Historia. Hibridación in situ Fluorescente

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Historia. Hibridación in situ Fluorescente"


1 Fluorescent in situ Hybridization

2 Historia Hibridación in situ Desarrollada por Pardue & Gall (1969) -Muy pocas secuencias de DNA disponibles -Radioisótopos Alto entrenamiento Seguridad Tiempo Hibridación in situ Fluorescente Pinkel & Gray (1984) Detección de secuencia blanco por fluorescencia Método rápido Discriminativo Inofensivo Relativamente fácil

3 Fundamentos Desnaturalización 37ºC 95ºC

4 Desnaturalización de la sonda Metodología Desnaturalización del DNA Cromosómico Hibridación Sonda-DNA Cromosómico

5 Hibridación in situ Fluorescente FISH (Clásico) Multicolor Karyotyping Spectral Karyotyping Multicolor banding FISH Fiber FISH Q-FISH Flow-FISH Chromosome combing Padlock FISH CGH Array-CGH etc.!!

6 Sondas

7 Sondas Definición Fragmentos de DNA homólogos a la secuencia blanco, marcados con una molécula detectable directamente o mediante una reacción inmunoquímica Estos fragmentos deben cubrir una región de por lo menos 70 kb para poder ser detectados al microscopio.

8 Sondas: Sondas región específicas: Sondas gen-específicas: Sondas de pintado cromosómico total:

9 Hibridación in situ Fluorescente en diagnóstico oncológico

10 Genética Clínica Citogenética Clásica Genética Molecular Citogenética Molecular

11 Análisisde Metafases Translocaciones Cromosomas Marcadores Inversiones (pericéntricas) Anomalías numéricas Microdeleciones

12 Análisisde Metafases

13 Citogenética de interfase Diversidad de sondas específicas (proyecto genoma) Simplificación de protocolos Disminución del tiempo de análisis Mejora notable en los métodos de marcado de sondas Mejora en los sistemas de tomas de imágenes y software Información valiosa en núcleos interfásicos FISH en interfases HERRAMIENTA CLÍNICA

14 Citogenética de interfase Algunos usos específicos Estudio de mosaicismos Células tumorales Muestras pequeñas Células inactivas

15 FISH en interfases Se obtiene información de una gran variedad de muestras Permite obtener información específica en muestras pequeñas Independiente de la presencia de células metabólicamente activas Es necesario establecer criterios propios Sujeto a variaciones técnicas importantes Debido a: Calidad de la sonda Calidad de la fijación Background Reactivos de detección Interpretación de las señales Especificidad de la sonda Temperatura de desnaturalización Variabilidad entre reacciones

16 Diseño o de sondas 22qter (C+) HIRA (Tuple1) PPM1F TOP3B Cent.

17 Diseño o de sondas Para aplicación en Oncología

18 Diseño o de sondas Para aplicación en Oncología Sondas Locus específicas Sondas Break Apart Sondas Doble fusión Sondas Tumores sólidos

19 Sondas Oncológicas Locus Específicas 17p13.1 (TP53) FXR2 17p13.1 SHBG SAT2 150Kb TP53 (20Kb) WDR79 EFNB3 DYH2 Izq, Normal. Der, P53-17q25.3 Isocromosoma 17q

20 Sondas Oncológicas Locus Específicas 1p36 (TP73) 1p Kb TP73 Control 1q44

21 Sondas Oncológicas Locus Específicas 5q15-q31 (SHGC85191/EGR1) Control 5q11.2 SHGC85191 EGR1

22 Sondas Oncológicas Tumores sólidos CANCER DE MAMA: Her 2/neu (erb2) Es un oncogen que se encuentra en la célula normal en dos copias únicamente Enumeración 17 (17p11.2) (C+) Her 2/neu Distintos mecanismos pueden llevar a la amplificación de este gen, desencadenando la enfermedad.

23 Sondas Oncológicas Tumores sólidos Procesado: Microtomo Tacos de parafina Cortes de 4-6 µ Señal al microscopio

24 Sondas Oncológicas Tumores sólidos Celula normal: dos copias de Her 2/neu dos señales verdes representan dos cromosomas 17 dos señales rojas representan dos copias del oncogen Celulas con amplificaciones Las señales verdes representan los cromosomas 17, las señales rojas representan del oncogen amplificado

25 Células normales Sondas Oncológicas Tumores sólidos Células anormales

26 Diseño o de sondas Translocación BCR-ABL

27 Diseño o de sondas Cromosoma Philadelphia en Leucemia Mieloide Crónica 95 % de los pacientes tiene esta fusión Su presencia activa una tirosina kinasa requerida para su función transformante La evolución es seguida a través del porcentaje de células con cr. Phi en sangre El método más apropiado para esto es FISH

28 Diseño o de sondas Translocación BCR-ABL Porqué FISH? Los métodos moleculares (PCR) dan la respuesta: SI ó NO FISH: respuesta cuantitativa (%) Los métodos moleculares (PCR) pueden contaminarse con falsos positivos FISH: no es pasible de contaminación intermuestras

29 Translocación BCR-ABL (Sonda Fusión Simple) 140Kb 52Kb Crom. 22 BCR Crom. 9 ABL 350Kb 421Kb BCR-ABL - Falsos positivos 5-13% BCR-ABL +

30 Sondas de Doble Fusión Translocación BCR-ABL (Sonda Doble Fusión) 140Kb 52Kb Crom. 22 BCR Crom. 9 ABL 1300Kb 876Kb BCR-ABL - Falsos positivos 0.5% BCR-ABL +

31 Diseño o de sondas MLL (myeloid/lymphoid or mixed leukemia)

32 Sondas Break Apart MLL (myeloid/lymphoid or mixed leukemia) (Sonda Break apart) Crom. 11 MLL MLL normal MLL translocado

33 Conclusiones Finales Simple de aplicar Resultados obtenidos en corto tiempo Fácil de interpretar Funciona en casi cualquier célula o tejido Herramienta en investigación Herramienta diagnóstica


CROMOSOMA 21. Pintado Cromosómico Total 21

CROMOSOMA 21. Pintado Cromosómico Total 21 CROMOSOMA 21 Pintado Cromosómico Total 21 21q21.3 Early onset Alzheimer region probe EN 21 Break Apart 21q22 [AML1(RUNX1)] Doble Fusión t(12;21)(p13;q22)[etv6/aml1(runx1)] Doble Fusión t(8;21)(q21;q22)

Más detalles

Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas.

Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas. Técnicas utilizadas en el estudio de las cromosomopatías y del cáncer. Aplicaciones clínicas. El análisis cromosómico ha proporcionado un conocimiento básico de los cambios genéticos responsables de las

Más detalles


BIOTECNOLOGÍA EN EL DIAGNÓSTICO CITOGENÉTICO nota de tapa EN ARGENTINA: De izq. a der. María Muhlmann - Mariela Nieves - David Marañon - Alejandro Laudicina Laboratorio de Citogenética Molecular - Centro Atómico Constituyentes - Comisión Nacional

Más detalles

Selección de pacientes

Selección de pacientes 2 Selección de pacientes MENSAJES CLAVE Aproximadamente entre el 20% y el 30% de las pacientes con cáncer de mama presentan tumores HER2 positivos. Hasta un 24% de los tumores con receptores de estrógenos

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

Las alteraciones cromosómicas como mecanismo de activación oncogenética

Las alteraciones cromosómicas como mecanismo de activación oncogenética Las alteraciones cromosómicas como mecanismo de activación oncogenética Javier Benítez Dpto. Genética, Fundación Jiménez Díaz, Madrid. En los últimos años se han empezado a conocer las bases moleculares

Más detalles

CÁNCER DE MAMA. Modelo de aplicación de la genética y biología molecular. Dr. Abelardo Arias Velásquez

CÁNCER DE MAMA. Modelo de aplicación de la genética y biología molecular. Dr. Abelardo Arias Velásquez V SIMPOSIO ANDINO DE LABORATORIO Y MEDICINA CÁNCER DE MAMA Modelo de aplicación de la genética y biología molecular Dr. Abelardo Arias Velásquez Jefe de la Unidad de Genética y Biología Molecular Instituto

Más detalles

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile

Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Actualización en nuevas técnicas de diagnóstico genético molecular disponibles en Chile Dra. Teresa Aravena Clínica INDISA Hospital Clínico de la Universidad de Chile Hospital Dr. Sótero del Río Exámenes

Más detalles

Bases moleculares y estudios genéticos

Bases moleculares y estudios genéticos II Jornada Genética Clínica para Médicos de Familia Bases moleculares y estudios genéticos María García-Barcina Unidad de Genética del H. Universitario de Basurto Osakidetza Sede SVMFIC Valencia, 2 de

Más detalles

Citogenética Básica. Tinción de las preparaciones cromosómicas para detectar los posibles cambios numéricos y estructurales.

Citogenética Básica. Tinción de las preparaciones cromosómicas para detectar los posibles cambios numéricos y estructurales. Citogenética Básica Qué son los Cromosomas? La citogenética es el estudio de los cromosomas y las enfermedades relacionadas, causadas por un número y/o estructura anormales de los cromosomas. Los cromosomas

Más detalles

HER2 en Cancer Gastrico

HER2 en Cancer Gastrico HER2 en Cancer Gastrico Dr. Alejandro Corvalan Laboratorio de Patologia Molecular y Epidemiologia Centro de Investigaciones Medicas Departamento de Hematoloiga &Oncologia P.Universidad Catolica de Chile

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles



Más detalles

Citogenetica. Cariotipo. Aspectos Tecnicos de Citogenetica Convencional y Molecular en Leucemias Agudas. Citogenetica. Anormalidades Cromosomicas

Citogenetica. Cariotipo. Aspectos Tecnicos de Citogenetica Convencional y Molecular en Leucemias Agudas. Citogenetica. Anormalidades Cromosomicas Lectura Especial- Aspectos Tecnicos de Citogenetica Convencional y Molecular en Leucemias Agudas Part 1 of 3 Lectura Especial- Citogenetica Susana C.,, PhD 1 Susana C.,, PhD Directora, Laboratorio de Cytogeneticas

Más detalles

Técnicas de hibridación Concepto, modalidades y tipos de sondas Aplicaciones principales. Federico Rojo Fundación Jiménez Díaz

Técnicas de hibridación Concepto, modalidades y tipos de sondas Aplicaciones principales. Federico Rojo Fundación Jiménez Díaz Técnicas de hibridación Concepto, modalidades y tipos de sondas Aplicaciones principales Federico Rojo Fundación Jiménez Díaz Guión de la presentación Alteraciones estructurales del DNA y cáncer Hibridación

Más detalles

Técnica de CGH-array. María Rodríguez-Rivera

Técnica de CGH-array. María Rodríguez-Rivera Técnica de CGH-array María Rodríguez-Rivera Laboratori de Citogenètica Molecular. Servei de Patologia. Hospital del Mar. Programa de Càncer-IMIM. Barcelona Índice Introducción a los microarrays Arrays

Más detalles



Más detalles



Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles


ENFERMEDAD RESIDUAL MINIMA EN HEMATOPATOLOGÍA XXV Congreso de la SEAP-SEC-SEPAF, Zaragoza, Mayo 2011 ENFERMEDAD RESIDUAL MINIMA EN HEMATOPATOLOGÍA Santiago Montes Moreno MD Departamento de Patología, HUMV Grupo de Linfomas y Unidad de Diagnóstico

Más detalles

Onco-Hematología: Contribución de la PCR en Tiempo Real. PCR en tiempo real

Onco-Hematología: Contribución de la PCR en Tiempo Real. PCR en tiempo real Onco-Hematología: Contribución de la PCR en Tiempo Real Dra. Marina I. Gutiérrez Laboratorio Dr. Stamboulian. División Biología Molecular. Buenos Aires PCR en tiempo real La PCR (reacción en cadena de

Más detalles

Los retos de las nuevas tecnologías. Eduardo Tizzano Hospital Sant Pau Barcelona y CIBERER U-705

Los retos de las nuevas tecnologías. Eduardo Tizzano Hospital Sant Pau Barcelona y CIBERER U-705 Avances en genética y discapacidad: Los retos de las nuevas tecnologías Eduardo Tizzano Hospital Sant Pau Barcela y CIBERER U-705 Investigación en enfermedades genéticas Investigación básica: en general

Más detalles

Blga. María Leticia Amésquita Cárdenas. GENETICA MEDICA Departamento Morfología Humana. Facultad de Medicina Universidad Nacional de Trujillo

Blga. María Leticia Amésquita Cárdenas. GENETICA MEDICA Departamento Morfología Humana. Facultad de Medicina Universidad Nacional de Trujillo Blga. María Leticia Amésquita Cárdenas GENETICA MEDICA Departamento Morfología Humana. Facultad de Medicina Universidad Nacional de Trujillo Cáncer Enfermedad neoplásica con transformación de las células

Más detalles

PCR, Southern Blot Biopsia coriónica (post semana 15) Líquido amniótico (post semana 15) Deleciones Subteloméricas Sangre periférica con EDTA

PCR, Southern Blot Biopsia coriónica (post semana 15) Líquido amniótico (post semana 15) Deleciones Subteloméricas Sangre periférica con EDTA GENETICA MOLECULAR Patología y técnica Tipo/s de muestra Síndrome de X-Fragil PCR, Southern Blot (post semana 15) (post semana 15) Deleciones Subteloméricas MLPA Fibrosis Quística (29 mutaciones) PCR-ARMS

Más detalles

Instructivo para la derivación de material

Instructivo para la derivación de material LABORATORIO ESPECIALIZADO DE HEMATOLOGÍA, ONCOLOGÍA Y GENÉTICA Instructivo para la derivación de material 1. Estudios de Anemia: Extendidos de sangre periférica con gota directa de la aguja (sin anticoagulante)

Más detalles

Página 1 de 7. Versión: Preliminar Versión 1.0. Título de la Guía:

Página 1 de 7. Versión: Preliminar Versión 1.0. Título de la Guía: Versión: Preliminar Versión 1.0 1. Título de la Guía: Guía De Atención Integral (GAI) Para La Detección, Tratamiento Y Seguimiento De Leucemias Linfoide Y Mieloide Y Linfoma No Hodgkin En Población Mayor

Más detalles

Seminario Taller de Citogenética y Discusión de Resultados 2012-2013 del Programa EEDDCARIO INAS Septiembre 19 de 2013

Seminario Taller de Citogenética y Discusión de Resultados 2012-2013 del Programa EEDDCARIO INAS Septiembre 19 de 2013 PROGRAMA DE EVALUACIÓN EXTERNA DEL DESEMPEÑO PARA LABORATORIOS DE CITOGENÉTICA CLÍNICA - EEDDCARIO Seminario Taller de Citogenética y Discusión de Resultados 2012-2013 del Programa EEDDCARIO INAS Septiembre

Más detalles



Más detalles

Perfiles de expresión génica y diagnóstico/pronóstico en cáncer. Introducción 6/1/2010. Meritxell Pelicano Esqueta. Genómica y proteómica

Perfiles de expresión génica y diagnóstico/pronóstico en cáncer. Introducción 6/1/2010. Meritxell Pelicano Esqueta. Genómica y proteómica Perfiles de expresión génica y diagnóstico/pronóstico en cáncer Meritxell Pelicano Esqueta Genómica y proteómica Curso 2009/2010 Introducción Expresión génica: Proceso por el cual los organismos transforman

Más detalles


MEDICIÓN DE LA LONGITUD TELOMÉRICA MEDICIÓN DE LA LONGITUD TELOMÉRICA 1. SOBRE LOS TELÓMEROS EN GENERAL Qué son los cromosomas? Los cromosomas son estructuras altamente condensadas de ácido desoxirribonucleico (ADN), que contienen la información

Más detalles

Del microscopio al chip: Cariotipo Molecular

Del microscopio al chip: Cariotipo Molecular Del microscopio al chip: Cariotipo Molecular TM. KREN ESPINOZ SVEDR Centro de Genética y Genómica Facultad de Medicina Clínica lemana Universidad del Desarrollo Esquema de la presentación 1. De citogenética

Más detalles



Más detalles

Información para Envío de Muestras

Información para Envío de Muestras Información para Envío de Muestras CARIOTIPO EN LÍQUIDO AMNIÓTICO Es el estudio de los cromosomas del feto en células de líquido amniótico. El estudio implica el cultivo de amniocitos, bandeo cromosómico

Más detalles


FRAGMENTO OLIGO 5-3 Hebra SECUENCIA 5' - - > 3' TAMAÑO (pb) F1. hmtl 569 L AACCAAACCCCAAAGACACC hmth2982 H CTGATCCAACATCGAGGTCG ANEXO 1 Protocolo para la PCR para la amplificación del mtdna en 10 fragmentos solapantes: Se prepara la siguiente mezcla: Tampón ( TRIS 100 mm, MgCl 2 12 mm, KCl 500 mm, ph 8,3): 10X dntps : 10 mm (cada

Más detalles


ENFERMEDADES MALIGNAS DE LA SANGRE Enfermedades malignas de la sangre Page 1 sur 6 Atlas of Genetics and Cytogenetics in Oncology and Haematology ENFERMEDADES MALIGNAS DE LA SANGRE * Introducción Síndromes mieloproliferativos Leucemia mieloide

Más detalles



Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Significancia de los micronúcleos en lesiones cervicales intraepiteliales y carcinoma

Significancia de los micronúcleos en lesiones cervicales intraepiteliales y carcinoma Significancia de los micronúcleos en lesiones cervicales intraepiteliales y carcinoma María E. Gonsebatt Universidad Nacional Autónoma de México margen@unam.mx > 90 % de los cánceres se originan en tejidos

Más detalles

Paralelismo entre cromosomas y la teoria de Mendel

Paralelismo entre cromosomas y la teoria de Mendel Paralelismo entre cromosomas y la teoria de Mendel Cromosomas sexuales Autosomas Herencia ligada al sexo Cromosomas heteromorfos Nettie Stevens, 1909 Estudios en Drosophila, mosca del vinagre Thomas Hunt

Más detalles



Más detalles

Precisión en la identificación de los tumores Her2


Más detalles

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados

Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Mapeo genómico: Determinación de la localización de elementos en un genoma, con respecto de marcadores identificados Tipos de mapas: MAPAS FISICOS (de restricción, citogenéticos, de híbridos de radiación...)

Más detalles

2 REG-R01.001.5040-023

2 REG-R01.001.5040-023 6(3) 2011 LA CITOGENETICA COMO HERRAMIENTA DIAGNÓSTICA EN CÁNCER En neoplasias hematológicas, el análisiss citogenético se ha incorporado rutinariamentee como una herramienta que complementa el diagnóstico

Más detalles



Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

Enfermedades genéticas

Enfermedades genéticas Enfermedades genéticas Desórdenes genéticos Mutaciones Rearreglos genómicos Variación en número de cromosomas Monogenéticas, heredables en forma mendeliana. Enfermedades genéticas Poligenéticas o complejas,

Más detalles


NOTICIAS CIENTÍFICAS: ANÁLISIS NOTICIAS CIENTÍFICAS: ANÁLISIS José M. Ortiz Melón Editor científico e- mail: edicion@ranf.com Lecciones de Genómica del Cáncer En la ultima década los esfuerzos realizados en la secuenciación de muchos

Más detalles

BioSeq 739 Servicio de ayuda al diagnóstico oncológico

BioSeq 739 Servicio de ayuda al diagnóstico oncológico BioSeq 739 Servicio de ayuda al diagnóstico oncológico Análisis Genómico Tumoral por Secuenciación Masiva PPBSA CP13 060312 Información sobre el servicio de BioSeq 739 La mayoría de tipos de cáncer se

Más detalles


DETERMINACIÓN DEL HER 2 DETERMINACIÓN DEL HER 2 Valor predictivo Trastuzumab Resistencia tratamientos convencionales < respuesta a terapia adyuvante con tamoxifeno > respuesta a antraciclinas y taxanos Clasificaciones moleculares

Más detalles

Técnicas de Biología Molecular

Técnicas de Biología Molecular Técnicas de Biología Molecular DNA I. Enzimas de restricción Análisis Las enzimas de restricción fueron aisladas de bacterias; su función natural es proteger contra DNA extraño II. Separación electroforética

Más detalles

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07

PCR A TIEMPO REAL. María Maiques R4-Bioquímica Clínica 25-Abril-07 PCR A TIEMPO REAL María Maiques R4-Bioquímica Clínica 25-Abril-07 VEAMOS Herramientas para detectar mutaciones Moléculas fluorescentes y tecnología FRET PCR a tiempo real: equipos y métodos de detección

Más detalles

Congreso Nacional del Laboratorio Clínico 2014

Congreso Nacional del Laboratorio Clínico 2014 Técnicas de Citogenética en diagnóstico prenatal: cariotipo, FISH, QF-PCR y arrays CGH. Cristina Torreira Análisis Clínicos Xerencia de Xestión Integrada de Vigo Comisión de Genética de la SEQC Índice

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles


LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER Genética Molecular 10/11 Ana Serrano Puebla LAS TRANSLOCACIONES DE RAF PARTICIPAN EN EL CANCER En este trabajo se dispusieron a investigar sobre el desarrollo y mantenimiento de células cancerígenas en

Más detalles

RECOMENDACIONES. 1. Criterios técnicos

RECOMENDACIONES. 1. Criterios técnicos RECOMENDACIONES sobre el uso Clínico de los arrays-cgh Dentro del contexto de esta guía, que está dirigida a la implantación de los arrays-cgh para su aplicación clínica en el diagnóstico genético, se

Más detalles

Retraso Mental y genética

Retraso Mental y genética Retraso Mental y genética Dra. Teresa Aravena Cerda Especialista en genética clínica INTA, Universidad de Chile Hospital Clínico de la Universidad de Chile Clínica INDISA Prevalencia RDSM o DI: 1 a 3 %

Más detalles

Estrategias de análisis global. Hacia el manejo genético de las neoplasias

Estrategias de análisis global. Hacia el manejo genético de las neoplasias ARTÍCULO DE REVISIÓN Estrategias de análisis global. Hacia el manejo genético de las neoplasias Alfredo Hidalgo,* Mauricio Salcedo* * Laboratorio de Genética Molecular del Cáncer. Unidad de Investigación

Más detalles

Análisis en Genética 1

Análisis en Genética 1 Análisis en Genética 1 Análisis Genético FUNCION BIOLOGICA Gen o genes implicados Localización Cartografiado Función Interacciones TIPOS DE MUTACIÓN MUTACIÓN GÉNICA -El alelo de un gen sufre un cambio,

Más detalles



Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles


TEST PRENATAL NO INVASIVO (NIPT) TEST PRENATAL NO INVASIVO (NIPT) El Test VERIFI (Test Prenatal no Invasivo) permite la detección de anomalías cromosómicas como síndrome Down y 5 microdeleciones en la sangre materna mediante el análisis

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras

METODOLOGIA DEL PCR. Lic. Jorge Mato Luis. Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras METODOLOGIA DEL PCR Lic. Jorge Mato Luis Laboratorio de Genética Molecular Hospital Clínico Quirúrgico Hermanos Ameijeiras Desnaturalización del DNA 5 A G G T T A G T G G A C C C T T G A T 3 3 T C C A

Más detalles

Dr. Horacio Decanini Arcaute Anatomopatólogo

Dr. Horacio Decanini Arcaute Anatomopatólogo Dr. Horacio Decanini Arcaute Anatomopatólogo Consenso general Introducción: La sobre- expresión del gen Her / 2 neu se encuentra Asociada con comportamiento agresivo y es considerada Como factor predictivo

Más detalles



Más detalles

Información para Envío de Muestras

Información para Envío de Muestras Información para Envío de Muestras 1 TRIPLE MARCADOR El Triple marcador sérico (TMS), es una prueba de tamizaje o screening y su objetivo principal es detectar embarazos con mayor riesgo del esperado.

Más detalles

Cáncer: malos números BASES MOLECULARES DEL CANCER. C. pulmón: malos resultados. Cáncer de pulmón: problemas. Carcinogénesis Origen de las mutaciones

Cáncer: malos números BASES MOLECULARES DEL CANCER. C. pulmón: malos resultados. Cáncer de pulmón: problemas. Carcinogénesis Origen de las mutaciones BASES MOLECULARES DEL CANCER Miguel Carrera Lamarca Hospital U. Son Dureta Fundación Caubet-CIMERA Palma de Mallorca Cáncer: malos números Cáncer Segunda causa de muerte; la primera entre los 45 y 60 años

Más detalles


DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) DIAGNÓSTICO GENÉTICO DE PREIMPLANTACIÓN (PGD) Las alteraciones genéticas son una importante causa de esterilidad e infertilidad y pueden ser responsables de algunos defectos congénitos. Estas alteraciones

Más detalles

Investigación y cooperación frente a los grandes retos sociales

Investigación y cooperación frente a los grandes retos sociales Investigación y cooperación frente a los grandes retos sociales Si un día lográramos dotar de mayor capacidad y eficacia a los servicios técnicos de nuestras células, el cáncer acabaría reduciéndose a

Más detalles

Leica HER2 FISH System - 30 Test Instrucciones de uso

Leica HER2 FISH System - 30 Test Instrucciones de uso Leica HER2 FISH System - 30 Test Instrucciones de uso Para el uso en el sistema Leica Biosystems BOND-MAX and BOND-III TA9217 es un producto de hibridación in situ de fluorescencia diseñado para la tinción

Más detalles

23/07/2011. 80 x 80 mm. Fecha: Tamaño: Difusión: Página: Sección: LA VANGUARDIA

23/07/2011. 80 x 80 mm. Fecha: Tamaño: Difusión: Página: Sección: LA VANGUARDIA 23/07/2011 Tamaño: 80 x 80 mm. Página: 25 Difusión: 191673 LA VANGUARDIA Sección: 26/07/2011 Tamaño: 240 x 240 mm. Página: 12 Difusión: 47056 DIARIO MEDICO Sección: abc.es ctualidadnoticias.com adn.es

Más detalles

Análisis de la. como parte del diagnóstico general del cáncer de mama. Karla Elizabeth Flores Martínez* Rafael González Alvarez** Entretextos.

Análisis de la. como parte del diagnóstico general del cáncer de mama. Karla Elizabeth Flores Martínez* Rafael González Alvarez** Entretextos. ISSN: 2007-5316 40 Entretextos Análisis de la metilación del ADN como parte del diagnóstico general del cáncer de mama Karla Elizabeth Flores Martínez* Rafael González Alvarez** Frutos Rojos (fragmento)

Más detalles

Leucemia. Dr. Rafael Hurtado Monroy

Leucemia. Dr. Rafael Hurtado Monroy 1 Leucemia Dr. Rafael Hurtado Monroy Es un término que define a un grupo de enfermedades malignas de la sangre y el diagnóstico temprano es muy importante para que el paciente acuda con el especialista

Más detalles

DGP: Para tus hijos, evita riesgos

DGP: Para tus hijos, evita riesgos DGP: Para tus hijos, evita riesgos Ahora, con el Diagnóstico Genético Preimplantacional (DGP) podrás evitar los riesgos genéticos en tu descendencia. Salud de la mujer Dexeus Salud de la mujer Dexeus DEPARTAMENTO

Más detalles

Enzimas de restricción

Enzimas de restricción BIOTECNOLOGIA Enzimas de restricción Endonucleasas que reconocen dianas específicas en el ADN Protegen a cada cepa de bacterias de otro ADN que no pertenece al sistema El ADN propio está protegido porque

Más detalles

Avances genéticos en diagnóstico prenatal. Dr. David Poyatos Andújar. Especialista de producto Área Molecular

Avances genéticos en diagnóstico prenatal. Dr. David Poyatos Andújar. Especialista de producto Área Molecular Avances genéticos en diagnóstico prenatal Dr. David Poyatos Andújar. Especialista de producto Área Molecular 9 11 14 1er trimestre 2º trimestre 3er trimestre 2 Test Prenatal No Invasivo Detección T13,

Más detalles


CIENCIA Y VIDA COTIDIANA CIENCIA Y VIDA COTIDIANA Genética para andar por casa... y 3 Murcia, 17 de diciembre de 2012. Genética. Gen. ADN. Información genética. Cromosomas. Genética forense. Ingeniería genética. Clonación/Transgénicos.

Más detalles

Genética 1 er Curso. Cualquiera de los tipos de mutaciones que hemos estudiado, cuando se producen, pueden desencadenar básicamente dos cosas:

Genética 1 er Curso. Cualquiera de los tipos de mutaciones que hemos estudiado, cuando se producen, pueden desencadenar básicamente dos cosas: Grado Medicina Genética 1 er Curso TEMA 8 EFECTOS FENOTÍPICOS DE LAS MUTACIONES 8.1 Pérdida de función, fenotipos recesivos y haploinsuficiencia. 8.2 Fenotipos dominantes por ganancia de función. 8.3 Alteraciones

Más detalles

Curs de genètica aplicada a Medicina Fetal

Curs de genètica aplicada a Medicina Fetal Curs de genètica aplicada a Medicina Fetal MA Sánchez Durán Diciembre 2015 Introducción Detección de defectos congénitos Desarrollo Genética 2 7 7 Infecciones Monogénicos 55 25 Cromosómicos Poligénico

Más detalles


CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 CLASE DE RESOLUCIÓN DE PROBLEMAS DE PCR LIC. BIOTECNOLOGÍA 2015 DEFINICIÓN PCR: Constituye la técnica más importante para amplificar ácidos nucleicos in vitro. Ambas hebras del DNA de interés son replicadas

Más detalles



Más detalles

Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña

Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña Muestras citológicas para el estudio de mutaciones de EGFR y KRAS en cáncer de pulmón de célula no pequeña Caroline Becker; Enric Carcereny Costa; Felipe Andreo García; Eva Castellá; Mariona Lletjós Sanuy;

Más detalles


DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) DIAGNÓSTICO GENÉTICO DEL CÁNCER HEREDITARIO Ref.PCRCAN(4 prácticas) 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción

Más detalles

Las enfermedades genéticas y el diagnóstico genético Preguntas y respuestas

Las enfermedades genéticas y el diagnóstico genético Preguntas y respuestas Las enfermedades genéticas y el diagnóstico genético Preguntas y respuestas PRESENTACIÓN En este documento presentamos doce preguntas básicas relacionadas con las enfermedades genéticas y el diagnóstico

Más detalles

Marta Hergueta Redondo Dic. -2005

Marta Hergueta Redondo Dic. -2005 Perfil de expresión genética en el carcinoma no microcítico de pulmón: utilidad de las biopsias endoscópicas, correlación con la histología y predicción pronóstica en pacientes operables. FIS 04/2641 Marta

Más detalles

Cáncer Mama, biomarcadores de expresión génica

Cáncer Mama, biomarcadores de expresión génica 1 Cáncer Mama, biomarcadores de expresión génica Dr. Aleix Prat Jefe del Grupo de Genómica Traslacional del Instituto de Oncología Vall d'hebron. Oncólogo Médico del Hospital Universitario Vall d'hebron.

Más detalles

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m )

PCR. Qué es la PCR? T a de fusión de oligonucleótidos (t m ) % a de fusión de oligonucleótidos (t m ) Qué es la PCR? La reacción en cadena de la polimerasa (PCR: polymerase chain reaction) es una técnica de amplificación de secuencias de DNA in vitro t m = 2 (A

Más detalles


TEST de PATERNIDAD. Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO Ref.PCR paternidad (4 prácticas) 1.OBJETIVO DEL EXPERIMENTO TEST de PATERNIDAD Este experimento introduce a los alumnos en el uso del ADN y la PCR para simular una determinación de paternidad. Los estudiantes

Más detalles


LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL LA BIOTECNOLOGÍA HACE TU VIDA MEJOR Y MÁS FÁCIL BIOTECNOLOGÍA APLICADA A LA SALUD La Biotecnología está presente en la Medicina y en la Salud animal, ya que participa en el diagnóstico y en el tratamiento

Más detalles

Qué sucede en un laboratorio de genética?

Qué sucede en un laboratorio de genética? 12 Algunas personas han expresado su preocupación sobre la posibilidad de que la policía acceda a su ADN. Esto es un hecho extremadamente raro. Si se diera este caso, esto sería posible (como con cualquier

Más detalles



Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles


CARACTERISTICAS DE LAS CELULAS NORMALES EN CULTIVO CARACTERISTICAS DE LAS CELULAS NORMALES EN CULTIVO 1. La duración del ciclo celular en una célula determinada es aleatoria 2. Para poder dividirse las células requieren de la actuación de diversos factores

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

Presentando la prueba BRCA. Acceso a los resultados que usted quiere para el tratamiento que necesitan sus pacientes.

Presentando la prueba BRCA. Acceso a los resultados que usted quiere para el tratamiento que necesitan sus pacientes. Presentando la prueba BRCA Acceso a los resultados que usted quiere para el tratamiento que necesitan sus pacientes. Quest Diagnostics se compromete con usted a través de la atención continua, fortaleciéndole

Más detalles

Proyecto Genoma eucem a nfáti r nica

Proyecto Genoma eucem a nfáti r nica Proyecto Genoma Leucemia Linfática Crónica Consorcio Internacional del Genoma del Cáncer Objetivos Identificar las alteraciones genéticas causantes de los 50 cánceres mas frecuentes Mínimo de 500 pacientes

Más detalles

personalizado del cáncer de pulmón y la importancia de las determinaciones moleculares para oncovida

personalizado del cáncer de pulmón y la importancia de las determinaciones moleculares para oncovida Tratamiento personalizado del cáncer de pulmón y la importancia de las determinaciones moleculares para optimizar el tratamiento 22 oncovida C o l e c c i ó n 1 Qué es el cáncer de pulmón y cuales son

Más detalles


5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles



Más detalles