El desarrollo de técnicas moleculares de laboratorio nos ha permitido la detección y

Tamaño: px
Comenzar la demostración a partir de la página:

Download "El desarrollo de técnicas moleculares de laboratorio nos ha permitido la detección y"


1 Ensayos de cuantificación de carga viral VIH-1. El desarrollo de técnicas moleculares de laboratorio nos ha permitido la detección y cuantificación de las moléculas de ARN de VIH-1 en sangre periférica y en otras muestras biológicas. La cantidad de ARN de VIH-1 presente en plasma, a la que denominamos carga viral, es un factor pronóstico de evolución a sida y muerte independiente de la cifra de linfocitos CD4 [1-3]. En un estudio promovido por los Centers for Disease Control (CDC), la cifra de CD4 era el principal factor de predicción del riesgo de desarrollar una infección oportunista, pero el riesgo relativo era de 1,6-3,5, en función de la carga viral, respecto a los pacientes que tenían menos de 400 copias/ml [3]. Entre los pacientes incluidos en la cohorte MACS, en estadios iniciales, la carga viral y las cifras de CD38 fueron factores de predicción más potentes de evolución a sida que los CD4; con posterioridad, los CD4 aumentaron su importancia como factor pronóstico [4]. La determinación de la carga viral de VIH-1 en plasma ha demostrado su utilidad como: factor de predicción del riesgo de progresión a SIDA o muerte; guía para el inicio del tratamiento antirretroviral, junto con el recuento de CD4 y la clínica; indicador principal de la eficacia del tratamiento antirretroviral; parámetro para la evaluación de la eficacia de nuevos fármacos antirretrovirales; medio útil para comparar la potencia relativa de diferentes tratamientos; sospecha de aparición de resistencias y posible indicación de cambio en la terapia; indicador intermedio de interacciones farmacológicas significativas; control de cumplimiento del tratamiento; evaluación del riesgo de transmisión, sobre todo materno-fetal;

2 detección del virus en neonatos y en primoinfección, aunque debe confirmarse posteriormente; mejor conocimiento de la cinética viral en diversos compartimientos del organismo; identificación de reservorios. Métodos de cuantificación de la carga viral Las pruebas comerciales están diseñadas para la cuantificación del ARN vírico en muestras de pasma. La mayoría están basadas en la detección del ADN complementario al ARN vírico (ADNc), que ha sido obtenido por un proceso de transcripción inversa de dicho ARN. El ADNc es inmediatamente amplificado mediante la reacción en cadena de la polimerasa (PCR; Polymerase Chain Reaction ). El ácido nucleico amplificado se denomina amplicón. Las primeras pruebas comerciales como el test COBAS Amplicor HIV-1 Monitor (Roche Diagnostics) cuantificaban el ARN a partir del amplicón acumulado tras la reacción de PCR. Actualmente, este tipo de pruebas han sido sustituidas por otras como: COBAS TaqMan HIV-1 Test (Roche Molecular Systems), RealTime HIV type 1 (HIV-1) assay (Abbott Diagnostics), VERSANT HIV-1 RNA 1.0 kpcr Assay (Siemens Healthcare Diagnostics) y NucliSens Easy Q HIV-1 (BioMerieux Inc.), en las que la amplificación y cuantificación de los ácidos nucleicos (ADN o ARN) se realiza mediante la técnica de PCR a tiempo real, utilizando sistemas cada vez más automatizados que permiten la cuantificación más exacta y en menos tiempo sin necesidad de métodos laboriosos. La técnica de PCR a tiempo real cuantitativa permite amplificar y cuantificar simultáneamente el ADN o el ARN amplificado, ya que utiliza cadenas de oligonucleótidos marcados fluorescentemente que detectan y se unen al amplicón en cuanto aparece. Los oligonucleotidos que utilizan las pruebas comerciales VIH-1 suelen ser de dos tipos: las sondas tipo Taqman y los llamados molecular bacon. Las sondas tipo Taqman son oligonucleotidos que contienen dos moléculas fluorocromos

3 unidas a cada uno de sus extremos. La molécula de un extremo emite fluorescencia y la otra del otro extremo (el quencher ) absorbe la emisión de la anterior. Cuando la sonda se une al amplicón, la actividad exonucleasa de la polimerasa que interviene en la amplificación del ADNc elimina el quencher de la sonda y, en consecuencia, el fluorocromo emite una señal fluorescente que es detectada por un instrumento analizador. Los molecular bacon se caracterizan por ser oligonucleótidos de cadena simple con extremos complementarios capaces de unirse formando una horquilla. En los extremos de la horquilla se encuentran el fluorocromo y el quencher. Cuando la horquilla está cerrada el quencher absorbe fluorescencia emitida por el fluorocromo. En presencia del amplicón, la horquilla se abre para unirse al ADN o ARN amplificado y queda desbloqueada la emisión de fluorescencia, la cual es detectada por el instrumento analizador. El sistema empieza a detectar la señal de fluorescencia asociada al incremento exponencial del amplicón. Existe una relación cuantitativa entre la cantidad inicial de ácido nucleico y la cantidad de amplicón producido en un ciclo determinado. La utilización de estándares externos de concentración conocida permiten la preparación de curvas patrón en las que extrapolar el valor de la señal obtenido en cada muestra para poder calcular su concentración de carga viral (copias/ml o en unidades internacionales (IU, International units )). La mayoría de pruebas comerciales contienen, además, estándares internos que se colocan junto a cada muestra en el mismo tubo desde el inicio de la prueba y con las que se puede controlar las variaciones del análisis de tubo a tubo Otras pruebas comerciales de cuantificación de la carga viral han fundamentado la cuantificación del ARN vírico en la amplificación y detección de la señal emitida, en lugar de amplificar el ácido nucleico; como es el caso de Versant HIV-1 RNA 3.0 Assay (b-dna), aunque este tipo de técnicas terminará siendo sustituido por las pruebas basadas en la PCR a tiempo real. Actualmente, los laboratorios pueden disponer de las siguientes pruebas comerciales:

4 COBAS TaqMan HIV-1 Test (Roche Molecular Systems) RealTime HIV type 1 (HIV-1) assay (Abbott Diagnostics) VERSANT HIV-1 RNA 1.0 kpcr Assay (Siemens Healthcare Diagnostics) NucliSens Easy Q HIV-1 (BioMerieux Inc.) Versant HIV-1 RNA 3.0 Assay (b-dna, Siemens Healthcare Diagnostics). COBAS TaqMan HIV-1 Test (Roche Molecular Systems) La prueba COBAS TaqMan HIV-1 permite detección cuantitativa de ARN del VIH-1 en plasma de pacientes infectados, en un rango de copias/ml, mediante la detección de la amplificación de ADNc por PCR a tiempo real [5]. Este test ha sido validado para la cuantificación de los virus del grupo M (subtipos A-H) y los virus recombinados (CRF, Circulating Recombinant Form) de los tipos CRF01_AE. Esta prueba sustituye al anterior COBAS Amplicor assay. COBAS TaqMan HIV-1 está basada en tres procesos principales: (1) la preparación de las muestras para obtener el ARN del VIH-1, que puede realizarse de forma automatizada con el sistema COBAS AmpliPrep; (2) la transcripción reversa automática de una región del ARN del VIH-1 para generar ADNc; (3) la amplificación del ADNc, con iniciadores complementarios específicos ( primers ) que definen una secuencia altamente conservada del gen gag del VIH-1, y la detección del amplicón con sondas de tipo Taqman se realiza simultáneamente. Además, dispone de un estándar interno de cuantificación llamado QS que se coloca en la muestra en que se desea cuantificar la carga viral. El QS es ARN no infeccioso, con regiones de unión a iniciadores idénticas a las del ARN del VIH-1 y una región exclusiva de unión a sonda que permite distinguir el producto amplificado del QS del producto amplificado procedente del VIH-1. El analizador COBAS Taqman calcula la concentración del VIH-1 en las muestras de la prueba, comparando la señal procedente de la amplificación del VIH-1 con la señal del QS para cada muestra y control. El QS compensa los efectos de inhibición que

5 pudieran producirse y controla los procesos de preparación y amplificación para permitir la determinación cuantitativa exacta de ARN del VIH-1 en cada muestra. Actualmente se está evaluando un nueva versión de esta prueba desarrollada por Roche, se trata de la prueba COBAS TaqMan HIV-1 v 2.0. Esta versión se caracteriza por utilizar iniciadores que flanquean regiones del gen gag y del extremo altamente repetitivo (long terminal repeat, LTR). Esto le permite aumentar el rango de amplificación de copias/ml. Este ensayo demostrado una mejora en la sensibilidad respecto a la versión anterior, una aceptable precisión [6] RealTime HIV type 1 (HIV-1) assay (Abbott Diagnostics) RealTime HIV type 1 (HIV-1) assay es una prueba también automatizada que permite la cuantificación del ARN del VIH-1 en muestras de plasma de pacientes infectados, en un rango de 40 a copias/ml. Detecta y cuantifica la carga viral de un amplio grupo de virus, grupo M (subtipos A H), el grupo O y el grupo N [7]. La extracción de los ácidos nucleicos puede realizarse de forma automatizada con el instrumento m2000sp. Los iniciadores y las sondas van dirigidos a reconocer la integrasa, una región muy conservada del gen pol. La sonda que utiliza consiste en un fragmento de ADN de doble cadena con diferentes tamaños. El fragmento largo de la cadena es complementario a una región del ADNc objeto de amplificación y lleva unida una molécula fluorescente. El fragmento corto contiene la molécula de extición, el quencher. Cuando el ADNc está presente se produce la hibridación del ADNc con el fragmento largo de la sonda y se genera una señal que es detectada por el analizador m2000rt. VERSANT HIV-1 RNA 1.0 kpcr Assay (Siemens Healthcare Diagnostics) Se trata de un ensayo para la cuantificación del ARN de VIH-1 en muestras de plasma de pacientes infectados por VIH-1, en un rango de copias/ml y que ha sido validado para la cuantificación de los virus del grupo M (subtipos A-G), los virus

6 recombinados de los tipos AE y AG, y los virus del grupo O [8]. La extracción de los ácidos nucleicos ARN y ADN de las muestras de plasma se realiza mediante un sistema basado en bolas magnéticas en un proceso automatizado que permite analizar 96 muestras en 2 horas y 45 minutos (Hamilton STARlet instrument). Antes de iniciar la transcripción inversa del ARN vírico a ADNc se procede a la degradación del posible ADN contaminante presente en la muestra utilizando el enzima uracil N glycosylase. La transcripción inversa del ARN y la amplificación de una región muy conservada de la integrasa en gen pol del ADNc se realizan simultáneamente a partir del ARN del virus y de un estándar interno de cuantificación mediante el proceso de PCR a tiempo real, de forma automatizada (Agilent MX3005 Instrument). Las posibles mutaciones en el gen de la integrasa que pudieran contener los virus no afectarían a la detección y cuantificación de la carga viral [9,10]. NucliSens Easy Q HIV-1 (BioMerieux Inc., Boxtel, Netherlands) Esta prueba permite la cuantificación directa del ARN del VIH-1 a partir de muestras de plasma y de gotas de sangre seca recogidas en papel de filtro, en un rango de copias/ml, de todos los virus del grupo M (A, B, C, D, F, G, H, J) y los recombinantes CRF01_AE and CRF02_AG [11]. La extracción de los ácidos nucleicos (ARN y ADN) se efectúa mediante un sistema de bolas sílica que puede hacerse automatizadamente con el instrumento NucliSENS easymag. Esta prueba, a diferencia de las pruebas comerciales anteriormente descritas, amplifica y cuantifica a tiempo real el ARN amplificado a partir del ARN vírico y sustituye a la prueba comercial de primera generación Nuclisens HIV-1 QT. La amplificación del ARN la efectúa gracias a un sistema de amplificación isotérmica diseñado por NASBA [12]. Esta prueba utiliza horquillas marcadas o molecular bacons, en lugar de sondas, para detectar el amplicón. En uno de los extremos de la horquilla contiene el fluorocromo carboxyfluoresceine (FAM) y se une específicamente al ARN del VIH-1; el del otro extremo contiene la molécula carboxy-x-rhodamine (ROX) y se une al estándar de cuantificación o calibrador. La fluorescencia producida se monitoriza mediante un

7 sistema automatizado (NucliSens EasyQ Analyzer). La técnica de realiza en un tubo cerrado, lo cual disminuye el riesgo de contaminación de la prueba. El tiempo necesario es inferior a dos horas. Varios estudios han evidenciado una buena correlación con la cuantificación mediante otros métodos de detección [13,14].. Versant HIV-1 RNA 3.0 bdna base-assay (Siemens Healthcare Diagnostics Inc., Tarrytown, NY) Esta prueba permite la cuantificación del ARN viral en muestras de plasma de pacientes infectados, en un rango de 75 a copias/ml de virus del grupo M (A- G). Cuantifica directamente el ARN vírico sin la necesidad de realizar una amplificación del ADNc, ya que se basa el la amplificación de la señal de detección [15]. Para ello, después de efectuar la extracción de los ácidos nucleicos de las muestras de plasma de los pacientes infectados por el VIH-1, el material se traslada a placas que contienen un conjunto sondas de captura especiales para unirse ARN vírico. Este conjunto de sondas de captura (> 80) están formadas por oligonucleótidos sintéticos específicos que reconocen una amplia región del gen pol del VIH-1. Para conseguir una óptima hibridación entre las sondas de captura y el ARN vírico se requiere un periodo de incubación largo (overnight). Un segundo tipo de sondas, las sondas diana, se hibridan al ARN viral y a las sondas del amplificador. Un tercer tipo de sondas, las sondas del amplificador, se hibridan con el preamplificador, formando complejos de ADN ramificado. Finalmente, se añaden un cuarto tipo de sondas marcadas con fosfatasa alcalina y se incuban en un sustrato quimioluminiscente. La cantidad de señal detectada por el analizador es proporcional a la cantidad de virus en la muestra. La concentración de virus se establece a partir de una curva patrón definida por la emisión de luz de la muestra, comparándola con la emisión que producen las muestras estándares de concentraciones conocidas de virus. La inclusión de más de 80 sondas de ácidos nucleicos que reconocen a varias zonas del gen pol permite la cuantificación de subtipos no B dentro del grupo M.

8 En la Tabla 1 se resumen las características más importantes de los ensayos de cuantificación de la carga viral que están comercializados en la actualidad. Tabla 1. Características de los ensayos comerciales. COBAS TaqMan HIV-1 Test (Roche) RealTime HIV type 1 (HIV-1) assay (Abbott ) VERSANT HIV-1 RNA 1.0 kpcr Assay (Siemens ) NucliSens Easy Q HIV-1 (BioMerieux ) Versant HIV-1 RNA 3.0 Assay (b-dna). (Siemens ) Abreviación CAP/CTM HIV-1 RealTime HIV kpcr NucliSens EQ b-dna Plasma Plasma Plasma, sangre Tipo de muestra Plasma (citrato y Plasma (citrato y (citrato y seca en filtro y (anticoagulante) EDTA) (citrato y EDTA) EDTA) EDTA) tejidos Volumen de muestra , (ml) Método de extracción (Instrumento) Método amplificación (Instrumento) Regíon del genoma del VIH-1 amplificada Sondas Rango de linearidad (copias/ml) Subtipos detectados Número de muestras procesables simultáneamente Duración completa del proceso (horas) Automática (COBAS AmpliPrep) RNA RT-PCR Tiemporeal (COBASTaqman) Automática (m2000sp) RNA RT-PCR Tempo-real (m2000rt) Automática (Hamilton STARlet) ARN y ADN kpcr (Agilent X3005) Automática (Easy Mac) ARN y ADN PCR isotérmica NASBA Tempo-real (NucliSSENS) No extracción y purificación de ácidos nucleicos Amplificación de la señal bdna (Versant 340 y Versant 440 molecular systems) gag Pol-integrasa Pol gag pol Sonda Taqman Grupo M (A-H), CRF01_AE Sondas de doble cadena truncadas Grupo M (A-D, F-H), CRF01_AE y CRF02_AG, ; Grupo O y Grupo N Sonda Taqman Grupo M (A-D, F-H, K), CRF01_AE y CRF02_AG, CRF06_cpx; Grupo O Horquillas molecular bacon Grupo M (A-D, F-H, J) bdna Grupo M (A-D, F-G) Los estudios comparativos realizados entre las diferentes pruebas comercializadas de cuantificación muestran un alto grado de acuerdo. Las mayores discrepancias se suelen observar en los niveles bajos de carga viral y en la detección de virus del subtipo No-B [9,10,13,14,16]. Debido a la variabilidad biológica en un mismo sujeto a lo largo de la enfermedad y a la relacionada con la propia técnica, las variaciones de la carga viral superiores a 0,5 log 10 se consideran clínicamente significativas.

9 La diversidad genética del VIH-1 representa un desafío para el desarrollo de pruebas capaces de detectar y cuantificar de manera fidedigna a todas las variantes del virus. En Europa y Norteamérica, la mayoría de los pacientes están infectados por el subtipo B. En otras partes del mundo, las infecciones por subtipos no B del grupo M son más frecuentes e incluso mayoritarias. En España, entre los años 2000 y 2009, se ha observado un incremento de la prevalencia de los subtipos no-b y de virus recombinados (CRF) del grupo M [17,18]. Las infecciones por los grupos O y N son excepcionales. Las pruebas comerciales de cuantificación de la carga viral están diseñadas para la detección de VIH-1 del subtipo B, pero también pueden detectar otros subtipos e incluso formas recombinantes del grupo M aunque con menor eficacia. Algunos estudios comparativos han analizado el grado de acuerdo de las distintas pruebas comerciales para detectar y cuantificar la carga viral en muestras de pacientes infectados con subtipos no-b del VIH-1. Las mayores discrepancias se observaron en las muestras portadoras del subtipo G o de la forma recombinante CFR02-AG. En los casos en que eran detectados observaron discrepancias de > 1 log 10 y de > 0,5 Log 10, cuando las pruebas eran comparadas dos a dos [16,19]. Como alternativa a las pruebas comerciales anteriormente descritas se ha evaluado dos nuevas pruebas comerciales de bajo coste: el test ExavirLoad v2 (Cavidi) y el test Generic HIV viral load (Biocentric). ExavirLoad v2 mide la actividad del enzima de transcripción inversa del VIH-1 en la conversión del ARN a ADNc a partir de muestras de plasma y la compara con una curva patrón. Generic HIV viral load (Biocentric) está basada en la técnica de PCR a tiempo real que amplifica una región conservada de los extremos altamente repetitivo (LTR) del VIH-1. Ambas pruebas presentaron una buena correlación con COBAS Amplicor assay, aunque con ExavirLoad v2 se obtuvieron más resultados falsos positivos y algunas limitaciones en la detección de subtipos que con Generic HIV viral load [20]

10 Cuantificación de la carga viral en muestras biológicas diferentes al plasma La cuantificación de la carga viral suele realizarse en muestras de plasma, pero la sangre no es el único compartimento anatómico donde se puede detectar el VIH-1. El virus replica en el interior de las células y puede llegar a otros compartimentos a través de la sangre formando reservorios de células infectadas con el virus en estado de latencia o con replicación persistente, que en muchas ocasiones evolucionan de manera distinta a los virus circulantes en sangre [21,22]. Las técnicas de biología molecular han permitido la detección del VIH-1 en muestras procedentes de diferentes lugares anatómicos como el semen, lavado vaginal, frotis, tejido linfoide y líquido cefaloraquídeo; [23]. La cuantificación de la carga viral en este tipo de muestras no es muy frecuente y requiere la utilización de métodos caseros y la modificación de las pruebas comercializadas. La carga viral en estos compartimentos de puede ser un marcador subrogado de la infecciosidad en la transmisión sexual y en la transmisión materno-fetal, y de la eficacia del tratamiento antirretroviral. Detección en fluidos genitales Algunos estudios han demostrado que los niveles de la carga viral en el plasma están correlacionados con los niveles de carga viral en el semen [24]. El semen es uno de los principales vehículos de transmisión del VIH-1 y es frecuente determinación de la carga viral en semen durante la reproducción asistida parejas serodiscordantes. Su análisis requiere la preparación previa de la muestra, ya que el virus puede detectarse en el plasma seminal y en las células no-espermatozoides, y la adaptación de la prueba comercial. La mayor parte de estudios se han realizadoadaptando las pruenas de primera generación COBAS Amplicor assay y NASBA HIV-QT [25]. Este tipo de muestras contienen sustancias inhibidoras que dificultan la detección del VIH-1 cuando se encuentran en concentraciones muy bajas y puede dar lugar a falsos negativos. Se ha observado que la extracción de los ácidos nucleicos mediante los métodos basados en la sílica incrementa la sensibilidad de las pruebas comerciales [26].

11 En el aparato genital femenino se han observado diferencias significativas en la carga viral en diferentes fases del ciclo menstrual. Se produce una disminución significativa en la fase periovulatoria y un incremento por encima de las concentraciones plasmáticas en los períodos premenstrual y menstrual, sin que se acompañe de cambios en la viremia plasmática [27,28]. También se observa una correlación entre la cuantificación viral en las secreciones vaginales y de cuello uterino. Se ha descrito una cuantificación aceptable mediante b-adn de muestras obtenidas a partir de tampones, con cifras de carga viral similares a las registradas en el lavado cervicovaginal [29,30]. Detección y valoración en tejido linfoide La cuantificación de la carga viral en ganglios linfáticos en pacientes que reciben tratamiento antirretroviral de tipo TARGA ha permitido observar una disminución significativa de la carga viral tanto en plasma como en células mononucleares de ganglio linfático; sin embargo, en este último caso es más lenta y se produce una menor disminución tras unas pocas semanas de tratamiento [31]. La replicación viral puede persistir incluso a niveles elevados en el tejido linfático, a pesar de mantener una carga viral indetectable en plasma [32,33]. En todo caso, una terapia subóptima no consigue disminuir la carga viral a cifras indetectables en el tejido linfático [34]. El tejido linfoide asociado a intestino (GALT, gut-associated lymphoid tissue ) está muy implicado en la patogénesis del VIH-1. A diferencia del tejido linfoide de otros compartimentos anatómicos, el GALT se encuentra de una de entrada del virus en las etapas iniciales de la infección y en él reside gran número de linfocitos T-CD4 memoria fuente de replicación del VIH-1, y lo convierte en un gran reservorio de virus. La infección masiva del GALT conduce a la disfunción de la mucosa favoreciendo la translocación bacteriana, a cual a su vez contribuye a la activación generalizada de la respuesta inmune sistémica y a la progresión de la enfermedad. Algunos estudios han demostrado que la supresión de la carga viral en GALT suele ser más lenta que en sangre periférica y que no llega a ser completa, lo cual contribuye a la falta de

12 recuperación de la población de células T-CD4 en este tejido. El inicio del tratamiento antirretroviral en las fases tempranas de la infección puede tener un efecto más rápido y duradero en la supresión de la replicación viral en GALT que el inicio del tratamiento durante la infección crónica y contribuir en la restauración de la población de células T- CD4 [35]. La determinación de la carga viral en este tipo de muestras es complicada porque requiere la realización de una biopsia y porque requiere la modificación de las pruebas comerciales o caseras. Recientemente se ha publicado que la detección de ARN/ADN de VIH-1 y de ARN mensajero de células TCD4 en muestras de heces de pacientes VIH-1 en la fase crónica de la infección es posible, sugiriendo que este tipo de muestras podría ser útil para el estudio de la pérdida de células T-CD4 del GALT asociada a la patogéneis del VIH-1 [36]. Detección y valoración líquido cefalorraquideo La infección del sistema nervioso central por VIH-1 se produce desde las etapas iniciales de la infección del paciente. La carga viral en el líquido cefalorraquideo (LCR) esta correlacionada la disfunciones neurocognivas y a la demencia por SIDA [37,38]. Cuantificación de la carga Pro-viral de VIH-1 Tras la infección, el VIH-1 inicia ciclo vital con la transcripción inversa del ARNv a ADN en el citoplasma formando un complejo de pre-integración (CPI) poco estable. En el núcleo el CPI se integra en el ADN de la célula huésped de forma estable dando lugar al provirus. La cuantificación del ADN proviral puede ser útil como medida del reservorio celular del virus, como marcador de eficacia de la terapia antirretroviral, del diagnostico precoz de la primoinfección en adultos y en hijos nacidos de madres seropositivas, y como marcador predictivo de la progresión de la enfermedad [39-42].

13 El ADN vírico puede encontrarse de diferentes formas en el interior de la célula; como cadena de ADN simple, de cadena doble lineal, de cadena doble circular o de cadena doble integrado en el núcleo. Algunos estudios defienden que las formas circulares son poco estables e indicativas de infección reciente; otros estudios, si embargo, sugieren que estas formas no son tan inestables y que su número se diluye a medida que la célula se divide [43,44]. Se han desarrollado diferentes métodos para la cuantificación del ADN viral (recientemente revisado por Beloukas A y cols [45]). Algunos de estos métodos están basados en PCR a tiempo real caseros que amplifican una región entre los 2LTR, o regiones entre el LTR y el gen celular alu, otros se basan en modificaciones de pruebas comerciales de primera generación como COBAS amplicor [41,46-48]. En cualquier caso suelen referir las copias de ADN viral a la concentración de DNA total (microgramos de DNA) o al número de células (10 6 T-CD4+ o 10 6 PBMCs Periferal Blood Mononuclear Cells ). El rango de copias de ADN proviral en muestras clínicas obtenido en diferentes estudios empleando diferentes métodos suele estar entre 2 log 10 y 3,5 log 10, según el método empleado [45]. Bibliografía 1. Mellors, J.W., Rinaldo, C.R. Jr, Gupta, P. y cols. Prognosis in HIV-1 infection predicted by the quantity of virus in plasma. Science 1996; 272: Vlahov, D., Graham, N., Hoover, D. y cols. Prognostic indicators for AIDS and infectious disease death in HIV-infected injection drug users: Plasma viral load and CD4+ cell count. JAMA 1998; 279: Kaplan, J.E., Hanson, D.L., Jones, J.L., Dworkin, M.S. Viral load as an independent risk factor for opportunistic infections in HIV-infected adults and adolescents. AIDS 2001; 15: Giorgi, J.V., Lyles, R.H., Matud, J.L. y cols. Predictive value of immunologic and virologic markers after long or short duration of HIV infection. J Acquir Immune Defic Syndr 2002; 29:

14 5. Información del producto COBAS TaqMan HIV-1 Test (Roche Molecular Systems) 6. Scott L, Carmona S, Stevens W. Performance of the new Roche Cobas AmpliPrep- Cobas TaqMan version 2.0 human immunodeficiency virus type 1 assay. J Clin Microbiol. 2009;47(10): Información del producto RealTime HIV type 1 (HIV-1) assay (Abbott Diagnostics). 8. Información del producto VERSANT HIV-1 RNA 1.0 kpcr Assay (Siemens Healthcare Diagnostics). https://www.medical.siemens.com 9. Troppan KT, Stelzl E, Violan D, Winkler M, Kessler HH. Evaluation of the new VERSANT HIV-1 RNA 1.0 Assay (kpcr) for quantitative detection of human immunodeficiency virus type 1 RNA. J Clin Virol ;46(1): Ruelle J, Jnaoui K, Lefèvre I, Lamarti N, Goubau P. Comparative evaluation of the VERSANT HIV-1 RNA 1.0 kinetic PCR molecular system (kpcr) for the quantification of HIV-1 plasma viral load. J Clin Virol ;44(4): Información del producto NucliSens Easy Q HIV-1 (BioMerieux Inc., Boxtel, Netherlands) Diagnostics) Weusten JJ, Carpay WM, Oosterlaken TA, van Zuijlen MC, van de Wiel PA. Principles of quantitation of viral loads using nucleic acid sequence-based amplification in combination with homogeneous detection using molecular beacons. Nucleic Acids Res. 2002;30(6):e De Mendoza C, Koppelman M, Montès B, Ferre V, Soriano V, Cuypers H, Segondy M, Oosterlaken T. Multicenter evaluation of the NucliSens EasyQ HIV-1 v1.1 assay for the quantitative detection of HIV-1 RNA in plasma. J Virol Methods. 2005;127(1): Yao J, Liu Z, Ko LS, Pan G, Jiang Y. Quantitative detection of HIV-1 RNA using NucliSens EasyQ HIV-1 assay. J Virol Methods. 2005;129(1):40-6.

15 15. Información del producto Versant HIV-1 RNA 3.0 bdna base-assay (Siemens Healthcare Diagnostics). https://www.medical.siemens.com 16. Scott LE, Noble LD, Moloi J, Erasmus L, Venter WD, Stevens W. Evaluation of the Abbott m2000 RealTime human immunodeficiency virus type 1 (HIV-1) assay for HIV load monitoring in South Africa compared to the Roche Cobas AmpliPrep-Cobas Amplicor, Roche Cobas AmpliPrep-Cobas TaqMan HIV-1, and BioMerieux NucliSENS EasyQ HIV-1 assays. J Clin Microbiol Jul;47(7): Holguín A, de Mulder M, Yebra G, López M, Soriano V. Increase of non-b subtypes and recombinants among newly diagnosed HIV-1 native Spaniards and immigrants in Spain. Curr HIV Res. 2008;6(4): Cuevas M, Fernandez-Garcia A, Sanchez-Garcia A, Gonzalez-Galeano M, Pinilla M, Sanchez-Martinez M, Garcia V, Perez-Alvarez L; Study group of HIV-1 newly diagnosed patients in Galicia, Spain. Incidence of non-b subtypes of HIV-1 in Galicia, Spain: high frequency and diversity of HIV-1 among men who have sex with men. Euro Surveill. 2009; 26;14(47). 19. Holguín A, López M, Molinero M, Soriano V. Performance of three commercial viral load assays, Versant human immunodeficiency virus type 1 (HIV-1) RNA bdna v3.0, Cobas mpliprep/cobas TaqMan HIV-1, and NucliSens HIV-1 EasyQ v1.2, testing HIV-1 non-b subtypes and recombinant variants. J Clin Microbiol. 2008;46(9): Steegen K, Luchters S, De Cabooter N, Reynaerts J, Mandaliya K, Plum J, Jaoko W, Verhofstede C, Temmerman M. Evaluation of two commercially available alternatives for HIV-1 viral load testing in resource-limited settings. J Virol Methods Dec;146(1-2): Coombs RW, Speck CE, Hughes JP, Lee W, Sampoleo R, Ross SO, Dragavon J, Peterson G, Hooton TM, Collier AC, Corey L, Koutsky L, Krieger JN. Association between culturable human immunodeficiency virus type 1 (HIV-1) in semen and HIV-1 RNA levels in

16 semen and blood: evidence for compartmentalization of HIV-1 between semen and blood. J Infect Dis. 1998;177(2): Eron JJ, Vernazza PL, Johnston DM, Seillier-Moiseiwitsch F, Alcorn TM, Fiscus SA, Cohen MS. Resistance of HIV-1 to antiretroviral agents in blood and seminalplasma: implications for transmission. AIDS ;12(15):F Blankson JN, Persaud D, Siliciano RF. The challenge of viral reservoirs in HIV-1 infection. Annu Rev Med. 2002;53: Gupta P, Mellors J, Kingsley L, Riddler S, Singh MK, Schreiber S, Cronin M, Rinaldo CR. High viral load in semen of human immunodeficiency virus type 1-infected men at all stages of disease and its reduction by therapy with protease and nonnucleoside reverse transcriptase inhibitors. J Virol. 1997;71(8): Fiscus SA, Brambilla D, Coombs RW, Yen-Lieberman B, Bremer J, Kovacs A, Rasheed S, Vahey M, Schutzbank T, Reichelderfer PS; AIDS Clinical Trials Group Genital Secretions Working Group. Multicenter evaluation of methods to quantitate human immunodeficiency virus type 1 RNA in seminal plasma. J Clin Microbiol Jun;38(6): Mermin JH, Holodniy M, Katzenstein DA, Merigan TC. Detection of human immunodeficiency virus DNA and RNA in semen by the polymerase chain reaction. J Infect Dis ;164(4): Money, D.M., Arikan, Y.Y., Remple, V. y cols. Genital tract and plasma human immunodeficiency virus viral load throughout the menstrual cycle in women who are infected with ovulatory human immunodeficiency virus. Am J Obstet Gynecol 2003; 188: Reichelderfer, P.S., Coombs, R.W., Wright, D.J. y cols. Effect of menstrual cycle on HIV-1 levels in the peripheral blood and genital tract. WHS 001 Study Team. AIDS 2000; 14:

17 29. Webber, M.P., Schoenbaum, E.E., Farzadegan, H., Klein, R.S. Tampons as a selfadministered collection method for the detection and quantification of genital HIV-1. AIDS 2001; 15: Delany S, Rosas R, Mlaba N, Clayton T, Akpomiemie G, LeGoff J, Capovilla A, Bélec L, Stevens W, Mayaud P. Comparison of cervicovaginal lavage, cervicovaginal lavage enriched with cervical swab, and vaginal tampon for the detection of HIV-1 RNA and HSV-2 DNA in genital secretions. J Acquir Immune Defic Syndr ;49(4): Tamalet, C., Lafeuillade, A., Fantini, J., Poggi, C., Yahi, N. Quantification of HIV-1 viral load in lymphoid and blood cells: Assessment during four drug combination therapy. AIDS 1997; 11: Lafeuillade, A., Chollet, L., Hittinger, G. y cols. Residual human immunodeficiency virus type 1 RNA in lymphoid tissue of patients with sustained plasma RNA of <200 copies/ml. J Infect Dis 1998; 177: Kuster, H., Opravil, M., Ott, P. y cols. Treatment-induced decline of human immunodeficiency virus-1 p24 and HIV-1 RNA in lymphoid tissue of patients with early human immunodeficiency virus-1 infection. Am J Pathol 2000; 156: García F, Alonso, M.M., Romeu, J. y cols. Comparison of immunologic restoration and virologic response in plasma, tonsillar tissue, and cerebrospinal fluid in HIV-1 infected patients treated with double versus triple antiretroviral therapy in very early stages: The Spanish EARTH-2 Study. Early Anti-Retroviral Therapy Study. J Acquir Immune Defic Syndr 2000; Guadalupe M, Sankaran S, George MD, Reay E, Verhoeven D, Shacklett BL, Flamm J, Wegelin J, Prindiville T, Dandekar S. Viral suppression and immune restoration in the gastrointestinal mucosa of human immunodeficiency virus type 1-infected patients initiating therapy during primary or chronic infection. J Virol ;80(16):

18 36. Chakrabarti AK, Caruso L, Ding M, Shen C, Buchanan W, Gupta P, Rinaldo CR, Chen Y. Detection of HIV-1 RNA/DNA and CD4 mrna in feces and urine from chronic HIV-1 infected subjects with and without anti-retroviral therapy. AIDS Res Ther ;6: McArthur, J.C., McClernon, D.R., Cronin, M.F. y cols. Relationship between human immunodeficiency virus-associated dementia and viral load in cerebrospinal fluid and brain. Ann Neurol 1997; 42: Di Stefano, M., Monno, L., Fiore, J.R. y cols. Neurological disorders during HIV-1 infection correlate with viral load in cerebrospinal fluid but not with virus phenotype. AIDS 1998; 12: Finzi D, Blankson J, Siliciano JD, Margolick JB, Chadwick K, Pierson T, Smith K, Lisziewicz J, Lori F, Flexner C, Quinn TC, Chaisson RE, Rosenberg E, Walker B, Gange S, Gallant J, Siliciano RF. Latent infection of CD4+ T cells provides a mechanism for lifelong persistence of HIV-1, even in patients on effective combination therapy. Nat Med. 1999;5(5): Goujard C, Bonarek M, Meyer L, Bonnet F, Chaix ML, Deveau C, Sinet M, Galimand J, Delfraissy JF, Venet A, Rouzioux C, Morlat P; Agence Nationale de Recherche sur le Sida PRIMO Study Group. CD4 cell count and HIV DNA level are independent predictors of disease progression after primary HIV type 1 infection in untreated patients. Clin Infect Dis ;42(5): Avettand-Fènoël V, Chaix ML, Blanche S, Burgard M, Floch C, Toure K, Allemon MC, Warszawski J, Rouzioux C; French Pediatric Cohort Study ANRS-CO 01 Group. LTR realtime PCR for HIV-1 DNA quantitation in blood cells for early diagnosis in infants born to seropositive mothers treated in HAART area (ANRS CO 01). J Med Virol. 2009;81(2): Kostrikis LG, Touloumi G, Karanicolas R, Pantazis N, Anastassopoulou C, Karafoulidou A, Goedert JJ, Hatzakis A; Multicenter Hemophilia Cohort Study Group. Quantitation of human immunodeficiency virus type 1 DNA forms with the second template switch in

19 peripheral blood cells predicts disease progression independently of plasma RNA load. J Virol. 2002;76(20): Sharkey M, Triques K, Kuritzkes DR, Stevenson M. In vivo evidence for instability of episomal human immunodeficiency virus type 1 cdna. J Virol. 2005;79(8): Butler SL, Johnson EP, Bushman FD. Human immunodeficiency virus cdna metabolism: notable stability of two-long terminal repeat circles. J Virol. 2002;76(8): Beloukas A, Paraskevis D, Psichogiou M, Hatzakis A. The role of HIV-1 DNA as an additional marker of HIV-1 infection. Curr HIV Res. 2009;7(3): Malnati MS, Scarlatti G, Gatto F, Salvatori F, Cassina G, Rutigliano T, Volpi R, Lusso P. A universal real-time PCR assay for the quantification of group-m HIV-1 proviral load. Nat Protoc. 2008;3(7): Beloukas A, Paraskevis D, Haida C, Sypsa V, Hatzakis A. Development and assessment of a multiplex real-time PCR assay for quantification of human immunodeficiency virus type 1 DNA. J Clin Microbiol. 2009;47(7): Rouzioux C, Hubert JB, Burgard M, et al. Early levels of HIV 1 DNA in peripheral blood mononuclear cells are predictive of disease progression independently of HIV 1 RNA levels and CD4+ cell counts. J Infect Dis 2005;192:46 55

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Inmunodeficiencia Humana) Fabián Fay CIBIC. Rosario. Argentina Test de laboratorio para

Más detalles



Más detalles

Estrategia utilizada

Estrategia utilizada Estrategia utilizada 1) Extracción HIV RNA V3 7114 7218 2) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles


ARTÍCULO ORIGINAL REPRODUCIBILITY OF A QUANTIFICATION ASSAY, NUCLISENS HIV - 1 QT, IN HIV POSITIVE PLASMA SAMPLES Rev Chil Infect (2002); 19 (1): 25-31 ARTÍCULO ORIGINAL Estudio de reproducibilidad del examen de cuantificación de VIH-1 por la técnica Nuclisens HIV-1 QT en muestras de plasma de pacientes infectados

Más detalles

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles

Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales

Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales Revista Mexicana de Patología Clínica 1998; Volumen 45(3): 159-161 Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales NOHEMI PATRICIA CASTILLO

Más detalles

Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral

Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral Consuelo Viladés Laborda Servicio de Medicina Interna, Hospital Universitario de Tarragona Joan XXIII, Tarragona Introducción

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa?

CUESTIONES. 1. Por qué la PCR convencional no es cuantitativa? 2º BIOQUÍMICA CUESTIONES 1. Por qué la PCR convencional no es cuantitativa? En la PCR convencional, la cuantificación del ADN de la muestra es complicada debido a que la eficacia de amplificación va disminuyendo

Más detalles


DIAGNOSTICO VIROLOGICO MOLECULAR. Dr. Gerardo Andino DIAGNOSTICO VIROLOGICO MOLECULAR Dr. Gerardo Andino DIAGNÓSTICO MOLECULAR La tecnología empleada para la detección de genomas virales mediante la amplificación de secuencias específicas (PCR y reacciones

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

Diversidad Genética del VIH: Importancia para la Salud Pública Global

Diversidad Genética del VIH: Importancia para la Salud Pública Global Diversidad Genética del VIH: Importancia para la Salud Pública Global Alvaro Carrascal, MD, MPH Director, División de Atención de Salud Instituto del SIDA Departamento de Salud del Estado de Nueva York

Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

Métodos de laboratorio para el diagnóstico pediátrico del VIH

Métodos de laboratorio para el diagnóstico pediátrico del VIH Métodos de laboratorio para el diagnóstico pediátrico del VIH Presidenta de la Nación Dra. Cristina Fernández de Kirchner Ministro de Salud Dr. Juan Luis Manzur Secretario de Promoción y Programas Sanitarios

Más detalles

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz

Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz IDEXX VetLab Suite IDEXX SNAP Tests Laboratorio de Referencia IDEXX Nuevos paneles de PCR Real Time: El diagnóstico molecular más rápido, fiable y eficaz Obtenga respuestas definitivas con la IDEXX RealPCR

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Evaluación comparativa de COBAS TaqMan HIV-1 y COBAS AMPLICOR HIV-1 para la cuantificación de carga viral plasmática de HIV-1

Evaluación comparativa de COBAS TaqMan HIV-1 y COBAS AMPLICOR HIV-1 para la cuantificación de carga viral plasmática de HIV-1 BREVE INFORME SOBRE INVESTIGACIÓN ORIGINAL Evaluación comparativa de COBAS TaqMan HIV-1 y COBAS AMPLICOR HIV-1 para la cuantificación de carga viral plasmática de HIV-1 Recibido: 01/04/2009 Aceptado: 26/05/2009

Más detalles

Técnicas moleculares.

Técnicas moleculares. Técnicas moleculares. DMTV Carolina Acevedo Curso de Microbiología 2015 SÍNTESIS IN VITRO DE UNA GRAN CANTIDAD DE COPIAS DE UN SEGMENTO DE ADN EXISTENTE EN UNA MUESTRA. O sea. Amplificamos en forma exponencial

Más detalles

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa.

Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Detección de patógenos en alimentos, utilizando la técnica de PCR, reacción en cadena de la polimerasa. Lic. Esp. Mariano Diego Massari 1er Congreso Bioquímico Córdoba 2011 8ª Jornada de Actualización

Más detalles


PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO Dra. Carolina Rodríguez Laboratorio Dr. Stamboulian División Biología Molecular Introducción En la actualidad, el paciente trasplantado,

Más detalles



Más detalles


5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles



Más detalles


PAREJAS SERODISCORDANTE PAREJAS SERODISCORDANTE Las parejas serodiscordantes son aquellas en las que uno de los dos miembros es seropositivo al virus de la inmunodeficiencia humana (VIH). La elevada incidencia del VIH en pacientes

Más detalles


BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Clinical infectious diseases HIV infection is associated with decreased thrombin generation La infección por VIH se asocia con disminución de la generación de trombina Hsue PY

Más detalles



Más detalles

Facultad de Ciencias Bioquímicas y Farmacéuticas Área de Integración n Disciplinar y Estudio de la Problemática Profesional TPP I Unidad 2 Aspectos biológicos del VIH Algunos datos importantes 1959 Se

Más detalles



Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

Evaluación del Sistema COBAS Ampliprep/COBAS AMPLICOR HIV-1 MONITOR TM Test 1.5 en Plasma Seminal

Evaluación del Sistema COBAS Ampliprep/COBAS AMPLICOR HIV-1 MONITOR TM Test 1.5 en Plasma Seminal VALIDACIÓN METODOLÓGICA ORIGINAL Evaluación del Sistema COBAS Ampliprep/COBAS AMPLICOR HIV-1 MONITOR TM Test 1.5 en Plasma Seminal Recibido: 13/10/2009 Aceptado: 22/11/2009 Sonia Castillo *, M. Soledad

Más detalles


PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

PCR gen 18S ARNr humano

PCR gen 18S ARNr humano PCR gen 18S ARNr humano Ref.PCR18S 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa (PCR)

Más detalles

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental.

Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Cuantificación de Legionella mediante real time PCR. Resultados de un estudio experimental. Gemma Saucedo. Laboratorio Aguas de Barcelona 22-23 de noviembre de 2006 Introducción PCR: Polymerase Chain Reaction

Más detalles



Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Virus del Papiloma Humano- HPV

Más detalles

Niveles de interferón en pacientes esquizofrénicos

Niveles de interferón en pacientes esquizofrénicos Niveles de interferón en pacientes esquizofrénicos Dr. Segundo Mesa *Dra. Enma González* Dr. Angel Aguilera** Hospital Psiquiátrico de la Habana* Centro de Ingeniería Genética y Biotecnología** INTRODUCCION

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Tamizaje de infecciones transmisibles por transfusión en Argentina (Ley 22.990 - Ley Nacional de Sangre ) HVB: Enzimoinmunoensayos

Más detalles



Más detalles

Avances recientes en HIV/SIDA: Patogénesis, historia natural y carga viral.

Avances recientes en HIV/SIDA: Patogénesis, historia natural y carga viral. Avances recientes en HIV/SIDA: Patogénesis, historia natural y carga viral. Recent developments in HIV/SIDA: Pathogenesis, natural history and viral load. Campo Rafael E, MD.* Scerpella Ernesto G. MD.*

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

TaqMan GMO Maize Quantification Kit. Part No: 4481972

TaqMan GMO Maize Quantification Kit. Part No: 4481972 TaqMan GMO Maize Quantification Kit Part No: 4481972 1. Introducción Los organismos modificados genéticamente (OMG) se encuentran ampliamente distribuidos, siendo la soja y el maíz los vegetales que ocupan

Más detalles


III CONGRESO NACIONAL DE ATENCIÓN FARMACÉUTICA Adherencia a la terapia antirretroviral en pacientes infectados con el virus de la inmunodeficiencia humana que asisten a una clínica universitaria de enfermedades infecciosas en Venezuela. III CONGRESO

Más detalles


LOS SÍNTOMAS DE LA INFECCIÓN AGUDA POR VIH SERÍAN MÁS VARIADOS DE LO QUE SE PENSABA LOS SÍNTOMAS DE LA INFECCIÓN AGUDA POR VIH SERÍAN MÁS VARIADOS DE LO QUE SE PENSABA Se identifican diversos síntomas atípicos de la primo infección, algunos de ellos graves, aunque poco frecuentes Nota:

Más detalles

Cribado prenatal no invasivo

Cribado prenatal no invasivo Cribado prenatal no invasivo Detección T13, T18, T21, monosomía X y sexo fetal en sangre materna. Dra. Blanca Bermejo Barrera, Directora Desarrollo Área Molecular Evolución del cribado prenatal 1960 s

Más detalles

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema INTRODUCIÓN Hagamos un repaso de los datos recogidos en la bibliografía. Infección por VHC: Infección crónica por VHC afecta al 3% de la población mundial Incidencia de infección aguda: 1/100.000 habitantes

Más detalles

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007 Problemas en el Diagnostico de la Infección VIH Diplomado de Atención Integral del VIH-SIDA. 2007 Algunas Generalidades Sub - tipos del VIH y pruebas de laboratorio Analogía del VIH 1 y 2 es de: 40-60%

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires OBJETIVO DETECTAR Y DESCARTAR PRECOZMENTE UNIDADES DE SANGRE DE DONANTES CON VIREMIA PARA HIV, HBV Y HCV, CON PRUEBAS SEROLÓGICAS

Más detalles



Más detalles



Más detalles

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia

PCR a tiempo real. Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real Sección de Biología Molecular, Servicio de Apoyo a la Investigación, Universidad de Murcia PCR a tiempo real (PCRrt) Aplicaciones: - Cuantificación de ácidos nucleicos (AQ). - Estudio

Más detalles


Más detalles



Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

A principios de los años ochentas el desarrollo de nuevas tecnologías para la

A principios de los años ochentas el desarrollo de nuevas tecnologías para la Nuevos marcadores para la detección temprana y predicción de sobrevida en blancos terapéuticos. A principios de los años ochentas el desarrollo de nuevas tecnologías para la identificación del ADN del

Más detalles

El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes

El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes F. Pujol, F. Pérez, A. Dalmau-Bueno, J. Saz, H. Taboada, G. Marazzi, A. Pérez, A. Carrillo, A.

Más detalles

ms9 (Septina 9 metilada) Biomarcador del Cáncer Colorectal Luis Sáenz Mateos R3 Análisis Clínicos

ms9 (Septina 9 metilada) Biomarcador del Cáncer Colorectal Luis Sáenz Mateos R3 Análisis Clínicos ms9 (Septina 9 metilada) Biomarcador del Cáncer Colorectal Luis Sáenz Mateos R3 Análisis Clínicos Cáncer de Colon La incidencia de cáncer de colon en España supera los 25.000 casos nuevos al año. El número

Más detalles


DETERMINACIÓN DEL FACTOR Rh por PCR Ref.PCRRh DETERMINACIÓN DEL FACTOR Rh por PCR 1.OBJETIVO DEL EXPERIMENTO El objetivo de este experimento es introducir a los estudiantes en los principios y práctica de la Reacción en Cadena de la Polimerasa

Más detalles



Más detalles

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario

Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Asesoramiento genético para el estudio del cáncer de mama y ovario hereditario Cuándo debemos sospechar que un cáncer puede ser hereditario? El cáncer es una enfermedad muy frecuente, es fácil que en una

Más detalles

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica

TÉCNICAS GENÓMICAS. 2) Cuantificación del número de virus presentes en muestras de sangre o suero: carga vírica TÉCNICAS GENÓMICAS Utilidad/Objetivos: 1) Detección de microorganismos directamente en muestras clínicas identificando un fragmento específico del genoma del microorganismo concreto 2) Cuantificación del

Más detalles

Información para los participantes y Consentimiento Informado para el miembro de la pareja VIH negativo. El Estudio PARTNER

Información para los participantes y Consentimiento Informado para el miembro de la pareja VIH negativo. El Estudio PARTNER Información para los participantes y Consentimiento Informado para el miembro de la pareja VIH negativo El Estudio PARTNER El estudio PARTNER se realiza con parejas en las que: (i) uno de los miembros

Más detalles


EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH.

Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Manifestaciones clínicas. Cuadro mononucleósido asociado a la primoinfección. Clasificación de la infección VIH. Jose Maria Kindelán. Hospital Universitario Reina Sofía. Córdoba I. Historia natral de la

Más detalles

P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA"

P.C.R. Técnica de amplificación enzimática de secuencias específicas de DNA P.C.R. "Técnica de amplificación enzimática de secuencias específicas de DNA" Paso 1: Desnaturalización del DNA Paso 2: Hibridación de los "Primers" Paso 3: Extensión Paso 1: Desnaturalización del DNA

Más detalles

La determinación de la carga viral de VIH en sangre periférica ha demostrado su utilidad como:

La determinación de la carga viral de VIH en sangre periférica ha demostrado su utilidad como: Ensayos de detección de carga viral VIH Miguel Angel von Wichmann de Miguel, María Dolores de Juan Echávarri Unidad de Enfermedades Infecciosas y Servicio de Inmunología, Hospital Donostia, San Sebastián

Más detalles



Más detalles

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica Genotipificación de VIH en el INS: técnica local y técnicas convencionales Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. lar Responsable de los Procesos

Más detalles


PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta

Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta Resumen de la clase teórica sobre Infección persistente crónica II: HIV Dictada el día 30 de junio de 2008. Prof. Dra. Liliana Martínez Peralta El HIV es un retrovirus que pertenece al género de los Lentivirus.

Más detalles


DIAGNÓSTICO DE LAS ITS. INFECCIONES VIRALES DIAGNÓSTICO DE LAS ITS. INFECCIONES VIRALES Virus Herpes Simple Prof. Adj. Pablo López. Departamento de Laboratorio de Patología Clínica. Inmunología y Biología Molecular. Hospital de Clínicas. Herpes

Más detalles

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205

Código: IDX-016 Ver: 1 TOXO. Sistema para la detección de la presencia de ADN de Toxoplasma gondii. Reg. MSP 21205 Sistema para la detección de la presencia de ADN de Toxoplasma gondii Reg. MSP 21205 Valdense 3616. 11700. Montevideo. Uruguay. Teléfono (598) 2 336 83 01. Fax (598) 2 336 71 60. info@atgen.com.uy www.atgen.com.uy

Más detalles

Investigador principal: Dr. Jordi Casabona Barbarà. Centro: Hospital Universitari Germans Trias i Pujol. Duración: 3 años MEMORIA FINAL. 1.


Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante

BIOTECNOLOGÍA. 1.- Ingeniería Genética, ADN recombinante BIOTECNOLOGÍA 1.- Ingeniería Genética, ADN recombinante Técnica del ADN recombinante: es la más usada en ingeniería genética, esta basada en el uso de las enzimas de restricción o endonucleasas de restricción

Más detalles

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico.

AQUAGESTION. ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. AQUAGESTION ISAv: Un acercamiento actualizado en la detección de sus variantes en la región. Departamento de Desarrollo y Laboratorio Diagnóstico. Noviembre 2011 ACTUALIDAD Este año Sernapesca confirma

Más detalles

VIH en Africa Subsahariana. Subtipos.

VIH en Africa Subsahariana. Subtipos. VIH en Africa Subsahariana. Subtipos. Dra. Dra. África Africa Holguín Holguín Curso: Diagnóstico precoz de la infección por VIH. Noviembre 2010 ÍNDICE - Características del VIH en África Subsahariana -

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela PACIENTE CON SINDROME MENINGEO Y EXANTEMA Caso presentado por: E. Losada, A. Antela, A. Prieto. Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de

Más detalles


http://youtu.be/j8bl3jmfg4g http://youtu.be/j8bl3jmfg4g El VIH -1 entra a la célula del huésped al ligarse con el receptor CD4. Luego interacciona con las citoquinas ya sea del - co- receptor CCR5 predominantemente, - o el CXCR4

Más detalles

Amplicor HIV-1 monitor como standard predictivo en el tratamiento de pacientes HIV-1 positivos

Amplicor HIV-1 monitor como standard predictivo en el tratamiento de pacientes HIV-1 positivos Amplicor HIV-1 monitor como standard predictivo en el tratamiento de pacientes HIV-1 positivos Amplicor HIV-1 monitor in the treatment of HIV-1 positive patients Zulema Heredia Agurto * Ricardo Wimper

Más detalles

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original.

PCR? PCR en el diagnóstico? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR? Objetivo: Obtener un gran número de copias de un fragmento particular de ADN a partir de una cantidad mínima original. PCR en el diagnóstico? A partir de una mezcla compleja de ADN, se puede realizar

Más detalles

Hepatitis aguda C en pacientes VIH. Montserrat Laguno Centeno Hospital Clínico. Barcelona 08/10/2015

Hepatitis aguda C en pacientes VIH. Montserrat Laguno Centeno Hospital Clínico. Barcelona 08/10/2015 Hepatitis aguda C en pacientes VIH Montserrat Laguno Centeno Hospital Clínico. Barcelona 08/10/2015 Situación actual de la Hepatitis Aguda C (HAC) en el paciente VIH Experiencia en HAC en el paciente VIH

Más detalles



Más detalles

Un centro de biotecnología al servicio de la salud

Un centro de biotecnología al servicio de la salud Tecnologías para la Vida S. de R.L. de C.V. En búsqueda del bienestar humano Un centro de biotecnología al servicio de la salud Mexicali, Baja California, México Septiembre de 2012 Tecnologías para la

Más detalles


BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Clinical infectious diseases HIV-infected Ugandan adults taking antiretroviral therapy with CD4 counts > 200 cel/µl who discontinue cotrimoxazole prophylaxis have increased risk

Más detalles

Procreación Asistida En Parejas VIH +

Procreación Asistida En Parejas VIH + Procreación Asistida En Parejas VIH + Miguel A. Escobar MD, FACP Profesor de Medicina - Universidad del Valle Director Hemocentro - Cruz Roja del Valle Cali - Colombia Definiciones Serodiscordancia Hombre

Más detalles

Selección de pacientes

Selección de pacientes 2 Selección de pacientes MENSAJES CLAVE Aproximadamente entre el 20% y el 30% de las pacientes con cáncer de mama presentan tumores HER2 positivos. Hasta un 24% de los tumores con receptores de estrógenos

Más detalles

ONE Step ONE Decision OSNA para el análisis de ganglios centinela en cáncer de mama

ONE Step ONE Decision OSNA para el análisis de ganglios centinela en cáncer de mama ONE Step ONE Decision OSNA para el análisis de ganglios centinela en cáncer de mama OSNA UN paso por delante La biopsia de los ganglios linfáticos centinela (SLN, por sus siglas en inglés) se ha establecido

Más detalles


ENFERMEDAD RESIDUAL MINIMA EN HEMATOPATOLOGÍA XXV Congreso de la SEAP-SEC-SEPAF, Zaragoza, Mayo 2011 ENFERMEDAD RESIDUAL MINIMA EN HEMATOPATOLOGÍA Santiago Montes Moreno MD Departamento de Patología, HUMV Grupo de Linfomas y Unidad de Diagnóstico

Más detalles

El control de la viremia. Un factor fundamental en la rentabilidad de la vacunación frente a PCV2

El control de la viremia. Un factor fundamental en la rentabilidad de la vacunación frente a PCV2 44 El control de la viremia. Un factor fundamental en la rentabilidad de la vacunación frente a PCV2 Bollo JM, Jiménez M, Menjón R. MSD Animal Health. Introducción En primer lugar y de cara a todos aquellos

Más detalles

Pruebas de bajo costo para el seguimiento al tratamiento de VIH

Pruebas de bajo costo para el seguimiento al tratamiento de VIH Pruebas de bajo costo para el seguimiento al tratamiento de VIH (Economical assays for monitoring HIV-1 treatment) Lisa Frenkel Profesora de Pediatria y Medicina del Laboratorio Marzo 2010 Uso de pruebas

Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles