión de ciclina D1 fue agregada como una de las características del linfoma del manto. Los puntos de rotura BCL1/JH agrupados en el locus de 1kb BCL1-MTC pueden ser detectados por la metodología de la reacción en cadena de la polimerasa (PCR). Sin embargo, debe enfatizarse que los puntos de rotura que ocurren fuera del locus BCL1-MTC no serán identificados por este ensayo en particular. Por lo tanto, un resultado negativo no excluye completamente la presencia de un reordenamiento genético BCL1/JH en la muestra. Los resultados de este ensayo deben ser siempre interpretados en el contexto de datos morfológicos y otros datos relevantes, y no como única herramienta para el diagnóstico de una neoplasia. Este ensayo es sumamente útil cuando se lo confronta con un diagnóstico diferencial dificultoso que incluye al linfoma del manto. Por ejemplo, una proliferación neoplásica de células B en tejido, sangre, o medula ósea que es difícil de categorizar como una leucemia linfocítica crónica/linfoma de linfocitos pequeños, linfoma folicular, linfoma de tejido linfático asociado a mucosas, o linfoma del manto pueden ser fácilmente clasificados como este útlimo si se detecta la translocación genética BCL1/JH. Esto tiene implicancias clínicas importantes, ya que los linfomas del manto son típicamente más agresivos y tienen, en general, un peor pronóstico que otros linfomas de células B de bajo grado. Debido a que esta anormalidad molecular es también un marcador tumoral específico, puede utilizarse para determinar las diferentes etapas en las que puede encontrarse el linfoma y para monitorizar recurrencias luego del tratamiento en un paciente, si su linfoma original fue caracterizado y evidenció tener un reordenamiento BCL1/JH. El ensayo IdentiClone de InVivoScribe Technologies representa una nueva propuesta para la determinación diagnóstica de clonalidad basada en la PCR. Estos ensayos estandarizados fueron rigurosamente optimizados analizando muestras controles positivas y negativas empleando múltiples master mixes (mezclas de reacción). El desarrollo del ensayo fue IdentiClone BCL1/JH Gene Translocation Assay Gel Detection

4 Página 4 de 14 seguido por un extenso proceso de validación que incluía la determinación analítica de más de 400 muestras clínicas clasificadas según la Clasificación Revisada Europea/Americana de Linfomas (REAL). Las determinaciones fueron hechas en más de 30 centros de diagnóstico destacados e independientes diseminados a través de toda Europa en el marco de un estudio de colaboración conocido como la Acción Concertada BIOMED-2. Los resultados del estudio BIOMED-2 se encuentran publicados en Leukemia, una revista especializada líder en el área 6. Los ensayos basados en la detección en geles no son capaces de detectar de manera fiable poblaciones clonales que representen menos del 0.1% de la población total de linfocitos. Debe enfatizarse que los resultados de los ensayos moleculares de clonalidad deben interpretarse siempre en un contexto conjunto de datos clínicos, histológicos e inmunofenotípicos. El presente ensayo incluye 2 mezclas de reacción. La mezcla de reacción del Tubo BCL1/JH (BCL1/JH Tube) hibrida en el cluster mayor de translocación (MTC) del locus BCL1 y en la región de unión del locus de la cadena pesada de las inmunoglobulinas. La otra mezcla de reacción, la mezcla de reacción Specimen Control Size Ladder (control de muestra con marcador de tamaño) hibrida con varios genes amplificando una serie de productos de aproximadamente 100, 200, 300, 400 y 600 pares de bases para asegurar que la calidad y cantidad de ADN inicial es la adecuada para generar un resultado válido. En todos nuestros ensayos de clonalidad se utiliza un único programa de termociclador y metodologías de detección similares con lo que se mejora la consistencia interna y facilita el entrenamiento en una gama amplia de ensayos diferentes. 4. Principios del Procedimiento 4.1. Reacción en Cadena de la Polimerasa (PCR) Los ensayos de PCR son utilizados de manera rutinaria para la identificación de translocaciones genéticas. Estos ensayos apuntan a la región MTC de la translocación BCL1/JH y amplifican ADN genómico situado entre los cebadores que hibridan en el gen BCL1 y en las regiones conservadas de unión (JH) del gen IGH (BCL1/JH Tube). Los puntos de rotura que ocurren por fuera del MTC no serán identificados por este ensayo en particular. Por lo tanto, un resultado negativo no excluye completamente la presencia de un reordenamiento genético BCL1/JH en la muestra 6. ADN de una población normal de linfocitos también arrojará un resultado negativo. Figura 1. Representación de un diagrama esquemático de la translocación BCL1/JH t(11;14) mostrando el gen de la ciclina D1 (CCND1) a la izquierda y el gen de la cadena pesada de las inmunoglobulinas (IGH) a la derecha. Las flechas negras indican las posiciones relativas y orientaciones del cebador BCL1/MTC y del cebador JH, que estan incluidos en la mezcla de reaccion del Tubo BCL1/JH Detección en Geles La electroforesis en geles, como la electroforesis en geles de agarosa o en geles de poliacrilamida en condiciones no desnaturalizantes (PAGE), normalmente se utiliza para resolver los amplicones de diferentes tamaños de acuerdo a su tamaño, carga y estructura conformacional. Debido a que el ADN está cargado negativamente, cuando se aplica una diferencia de potencial eléctrico (voltaje) a través del gel que contiene los productos de amplificación por PCR, el campo eléctrico impulsa la migración de los amplicones a través del gel. Los fragmentos de ADN de menor tamaño son capaces de migrar fácilmente a través de la matriz del gel, mientras que los fragmentos de ADN más grandes migran más lentamente. Esto ocasiona la separación de los productos de amplificación de acuerdo a su tamaño. El bromuro de etidio, u otro colorante que se intercale en las hebras del ADN, puede ser luego utilizado para teñir y detectar estos productos en el gel.

5 Página 5 de Reactivos 5.1. Componentes IdentiClone BCL1/JH Translocation Assay Gel Detection 33 Reacciones IdentiClone BCL1/JH Translocation Assay MegaKit Gel Detection 330 Reacciones Tabla 1 Reactivo Mezcla de Reacción (Master Mix) Mezcla Control de Amplificación de la Muestra Control Positivo de ADN Control Negativo (Normal) de ADN Número de Catálogo Componentes del reactivo (ingredientes activos) Cantidad Nro. de unidades Nro. de unidades BCL1/JH Tube Unlabeled Oligonucleótidos que hibridan en la región MTC del gen BCL1 y en la región J del gen IGH en solución salina tamponada. Specimen Control Size Ladder Unlabeled Múltiples oligonucleótidos que hibridan en diferentes genes endógenos. IVS-0010 Clonal Control DNA 200 μg/ml de ADN en solución TE 1/ µl 1 5 IVS-0000 Polyclonal Control DNA 200 μg/ml de ADN en solución TE 1/10 Nota: No se ha utilizado conservante alguno en la fabricación de este producto. T de Conservación 1500 µl to -85 C 1500 µl to -85 C 100 µl to 8 C or -65 to -85 C 2 to 8 C or -65 to -85 C 5.2. Precauciones y Advertencias 1. Este producto es para Uso en Diagnóstico In Vitro 2. El kit de ensayo será usado como un conjunto. Ningún reactivo debe sustituirse por otro reactivo similar proveniente de otro fabricante. El realizar diluciones, reducir los volúmenes de las mezclas de amplificación o cualquier otra desviación del protocolo original pueden afectar la eficacia de este ensayo y/o anular cualquier sublicencia limitada que se adquiera con la compra de este ensayo. 3. Los materiales son estables hasta la fecha de caducidad que se indica en la etiqueta cuando son manipulados, conservados y almacenados de acuerdo a las instrucciones. No utilizar los productos una vez sobrepasada la fecha de caducidad 4. El cumplimiento riguroso de las instrucciones de uso y el seguimiento del protocolo asegurará un funcionamiento analítico y reproducibilidad óptimos. Debe asegurarse de que el programa del termociclador usado sea el correcto, ya que el uso de otros programas puede dar lugar a datos erróneos o inexactos, como resultados falsos positivos y falsos negativos. 5. No mezclar o combinar los reactivos procedentes de kits con diferentes números de lote. 6. Se recuerda al personal del laboratorio que deben usar todos los equipos de protección personal adecuados y trabajar de acuerdo a las buenas prácticas de laboratorio y a las recomendaciones universales para el trabajo con muestras biológicas. Las muestras deben ser manipuladas en instalaciones homologadas de contención de seguridad biológica y abiertas solamente en cabinas de seguridad biológica certificadas. Se recomienda el uso de agua destilada de grado biología molecular en la preparación del ADN de la muestra. 7. Debido a la sensibilidad analítica de este ensayo, se debe tener un cuidado extremo para prevenir la contaminación de los reactivos o de las mezclas de amplificación con las muestras, controles o materiales amplificados. Todos los reactivos deben ser cuidadosamente examinados para detectar cualquier signo de contaminación (por ej. Controles negativos que generen señales positivas). Se debe descartar inmediatamente cualquier reactivo con sospecha de contaminación. 8. Para minimizar las posibilidades de contaminación, se deben utilizar guantes limpios cuando se manipulen las muestras y los reactivos. Las áreas de trabajo y las pipetas se deben limpiar de forma rutinaria antes de empezar a realizar cualquier reacción de PCR. 9. El proceso de esterilización en autoclave no elimina la contaminación con ADN. El flujo de trabajo en el laboratorio de PCR debe ir siempre en una sola dirección entre las diferentes áreas de trabajo separadas; comenzando en el área de Preparación de las Mezclas de Reacción; siguiendo en el de la Preparación de la Muestra, pasando a continuación al de la Amplificación, y finalmente al de la Detección. No introducir ADN amplificado en las áreas designadas para la preparación de la muestra o de las mezclas de reacción. 10. Todas las pipetas, puntas y cualquier otro equipamiento utilizado en un área particular debe ser utilizado y mantenido dentro de esa área del laboratorio. IdentiClone BCL1/JH Gene Translocation Assay Gel Detection

6 Página 6 de Con el objetivo de prevenir la contaminación cruzada, y/o con RNasas y DNasas, siempre que sea posible, se debe utilizar material plástico estéril y desechable Almacenamiento y Manipulación Si el producto no es usado de forma inmediata, el kit debe ser almacenado entre -65 C y -85 C. La temperatura de almacenamiento óptima para los controles de ADN es entre 2 C y 8 C, aunque también pueden ser almacenados entre -65 C y -85 C. Todos los reactivos y controles deben ser descongelados y agitados vigorosamente antes de usarse para asegurar que se han resuspendido completamente. La agitación excesiva puede causar roturas en el ADN. Los materiales son estables hasta la fecha de caducidad indicada cuando son manipulados y almacenados de acuerdo a las instrucciones. No deben utilizarse pasada su fecha de caducidad. Debido a su alta concentración salina, las mezclas de reacción de PCR son sensibles a los ciclos de congelado/descongelado. En caso necesario, las mezclas de reacción se deben alicuotar en tubos estériles y herméticos, con tapa de rosca y junta de goma. 6. Instrumentos 6.1. Termociclador Uso ó Función: Amplificación de muestras de ADN Especificaciones y Características de Funcionamiento: Rango Térmico Mínimo: de 15 C a 96 C Velocidad Mínima de la Rampa: 0.8 C/seg Seguir los protocolos de instalación, operación, calibración y mantenimiento del fabricante. Ver la sección 8.4 Amplificación para el programa del termociclador Unidad de Electroforesis Uso ó Función: Separación de fragmentos de ADN Especificaciones y Características de Funcionamiento: Capaz de aplicar una diferencia de potencial desde 35V hasta 135V durante tiempos prolongados Seguir los protocolos de instalación, operación, calibración y mantenimiento del fabricante Unidad de Iluminación UV Uso o Función: Detección de ADN Especificaciones y Características de Funcionamiento: Capaz de emitir luz a una longitud de onda de ~302 nm Seguir los protocolos de instalación, operación, calibración y mantenimiento del fabricante. 7. Recogida y Preparación de la Muestra 7.1. Precauciones Las muestras biológicas humanas pueden contener materiales potencialmente infecciosos. Todas las muestras deben manipularse de acuerdo con las normas estándar OSHA sobre patógenos de transmisión sanguínea o las normas de bioseguridad de nivel Sustancias que Interfieren Se sabe que las siguientes sustancias interfieren en la reacción de PCR: 1. Quelantes de cationes divalentes 2. Puntas de pipetas de retención baja 3. EDTA (no significativo a bajas concentraciones) 4. Heparina 7.3. Requerimientos de la Muestra y su manipulación Este ensayo analiza ADN genómico proveniente de las siguientes fuentes: 1. 5 ml de sangre periférica, biopsia de médula ósea, o aspirado de médula ósea anticoagulado con heparina o EDTA (conservado entre 2 C y 8 C y transportado a temperatura ambiente) 2. Un mínimo de 5mm cuadrados (5mm 3 ) de tejido (conservado y transportado congelado; o conservado y transportado en RPMI 1640 a temperatura ambiente o en hielo) 3. 2μg de ADN genómico (conservado entre 2 C y 8 C y transportado a temperatura ambiente)

7 Página 7 de Muestras o cortes de tejido fijados en formol y embebidos en parafina (conservados y transportados a temperatura ambiente) 7.4. Preparación de la Muestra Extraer el ADN genómico de las muestras de los pacientes tan pronto como sea posible. Resuspender el ADN a una concentración final de 100 μg a 400 μg por ml en TE 1/10 (1 mm Tris-HCl, ph 8.0; 0.1 mm EDTA) o en agua grado biología molecular o grado USP. Este ensayo es un sistema robusto. Un amplio rango de concentraciones de ADN será capaz de generar un resultado válido. Por lo tanto, generalmente no son necesarios la cuantificación y el ajuste de las concentraciones de ADN. El análisis de la muestra problema de ADN con el Specimen Control Size Ladder asegurará que existe ADN en cantidad y calidad suficientes para generar un resultado válido Conservación de la Muestra El ADN genómico debe conservarse entre 2 C y 8 C o entre -65 C y -85 C hasta el momento de su uso. 8. Procedimiento del Ensayo 8.1. Materiales Suministrados en el Kit Tabla 2 Número de Catálogo Descripción BCL1/JH Tube Unlabeled Specimen Control Size Ladder Unlabeled IVS-0010 Clonal Control DNA IVS-0000 Polyclonal Control DNA 8.2. Materiales Requeridos pero No Suministrados en el Kit Tabla 3 Reactivo/Material Reactivos/Materiales y Proveedores Recomendados Notas ADN Polimerasa Agua Bi-Destilada Grado Biología Molecular o Agua Grado USP Pipetas Calibradas Termociclador Applied Biosystems: AmpliTaq Gold DNA Polymerase (Cat# N ) Rainin: Pipetas P-2, P-20, P-200, y P-1000 O pipetas SL-2, SL-20, SL-200, y SL-1000 Bio-Rad: MJ Research PTC-100 o PTC-200, PTC-220, PTC-240 Perkin-Elmer PE 9600 o PE 9700 El agua debe ser estéril y libre de DNasas y RNasas. Deben ser capaces de medir volúmenes exactos entre 1μl y 1000μl. Mezcladores Vortex Placas o tubos para PCR Estériles Puntas de pipetas con Estériles, libres de filtro Pirógenos/RNasas/DNasas Tubos para microcentrífuga Estériles Unidad de Electroforesis en Geles Para geles de poliacrilamida Agarosa Cambrex: MetaPhor Agarose (Cat# 50180) NuSieve 3:1 Agarose (Cat# 50090) Bromuro de Etidio Invitrogen: UltraPure 10 mg/ml Ethidium Bromide (Cat# ) Buffer de Corrida TBE Invitrogen: Novex TBE Running Buffer (5X) (Cat# LC6675) Diluir 1:5 antes de usar IdentiClone BCL1/JH Gene Translocation Assay Gel Detection

8 Página 8 de 14 Reactivo/Material Reactivos/Materiales y Proveedores Recomendados Notas Buffer de Siembra en el Gel Marcadores de tamaño de ADN 100 bp InVivoScribe Technologies: 6X Loading Buffer (No Dyes) (Cat# ) 6X Loading Dye I (Light Dyes) (Cat# ) 6X Loading Dye II (Very Light Dyes) (Cat# ) Invitrogen: 10X BlueJuice Gel Loading Buffer (Cat# ) Novex Hi-Density TBE Sample Buffer (5X) (Cat# LC6678) Invitrogen: TrackIt 100 bp DNA Ladder (Cat# ) 8.3. Preparación de los Reactivos Todas las muestras desconocidas deben ser analizadas usando la mezcla de reacción del Specimen Control Size Ladder. Esto se hace para asegurar que no están presentes inhibidores de la amplificación y que hay ADN en cantidad y calidad suficientes para generar un resultado válido. Los resultados generados con un análisis único son válidos; no obstante, se recomienda realizar el análisis de cada muestra por duplicado siempre que sea posible. Si el análisis por duplicado genera resultados inconsistentes, es necesario volver a ensayar o analizar la muestra. Los controles positivo, negativo y blanco deben ser analizados para cada una de las mezclas de reacción. 1. Usando guantes, sacar las mezclas de reacción de reacción del congelador. Dejar que los tubos se descongelen completamente y entonces mezclar suavemente. 2. En una cabina de contención tomar una alícuota suficiente de cada mezcla de reacción y transferirla a tubos de microcentrífuga individuales, limpios y estériles. Los volúmenes de las alícuotas deben ser de 45μl para cada reacción. Se recomienda añadir una reacción extra por cada 15 reacciones, para compensar los errores de pipeteo. De esta manera, para cada mezcla de reacción (excepto para el Specimen Control Size Ladder), el número de reacciones (n) debe ser: n = 2 # de muestras (correr cada muestra por duplicado) + 1 control positivo de ADN (Ver sección 8.7 Controles Positivos Recomendados) + 1 control negativo de ADN (IVS-0000 Polyclonal Control DNA) + 1 control sin templado o blanco (agua) + 1 para compensar los errores de pipeteo n = 2 # de muestras + 4 Total Por lo tanto el volumen total de alícuota para cada mezcla de reacción debería ser n 45μl. Para la mezcla de reacción del Specimen Control Size Ladder, el número de reacciones (m) debería ser: m = # de muestras (correr cada muestra por duplicado) + 1 control negativo de ADN (IVS-0000 Polyclonal Control DNA) + 1 control sin templado o blanco (agua) + 1 para compensar los errores de pipeteo m = # de muestras + 3 Total Por lo tanto el volumen total de alícuota para la mezcla de reacción del Specimen Control Size Ladder debería ser m 45μl. 3. Añadir 1.25 unidades (o 0.25μl a 5 unidades/μl) de ADN polimerasa AmpliTaq Gold por reacción a cada mezcla de reacción. El total de polimerasa AmpliTaq Gold que es necesaria añadir a cada mezcla maestra de reacción deberá ser n 0.25μl, y m 0.25μl para la mezcla de reacción del Specimen Control Size Ladder. Mezclar suavemente con vortex. 4. Para cada reacción, alicuotar 45μl de la respectiva mezcla de reacción + ADN polimerasa en cada pocillo de una placa de PCR o tubo. 5. Añadir 5μl de la muestra correspondiente (muestra problema de ADN, control positivo de ADN, control negativo de ADN, o agua) en cada pocillo que contenga las respectivas mezclas de reacción. Mezclar suavemente con la pipeta varias veces. 6. Tapar los tubos o cubrir la placa de PCR. 7. Las muestras están ahora listas para ser amplificadas en un termociclador.

9 Página 9 de 14 Si la amplificación no puede realizarse inmediatamente después de la preparación de los reactivos, la placa de PCR o los tubos pueden ser conservados entre 2 C y 8 C por un período de hasta 24 horas. Guía Rápida: Para cada mezcla de reacción de reacción y n reacciones, mezclar: n 45μl Mezcla de Reacción n 0.25μl ADN polimerasa AmpliTaq Gold Vorterear suavemente para mezclar. Alicuotar 45μl de mezcla de reacción + solución de ADN polimerasa en cada reservorio de reacción. Agregar 5μl del respectivo Templado a cada reservorio. Volumen total de reacción = 50μl 8.4. Amplificación 1. Amplificar las muestras usando el siguiente programa de PCR: (Nota: Se recomienda usar la opción calculada para la medición de la temperatura con los termocicladores PTC BioRad MJ Research.) Programa Estándar para AmpliTaq Gold Paso 1: 95 C por 7 minutos Paso 2: 95 C por 45 segundos Paso 3: 60 C por 45 segundos Paso 4: 72 C por 90 segundos Paso 5: Ir a paso 2; repetir 34 veces Paso 6: 72 C por 10 minutos Paso 7: 15 C por tiempo indefinido 2. Retirar los tubos o la placa de amplificación del termociclador. Aunque el ADN amplificado es estable a temperatura ambiente durante largos períodos de tiempo, los productos de PCR deben almacenarse entre 2 C y 8 C hasta la detección. La detección debe realizarse dentro de los 30 días posteriores a la amplificación Detección en Geles Geles de Agarosa TBE 1. Preparar un gel de agarosa MetaPhor o NuSieve 3:1 al 2% en solución tampón TBE 1X. 2. Colocar el gel en la unidad de electroforesis y cubrirlo con solución tampón TBE. 3. Mezclar 20μl de cada producto de PCR con 4μl de buffer de siembra 6X. 4. Sembrar todos estos 20μl de la mezcla en cada reservorio individual del gel y sembrar 4μl de Marcadores de tamaño de ADN 100 bp flanqueando las muestras. 5. Correr el gel a 100V durante 90 minutos. El voltaje y el tiempo de corrida dependen del tamaño del amplicón de PCR, de la longitud del gel y del porcentaje de agarosa en el gel. El voltaje y el tiempo de corrida pueden ser adaptados de acuerdo a estos últimos. 6. Teñir los geles con Bromuro de Etidio u otro colorante equivalente. 7. Colocar el gel sobre la unidad de ilumincación UV para visualizar las bandas. 8. Fotografiar e interpretar los resultados. (Ver secciones 9 Interpretación de los Resultados y 11 Valores Esperados debajo.) 8.6. Control de Calidad En el kit se suministran controles positivos y negativos (o normales) y deben ser analizados cada vez que se desarrolla el ensayo para asegurar el desarrollo apropiado del mismo. Adicionalmente, se debe incluir un control sin ADN (por ej. agua) para controlar la posible contaminación de la mezcla de reacción o la contaminación cruzada de las reacciones de PCR debidas al empleo de técnicas asépticas inadecuadas. También se debe incluir un control de la solución tampón para asegurar que el tampón utilizado para resuspender las muestras no ha sido contaminado. Los valores de los controles positivos se encuentran en la sección 11.1 Tamaño Esperado de los Productos Amplificados. Controles adicionales y controles de sensibilidad (diluciones de los controles positivos en el control negativo) se encuentran disponibles en InVivoScribe Technologies. IdentiClone BCL1/JH Gene Translocation Assay Gel Detection

10 Página 10 de Controles Positivos Recomendados Los tamaños de los productos amplificados mostrados en la tabla se obtuvieron usando una plataforma ABI 3100 o por electroforesis en geles. Tabla 4 Mezcla de reacción BCL1/JH Tube Secuencia Blanco MTC de BCL1/JH Genes Múltiples ADN Control Número de Catálogo Tamaño del Producto en pares de bases a 202, ~600 b 100, 200, 300, 400, 600 c 100, 200, 300, 400, 600 c Rango de Tamaños Válido IVS-0010 Clonal Control DNA Specimen Control Rango de Tamaños Válido Size Ladder IVS-0000 Polyclonal Control DNA Nota a : En condiciones sub-óptimas una banda débil inespecífica de ~550bp puede ser detectada. Para discriminar entre específica e inespecífica, el control negativo de ADN no debe mostrar esta banda. Si una banda está presenten en el control negativo, entonces es inespecífica. Nota b : La banda de ~600bp es un producto inespecífico. Nota c : Debido a que los fragmentos de PCR de menor tamaño son preferencialmente amplificados, no es inusual que el fragmento de 600pb presente una señal disminuida o que se pierda completamente. 9. Interpretación de los Resultados Aunque un resultado positivo es altamente sugestivo de un proceso neoplásico, tanto los resultados positivos como los negativos deben interpretarse en un contexto global con toda la información clínica y los resultados de los ensayos del laboratorio. El rango de tamaños para cada una de las mezclas de reacción ha sido determinado analizando muestras control positivas y negativas. Para una interpretación exacta y significativa es importante tener en cuenta que se deben ignorar las bandas que aparezcan fuera del rango de tamaños válido para cada una de las mezclas de reacción Análisis 1. Muestras que no amplifican después de ser ensayadas repetidamente deber ser informadas como No se puede informar un resultado de esta muestra debido a que no se obtiene ADN en cantidad o calidad suficiente para su análisis. 2. Muestras que generan un resultado negativo deben ser repetidas si el control positivo de la reacción no amplificó. 3. Si las muestras analizadas por duplicado generan resultados diferentes, el ensayo debe ser repetido o vuelto a evaluar para aclarar un posible cambio de muestras. 4. Todos los controles del ensayo deben ser examinados previamente a la interpretación de los resultados de la muestra problema. Si los controles no generan los resultados correctos, el ensayo no es válido y las muestras no deben ser interpretadas. La siguiente tabla describe el análisis de cada uno de los controles y las acciones a seguir basándose en los resultados obtenidos. Tabla 5 Tipo de Control Resultado Esperado Resultado Aberrante Control Sin Templado No presenta amplificación, continuar con el análisis. Amplificación presente, repetir el ensayo. Control Policlonal Control Positivo (Este también puede ser un control de extracción si se añade un material control positivo a través de los procesos de extracción) El tamaño del producto es consistente con el tamaño esperado de acuerdo a la lista de la sección 11.1 Tamaño Esperado de los Productos Amplificados. No hay reordenamientos clonales presentes. Continuar con el análisis. El tamaño del producto es consistente con el tamaño esperado de acuerdo a la lista de la sección 11.1 Tamaño Esperado de los Productos Amplificados. Continuar con el análisis. Presenta reordenamientos clonales, repetir el ensayo. Repetir el ensayo.

11 Tipo de Control Resultado Esperado Resultado Aberrante Specimen Control Size Ladder (Este control de amplificación es esencial para muestras de calidad y cantidad desconocida.) Si todas las bandas de 100, 200, 300, 400, y 600pb están presentes, continuar con el análisis. Debido a que los fragmentos de PCR de menor tamaño son preferencialmente amplificados, es normal que el fragmento de 600pb presente una señal disminuida o que se la pierda completamente. Continuar con el análisis. Página 11 de 14 Si no se observan bandas, repetir el ensayo a menos que la muestra resulte positiva. Si sólo se observan 1, 2, o 3 bandas, re-evaluar la muestra para determinar una posible degradación del ADN a menos que la muestra resulte positiva Interpretación de la Muestra Problema Cuando los controles generan los resultados esperados, las muestras clínicas deben ser interpretadas como se detalla a continuación: Una o dos bandas positivas prominentes a dentro del rango de tamaños válido se informa como: Positivo para la detección de una translocación BCL1/JH t(11;14) consistente con la presencia de una población célular clonal. En un contexto global de criterios diagnósticos, las poblaciones célulares clonales pueden indicar la presencia de una neoplasia hematológica. La ausencia de bandas positivas a dentro del rango de tamaños válido se informa como: Negativo para la detección de una translocación BCL1/JH t(11;14). Nota a : Los criterios para definir una banda positiva son los siguientes: Los productos generados de muestras que caen dentro del rango de tamaños válido y presentan bandas discretas y definidas son consistentes con una banda positiva. 10. Limitaciones del Ensayo Este ensayo no identifica el 100% de las poblaciones célulares clonales. Este ensayo no puede detectar de manera fiable una cantidad menor de 1 célula positiva por cada 1000 células normales. Los resultados de las pruebas moleculares de clonalidad siempre deben ser interpretados en el contexto global de datos clínicos, histológicos e inmunofenotípicos. Los ensayos basados en la técnica de PCR están sujetos a interferencia por la degradación del ADN o por la inhibición de la PCR debida a EDTA, heparina y otros agentes. 11. Valores Esperados Tamaño Esperado de los Productos Amplificados Los tamaños de los productos amplificados mostrados en la tabla se obtuvieron usando una plataforma ABI 3100 o por electroforesis en geles. Tabla 6 Mezcla de Reacción BCL1/JH Tube Secuencia Blanco MTC de BCL1/JH Genes Múltiples ADN Control Número de Catálogo Tamaño del Producto en Pares de Bases a 202, ~600 b 100, 200, 300, 400, 600 c 100, 200, 300, 400, 600 c Rango de Tamaños Válido IVS-0010 Clonal Control DNA Specimen Control Rango de Tamaños Válido Size Ladder IVS-0000 Polyclonal Control DNA Nota a : En condiciones sub-óptimas una banda débil inespecífica de ~550bp puede ser detectada. Para discriminar entre específica e inespecífica, el control negativo de ADN no debe mostrar esta banda. Si una banda está presenten en el control negativo, entonces es inespecífica. Nota b : La banda de ~600bp es un producto inespecífico. Nota c : Debido a que los fragmentos de PCR de menor tamaño son preferencialmente amplificados, no es inusual que el fragmento de 600pb presente una señal disminuida o que se pierda completamente. IdentiClone BCL1/JH Gene Translocation Assay Gel Detection

12 Página 12 de Resultados de la Muestra Los resultados que se muestran a continuación fueron generados utilizando las mezclas de reacción indicadas. Los productos amplificados fueron corridos en un gel de agarosa al 2%. Para la mezcla de reacción BCL1/JH: El carril 1 muestra los datos generados al ensayar el control recomendado de ADN 100% clonal. El carril 2 muestra los datos generados al ensayar una dilución al 10% del control recomendado de ADN clonal. El carril 3 muestra los datos generados al ensayar una dilución al 1% del control recomendado de ADN clonal. El carril 4 muestra los datos generados al ensayar una dilución al 0.1% del control recomendado de ADN clonal. El carril 5 muestra los datos generados al ensayar el control de ADN policlonal, IVS-0000 Polyclonal Control DNA. Figura 2 Para la mezcla de reacción del Specimen Control Size Ladder: El carril 1 muestra un marcador de tamaños de ADN de 100pb. El carril 2 muestra un marcador de tamaños de ADN de 50pb. Los carriles 3 y 4 muestran los datos generados al ensayar dos muestras diferentes de ADN genómico. Figura 3

13 Página 13 de Características Analíticas Estudios iniciales de 5 muestras positivas y 2 negativas mostraron una concordancia de un 100% con un ensayo casero de PCR. Un estudio mas grande, conducido en tres laboratorios, determinó a 25 casos como postivos y a 18 casos como negativos para la translocación BCL1/JH utilizando ensayos caseros. Para las muestras negativas, la concordancia fue de un 100% utilizando ambos formatos, detección en geles y detección de fluorescencia. Para las muestras positivas, la concordancia fue de un 100% (25 de 25 muestras) utilizando detección de fluorescencia, y de un 88% (22 de 25 casos) utilizando detección en geles. La especificidad para ambos formatos fue de un 100% y la sensibilidad fue determinada como de entre 10-3 y Nosotros concluímos que la sensibilidad del IdentiClone BCL1/JH Translocation Assay es de entre 1 célula positiva en 10 3 células normales y 1 célula positiva en 10 4 células normales y es suficientemente alta para la detección de los puntos de rotura BCL1/JH en material al diagnóstico. No obstante, solamente el 40-50% de los puntos de rotura t(11;14) en el linfoma del manto (LCM) serán detectados utilizando solamente técnicas de PCR. 13. Bibliografía 1. Huret, JL. t(11;14)(q13;q32). Atlas Genet. Cytogenet. Oncol. Haematol. May Coignet, LJA et al. Detection of 11q13 rearrangements in hematologic neoplasias by double color Fluorescence In Situ Hybridization. Blood 1996, 87: Vaandrager, J et al. Direct visualization of dispersed 11q13 chromosomal translocations in mantle cell lymphoma by multicolor DNA fiber fluorescence in situ hybridization. Blood 1996, 88: De Boer, CJ et al. Cyclin D1 messenger RNA overexpression as a marker for mantle cell lymphoma. Oncogene 1995, 10: De Boer, CJ et al. Cyclin D1 protein overexpression as a marker for mantle cell lymphoma. Blood 1995, 86: Van Dongen, JJM et al. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: Report of the BIOMED-2 Concerted Action BMH4-CT Leukemia 2003, 17(12): Servicio Técnico y al Cliente Fabricante Representante Autorizado y Asistencia Técnica en la UE InVivoScribe Technologies, Inc. InVivoScribe Technologies, SARL 6330 Nancy Ridge Drive, Suite 106 Le Forum Bât B San Diego, California Avenue de la Tramontane USA ZI Athelia IV La Ciotat, France Teléfono: Teléfono: +33 (0) Fax: Fax: +33 (0) Servicio Técnico: Servicio Técnico: Servicio al cliente: Servicio al Cliente: Sitio Web: Sitio Web: Horario de atención: 7:00AM 5:00PM PST/PDT Horario de atención: 9:00AM 5:00PM CET/CEST Los representantes técnicos y de atención al cliente están disponibles de lunes a viernes para responder a todas sus preguntas, mediante consultas telefónicas, por correo electrónico o en la web. IdentiClone BCL1/JH Gene Translocation Assay Gel Detection

14 Página 14 de Aspectos Legales Este es un producto de diagnóstico in vitro. La metodología empleada está protegida por las patentes número 5,296,351 y 5,418,134 de los Estados Unidos de América; por la patente número 626,601 de Australia y por la patente número 2,781,438 de Japón, todas las cuales están bajo licencia exclusiva de InVivoScribe Technologies ( IVS ). Esta metodología también requiere métodos de amplificación de ácidos nucleicos como la Reacción en Cadena de la Polimerasa (PCR). En determinados países, esta tecnología está o puede estar cubierta por derechos bajo patente de Hoffmann-LaRoche, Inc. y de F. Hoffmann-LaRoche Ltd. Ninguna licencia para el uso de la metodología de PCR cubierta por alguna de estas últimas patentes es otorgada al comprador, expresamente o por implicación, por la simple compra de estos productos. Como lo es para cualquier uso dentro de los Estados Unidos de América, Australia y Japón (incluyendo el envío de resultados a estos países): La adquisición de este producto incluye una sublicencia limitada para la práctica no comercial y sin fines de lucro de esta tecnología si, y solo si, el comprador está registrado en IVS exclusivamente como un usuario de productos IVS sin fines de lucro. Ninguna licencia para tal uso es otorgada por la simple compra de estos productos. Para solicitar un formulario de registro de usuario exclusivo de productos sin fines de lucro, para discutir los términos de una potencial sublicencia para realizar una práctica más amplia de estos métodos, o por otras inquietudes, por favor contacte con IVS mediante correo electrónico a: o por teléfono al número IdentiClone es una marca registrada de InVivoScribe Technologies. P/N Revisión B 2009/05

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón

ELABORACIÓN N DE MEZCLA PARA PCR. Raquel Asunción Lima Cordón ELABORACIÓN N DE MEZCLA PARA PCR Raquel Asunción Lima Cordón PCR Polymerase Chain reaction (reacción en cadena de la polimerasa) Sintetizar muchas veces un fragmento de ADN PCR: simulación de lo que sucede

Más detalles

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml

Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Protocolo de laboratorio para purificación manual de ADN a partir de una muestra de 0,5 ml Para la purificación de ADN genómico de todos los kits de colección Oragene y ORAcollect. Visite nuestro sitio

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Características del kit:

Características del kit: ! La detección de clonalidad mediante análisis molecular por PCR de reordenamientos de los genes de las inmunoglobulinas (Ig) y TCR, es un instrumento de gran valor en el diagnóstico de los procesos linfoproliferativos

Más detalles

Materiales para la secuenciación de ADN

Materiales para la secuenciación de ADN Introduccion La Secuenciación Sanger es un método de secuenciación de ADN en el que el ADN diana se desnaturaliza y se hibrida con un cebador de oligonucleótidos, que se extiende entonces gracias a la

Más detalles

TaqMan GMO Screening Kit. Part No: 4466334

TaqMan GMO Screening Kit. Part No: 4466334 TaqMan GMO Screening Kit Part No: 4466334 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan mayor

Más detalles

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091

Instrucciones de uso. Wipe test. Control de Contaminación. Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 Instrucciones de uso Wipe test Control de Contaminación Kit de pruebas para la detección de contaminaciones basado en genética molecular REF 7091 40 Reacciones 1. Descripción del Producto El uso de la

Más detalles

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014

C V C. Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revisión 2. Julio de 2014 DOT142v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Página 1 de 7 Instrucciones de uso de Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revisión 2 Julio de

Más detalles

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala

Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala Caracterización morfo-agronómica y molecular de frijoles criollos de color rojo claro en Nicaragua y de frijoles negros en Ipala, Guatemala IICA/Red SICTA-CIAT INFORME DE AVANCE Gerardo Gallego - Harold

Más detalles

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN

5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN 5. DETECCION DE GENES DE VIRULENCIA MEDIANTE HIBRIDACIÓN CON SONDAS DE ADN Materiales - Eppendorf de 1,5 ml estériles - Eppendorf de pared fina para PCR - Puntas de pipeta estériles desechables - Guantes

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

DETERMINACIÓN DEL FACTOR Rh por PCR

DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G.

Código: IDK-010 Ver: 1. Proteína G C825T. Sistema para la detección de la mutación C825T en el gene de la proteína G. C825T Sistema para la detección de la mutación C825T en el gene de la proteína G. Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy www.atgen.com.uy

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ).

1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de Quant- it PicoGreen dsaadnssay Kit (Invitrogen ). 1. Título. Cuantificacion de ADN por espectrofluorometría mediante el uso de QuantiT PicoGreen dsaadnssay Kit (Invitrogen ). 2. Finalidad. El presente documento describe el Procedimiento Normalizado de

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera.

PROSPECTO. Para uso diagnóstico in vitro. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. Para uso en la preparación y aislamiento de linfocitos purificados directamente de sangre entera. PROSPECTO Para uso diagnóstico in vitro PI-TT.610-ES-V5 Información e instrucciones Uso previsto El reactivo

Más detalles

Protocolos de secuenciación de ADN

Protocolos de secuenciación de ADN 1 Protocolos de secuenciación de ADN Introducción El método de secuenciación utilizado aquí es el desarrollado por Sanger en 1975. Este consiste en la incorporación de didesixinucleótidos marcados fluorescentemente

Más detalles

DANAGENE RNA PURIFICATION KIT

DANAGENE RNA PURIFICATION KIT DANAGENE RNA PURIFICATION KIT REF.0801.1 100 EXTRACCIONES REF.0801.2 500 EXTRACCIONES 1.INTRODUCCION Este kit permite la permite la obtención de ARN total a partir de cultivos celulares, tejidos animales,

Más detalles

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa

38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa 38. Purificación de ADN plasmídico y electroforesis del mismo en gel de agarosa José Luis Caballero Repullo, Enriqueta Moyano, Juan Muñoz Blanco Departamento de Bioquímica y Biología Molecular, Campus

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España

Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Fabricado por: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid España Tel. 91 710 00 74 Fax 93 843 78 84 e-mail: info@biotools.eu www.biotools.eu BIOPAP Kit Kit para la detección

Más detalles

Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas.

Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas. Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas. El análisis cromosómico ha proporcionado un conocimiento básico de los cambios genéticos responsables de las

Más detalles

Historia. Hibridación in situ Fluorescente

Historia. Hibridación in situ Fluorescente Fluorescent in situ Hybridization Historia Hibridación in situ Desarrollada por Pardue & Gall (1969) -Muy pocas secuencias de DNA disponibles -Radioisótopos Alto entrenamiento Seguridad Tiempo Hibridación

Más detalles

III. METODOLOGÍA EXPERIMENTAL

III. METODOLOGÍA EXPERIMENTAL III. METODOLOGÍA EXPERIMENTAL 3.1 Análisis Previos Se utilizaron los filtros con muestra de partículas suspendidas en el aire PM 10 que el Instituto Municipal de Ecología (IME) proporcionó para llevar

Más detalles

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO

TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG

FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles

Práctico: Genética bacteriana 2007.

Práctico: Genética bacteriana 2007. Práctico: Genética bacteriana 2007. Actividad integrada Departamento de Genética Departamento de Bacteriología y Virología. OBJETIVOS Objetivos generales El estudiante al terminar la actividad práctica

Más detalles

Instrucciones de Uso GenDx SBTexcellerator

Instrucciones de Uso GenDx SBTexcellerator Octavo Edición Julio de 2011 Instrucciones de Uso GenDx SBTexcellerator Para Tipificación Basada en Secuenciación de HLA de alta resolución Genome Diagnostics B.V. Teléfono: +31 302 523 799 Correo electrónico:

Más detalles

HOSPITAL CLÍNIC-IDIBAPS

HOSPITAL CLÍNIC-IDIBAPS RED NACIONAL DE CENTROS DE CÁNCER PROGRAMA DE DIAGNÓSTICO DEL CÁNCER SUBPROGRAMA DE DIAGNÓSTICO MOLECULAR EN NEOPLASIAS HEMATOLÓGICAS CATÁLOGO DE SERVICIOS I. INFORMACIÓN GENERAL: HOSPITAL CLÍNIC-IDIBAPS

Más detalles

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR

Módulo 1 Biología Molecular Genética Molecular II 2009. Módulo 1. Amplificación de un fragmento de ADN genómico por PCR Módulo 1 Amplificación de un fragmento de ADN genómico por PCR En este primer módulo se amplificará por PCR, mediante el uso de oligonucleótidos específicos, un fragmento de ADN genómico de Aspergillus

Más detalles

Selección de pacientes

Selección de pacientes 2 Selección de pacientes MENSAJES CLAVE Aproximadamente entre el 20% y el 30% de las pacientes con cáncer de mama presentan tumores HER2 positivos. Hasta un 24% de los tumores con receptores de estrógenos

Más detalles

IgK-IgL Rearrangements Molecular Analysis Kit Nº CAT. MAD-003999M (20 tests)

IgK-IgL Rearrangements Molecular Analysis Kit Nº CAT. MAD-003999M (20 tests) IgK-IgL Rearrangements Molecular Analysis Kit Nº CAT. MAD-003999M (20 tests) El diagnóstico de los linfomas malignos es una de las áreas que más dificultad reviste dentro de la histopatología. Si bien

Más detalles

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211

imegen Alfa-1-AT Manual de Usuario Referencia: IMG-211 Manual de Usuario imegen Alfa-1-AT Genotipado de las mutaciones Glu342Lys (PI-Z) y Glu264Val (PI-S) del gen SERPINA1 mediante PCR a tiempo real Referencia: Fabricado en España Garantías y responsabilidades

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com

ELECTROFORESIS EN GELES DE AGAROSA. Agustín Garrido. agugarrido@hotmail.com 1 ELECTROFORESIS EN GELES DE AGAROSA Agustín Garrido agugarrido@hotmail.com Introducción En este trabajo práctico se utilizó la técnica de electroforesis. Este proceso se basa en la migración de las moléculas

Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino

DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

MANUAL DE PRÁCTICAS DE LABORATORIO

MANUAL DE PRÁCTICAS DE LABORATORIO MANUAL DE PRÁCTICAS DE LABORATORIO INGENIERIA ENBIOTECNOLOGÍA INGENIERÍA GENÉTICA FICHA TECNICA FICHA TÉCNICA SEMINARIO DE BIOTECNOLOGÍA MÉDICO-FARMACÉUTICA Fecha: Nombre del catedrático: 10-Julio-2012

Más detalles

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL

CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL LIBRO DE MEMORIAS 2 CURSO DE EXTENSIÓN TEÓRICO PRÁCTICO HERRAMIENTAS EFICIENTES PARA LA IDENTIFICACIÓN DE LEVADURAS DE INTERÉS AGROINDUSTRIAL Santiago de Cali, 23 al 28 de agosto de 2010 3 Libro de memorias

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml)

3. COMPONENTES. Tampón de electroforesis concentrado 2 x 50 ml 10 X (2 envases 500ml) PCR SIMULADA Ref.PCR Simulada (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408.

PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. Technical Manual PowerPlex Fusion System INSTRUCCIONES PARA UTILIZAR LOS PRODUCTOS DC2402 Y DC2408. IMPRESO EN ESTADOS UNIDOS PowerPlex Fusion System Toda la bibliografía técnica está disponible en Internet,

Más detalles

Practica la genética Ficha didáctica del profesorado Bachillerato

Practica la genética Ficha didáctica del profesorado Bachillerato Ficha didáctica del profesorado Bachillerato www.eurekamuseoa.es Extracción de ADN Cuál es la función de cada uno de los ingredientes utilizados para realizar la disolución tampón para la visualización

Más detalles

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina

CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA. Grado en Medicina DEPARTAMENTO DE BIOQUÍMICA Y BIOLOGÍA MOLECULAR III FACULTAD DE MEDICINA UNIVERSIDAD COMPLUTENSE DE MADRID CUADERNO DE PRÁCTICAS GENETICA MOLECULAR HUMANA Grado en Medicina CURSO ACADÉMICO 2014/2015 INDICE

Más detalles

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR

TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR TRABAJO PRÁCTICO Nº 5: ÁCIDOS NUCLEICOS DOCENTES: Andrés Ciocchini, Gabriela Niemirowicz. DESCRIPCIÓN DE LOS MÉTODOS A UTILIZAR Purificación de ácido desoxiribonucleico (ADN) por partición diferencial

Más detalles

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271.

Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. Technical Manual Kit PunchSolution INSTRUCCIONES PARA UTILIZAR EL PRODUCTO DC9271. IMPRESO EN ESTADOS UNIDOS 5/12 Kit PunchSolution Toda la bibliografía técnica está disponible en Internet, en el sitio

Más detalles

CAPÍTULO VI. Expresión de genes relacionados con apoptosis

CAPÍTULO VI. Expresión de genes relacionados con apoptosis CAPÍTULO VI Expresión de genes relacionados con apoptosis 1.- Introducción 2.- Protocolos para análisis genéticos 3.- Resultados en MCF-7 4.- Discusión 1.- Introducción Como se ha descrito anteriormente,

Más detalles

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA

ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA FACULTAD DE VETERINARIA DEPARTAMENTO DE SANIDAD ANIMAL ENFERMEDADES INFECCIOSAS GRADO EN VETERINARIA GUIÓN DE PRÁCTICAS DE LABORATORIO CURSO 2014 2015 MÓDULO: PORCINO Síndrome respiratorio y reproductor

Más detalles

INTRODUCCIÓN AL CULTIVO CELULAR

INTRODUCCIÓN AL CULTIVO CELULAR INTRODUCCIÓN AL CULTIVO CELULAR Cultivo celular: Es un modelo de estudio in vitro constituido por células que pueden crecer y mantenerse en suspensión o en monocapa por más de 24 horas en condiciones controladas.

Más detalles

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES

PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN DE LAS COMPETENCIAS PROFESIONALES CUESTIONARIO DE AUTOEVALUACIÓN PARA LAS TRABAJADORAS Y TRABAJADORES MINISTERIO DE EDUCACIÓN SECRETARÍA DE ESTADO DE EDUCACIÓN Y FORMACIÓN PROFESIONAL DIRECCIÓN GENERAL DE FORMACIÓN PROFESIONAL INSTITUTO NACIONAL DE LAS CUALIFICACIONES PROCEDIMIENTO DE EVALUACIÓN Y ACREDITACIÓN

Más detalles

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015

CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo:

AUTOR: JORGE CONTRERAS PINEDA 1. Titulo: Página 1 de 1 1. Titulo: Electroforesis de DNA 2. Objetivo Conocer los principios básicos de la electroforesis horizontal en geles de agarosa y aplicarlo para la separación de DNA humano, plasmídico, recombinante

Más detalles

MEMORIA DE PRÁCTICAS

MEMORIA DE PRÁCTICAS MEMORIA DE PRÁCTICAS Empresa: Centro Nacional de Tecnología y Seguridad Alimentaria (CNTA)- Laboratorio del Ebro. San Adrián (Navarra). Alumna: Laura Sánchez Vicente Período de prácticas: 01-07-08 hasta

Más detalles

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082

DETECCIÓN DE C. jejuni EN HAMBURGUESA DE POLLO POR PCR TRADICIONAL PRT-712.04-082 Página 1 de 5 1. OBJETIVO Detectar la presencia de Campylobacter jejuni en hamburguesa de pollo mediante técnica de PCR. 2. CAMPO DE APLICACIÓN Y ALCANCE Aplicar este procedimiento a muestras de hamburguesa

Más detalles

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS

APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS Prácticas docentes en la COD: 10-71 APLICACIÓN DE LA PCR: DIAGNÓSTICO DE PARÁSITOS FUNDAMENTO TEÓRICO La PCR es una técnica que permite llevar a cabo la síntesis in vitro de fragmentos de ADN. Está basada

Más detalles

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE

GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES PARA LA UTILIZACION DE PLASMA RICO EN PLAQUETAS (PRP) EN LA COMUNIDAD AUTONOMA DE LA REGION DE MURCIA 1 GARANTIAS MINIMAS DE CALIDAD Y SEGURIDAD EXIGIBLES

Más detalles

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa

velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz porosa INTRODUCCIÓN En general, la electroforesis es una técnica que separa las moléculas en base a sus diferentes velocidades de movimiento mediante la aplicación de un campo eléctrico a través de una matriz

Más detalles

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri

Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri Identificación varietal en vid por técnicas de Biología Molecular. Lic. Luciana Garcia Lic. Carolina Chiconofri OBJETIVO Desarrollar un banco de datos a partir de plantas de origen indudable y del uso

Más detalles

Kits BAGene SSP C IVD

Kits BAGene SSP C IVD Línea de Pruductos BAGene ES Instrucciones de Uso Kits BAGene SSP C IVD Kits de Pruebas para la determinación de los grupos sanguíneos ABO blood, tipos RH, sistemas Kell, Kidd y Duffy, sistema MNS, especificidades

Más detalles

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a

Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a Introducción Western Blotting (o inmunotransferencia) es un procedimiento estándar de laboratorio que permite a los investigadores verificar la expresión de una proteína, determinar la cantidad relativa

Más detalles

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems

MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems MANUAL DE PROCEDIMIENTOS DE LOS TERMOCICLADORES DE PCR EN TIEMPO REAL: STEP-ONE-PLUS Y QUANTSTUDIO 12K FLEX de Applied Biosystems INDICE I. Introducción II. Objetivo General del Manual III. Políticas de

Más detalles

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas)

DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) DIAGNÓSTICO GENÉTICO DE LA HIPERCOLESTEROLEMIA FAMILIAR POR RFLP Ref.PCRCOLEST(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) MICROBIOLOGÍA DE LOS ALIMENTOS 2015 INGENIERÍA EN ALIMENTOS LICENCIATURA EN BIOQUÍMICA TRABAJO PRÁCTICO N 1 REACCIÓN EN CADENA DE LA POLIMERASA (PCR) OBJETIVOS - Definir PCR, conocer los reactivos que

Más detalles

Bioquímica III- 2009

Bioquímica III- 2009 Facultad de Ciencias Exactas, Universidad Nacional de La Plata Bioquímica III- 2009 Trabajo Práctico Nro 4 Extracción de RNA y DNA bacteriano INTRODUCCIÓN El RNA es el ácido nucleico más abundante en la

Más detalles

Ministerio del Ambiente 1

Ministerio del Ambiente 1 Módulo Didáctico: Recursos Genéticos y Bioseguridad BASES TÉCNICAS PARA LA SEGURIDAD DE BIOTECOLOGÍA Cajamarca, 19 21 junio de 2012 Blgo. David Castro Garro Especialista en Biotecnología Ministerio del

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS

PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico

17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico 17.- Electroforesis de ácidos nucleicos en geles de agarosa. Aislamiento y caracterización electroforética de DNA plasmídico Carmen Alicia Padilla Peña, Jesús Diez Dapena, Emilia Martínez Galisteo, José

Más detalles

5. MATERIALES Y MÉTODOS

5. MATERIALES Y MÉTODOS 5. MATERIALES Y MÉTODOS 5.1 Equipos Los siguientes termocicladores se emplearon para la amplificación por PCR: - Perkin Elmer, GeneAmp PCR System 2400. - Perkin Elmer, GeneAmp PCR System 9600. - Applied

Más detalles

ELECTROFORESIS AVANZADA

ELECTROFORESIS AVANZADA Ref.ELECAVANZADA (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO ELECTROFORESIS AVANZADA El objetivo de este experimento es introducir a los alumnos en el conocimiento de la teoría electroforética y familiarizarse

Más detalles

Tecnología HaloPlex by Genycell Biotech España

Tecnología HaloPlex by Genycell Biotech España Paneles de genes custom-made Tecnología HaloPlex by Genycell Biotech España SERVICIO NGS CLÍNICA HALO: OVERVIEW 1. DISEÑO DEL PANEL DE GENES Y DEL KIT DE CAPTURA 2. PREPARACIÓN DE LA MUESTRA EN EL LABORATORIO

Más detalles

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN

PCR. Técnica inventada por Kary Mullis :1987. Premio Nobel 1993. Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN PCR PCR Técnica inventada por Kary Mullis :1987 Premio Nobel 1993 Amplifica una ÚNICA secuencia a partir de una mezcla compleja de ADN Aprovecha los requerimientos de la replicación Templete ADN Nucleótidos

Más detalles

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas

ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas ScanGel NEUTRAL 86429 48 Tarjetas 86430 1080 Tarjetas GEL NEUTRO Grupo sérico, screening de Ac irregulares, pruebas cruzadas IVD Todos los productos fabricados y comercializados por la sociedad Bio-Rad

Más detalles

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES

PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES PROBLEMAS MÁS FRECUENTES Y POSIBLES SOLUCIONES NO SE PRODUCE REACCIÓN O ÉSTA DECAE POCO DESPUÉS DE COMENZAR No hay ADN o hay menos del necesario No hay cebador o la concentración es inferior a la necesaria.

Más detalles

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática.

Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Departamento de Bioquímica Médica y Biología Molecular Práctica 3 Metodología y aplicaciones de la amplificación de material genético: Introducción a la bioinformática. Curso 1 Medicina (Abril) 2012 BIOQUÍMICA

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 -

CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 - CLART ENTHERPEX DETECCIÓN Y TIPADO DE HERPES Y ENTEROVIRUS HUMANOS MEDIANTE IDENTIFICACIÓN GENÓMICA PARA DIAGNÓSTICO IN VITRO - 1 - CLART ENTHERPEX Extracción 24 determinaciones Ref: AT-0908-24 48 determinaciones

Más detalles

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO

AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO AISLAMIENTO DE ÁCIDO DESOXIRRIBONUCLEICO (DNA) GENÓMICO Y PLASMÍDICO E l estudio del genoma de los seres vivos a sido uno d los principales objetivos de la Biología. Desde los trabajos de Mendel (1866),

Más detalles

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv

RESULTADOS Y DISCUSIÓN. Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv RESULTADOS Y DISCUSIÓN Estimación de la Concentración Proteica del Filtrado de Cultivo de Mycobacterium tuberculosis H37Rv La curva estándar con la que se estimó la concentración proteica del filtrado

Más detalles

Guía de PCR en tiempo real

Guía de PCR en tiempo real Guía de PCR en tiempo real Michelle C. Chirinos-Arias michelle.christine16@gmail.com Índice Introducción. 2 Algunos conceptos. 2 PCR (reacción en cadena de la polimerasa)... 2 PCR en tiempo real (qpcr)..

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL. Guía de interpretación de resultados

SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL. Guía de interpretación de resultados SISTEMAS DE DETECCIÓN DE PATÓGENOS POR PCR A TIEMPO REAL Guía de interpretación de resultados Sistemas de detección de patógenos por PCR a tiempo real Microbial ofrece sistemas para la detección de patógenos

Más detalles

ENFERMEDAD RESIDUAL MINIMA EN HEMATOPATOLOGÍA

ENFERMEDAD RESIDUAL MINIMA EN HEMATOPATOLOGÍA XXV Congreso de la SEAP-SEC-SEPAF, Zaragoza, Mayo 2011 ENFERMEDAD RESIDUAL MINIMA EN HEMATOPATOLOGÍA Santiago Montes Moreno MD Departamento de Patología, HUMV Grupo de Linfomas y Unidad de Diagnóstico

Más detalles

Información para Envío de Muestras

Información para Envío de Muestras Información para Envío de Muestras CARIOTIPO EN LÍQUIDO AMNIÓTICO Es el estudio de los cromosomas del feto en células de líquido amniótico. El estudio implica el cultivo de amniocitos, bandeo cromosómico

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas

DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas DNA RECONBINANTE Depende de enzimas capaces de: Cortar Unir Replicar Transcribir inversamente el RNA Otra herramienta es el uso de Sondas específicas ELEMENTOS BÁSICOS DE LA INVESTIGACIÓN EN GENES Análisis

Más detalles

NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA

NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA NORMAS PARA LA ACREDITACIÓN DEL LABORATORIO DE ANDROLOGIA Este laboratorio será acreditado en conjunto con el Laboratorio de Embriología cuando aquel funciones dentro del Centro. Cuando el laboratorio

Más detalles

Reacción en cadena de la polymerasa (PCR)

Reacción en cadena de la polymerasa (PCR) Reacción en cadena de la polymerasa (PCR) 1 PCR Que es? Es una técnica in vitro diseñada para amplificar una región específica de DNA. Es extremadamente sensible, con la capacidad de amplificar millones

Más detalles

CATÁLOGO DE PROMOCIONES 2015 FEBRERO MAYO

CATÁLOGO DE PROMOCIONES 2015 FEBRERO MAYO CATÁLOGO DE PROMOCIONES 2015 FEBRERO MAYO Condiciones y términos de venta Precios Unitarios en USD No incluyen IVA El período de promoción es aplicable del 16 de febrero al 15 de mayo del 2015 Las promociones

Más detalles

Reacción en cadena de la polimerasa (PCR)

Reacción en cadena de la polimerasa (PCR) Dr. Alejandro Leal Reacción en cadena de la polimerasa (PCR) La reacción en cadena de la polimerasa (PCR, por sus siglas en inglés de "polymerase chain reaction") es un método de amplificación in vitro

Más detalles

Tecnologías basadas en la PCR

Tecnologías basadas en la PCR Tecnologías de marcadores moleculares para estudios de diversidad genética de plantas: Módulo de aprendizaje Tecnologías basadas en el ADN Tecnologías basadas en la PCR Fundamentos de la PCR Derechos de

Más detalles