Estrategia utilizada

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Estrategia utilizada"

Transcripción

1 Estrategia utilizada 1) Extracción HIV RNA V ) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC AAGCACATTGT TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC AAGCACATTGT TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC AAGCACATTGT

2 Interpretación de Resultados Algoritmo Bio-informatico informatico geno2pheno [CORECEPTOR]

3 geno2pheno TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACGAGGGAG [CORECEPTOR] ATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAACAAGCACATTGT TGTACAAGACCCAACAACAATACAAGAAAAAGTATA CATGTAGGACGAGGGAGATCAATTTATGCAACAGA AAAAATAATAGGAGATACAAAACAAGCACATTGT

4 geno2pheno [CORECEPTOR] A1 effective not effective A2 A3 effective effective effective effective Report use A-CCR5 not use A-CCR5 effective consider effective consider

5 Resultados Posibles FPR: 2 < g2p < 5.75 A-CCR5: No Efectivo < considerar < efectivo

6 Tropismo Viral Para su determinación en plasma se requiere una carga viral > 1000 copias/ml Su aplicación esta definida y restringida para Fallo terapéutico Pacientes Naive.

7 Situaciones donde uno desearía definir el tropismo con viremia no detectable Cuando se requiere cambiar un régimen en pacientes con carga viral no detectable (< 50 copias/ml) como consecuencia de: Toxicidad Simplificación terapéutica

8 Ensayo Genotípico de Tropismo en HIV-DNA proviral en CMSP (PMBC) Sangre Buffy Coat HIV-DNA RT-PCR V3 loop Interpretación de resultados Secuencia Automática

9 Que Test de Tropismo Viral usar? Tropismo en HIV-RNA (plasma) ó Tropismo en HIV-DNA (proviral) en CMSP? Paciente CV Mayor 1000 copias (pl asma) CV menor a 1000 copias (células - Buffy Coat) Näive Fallo Toxicidades Simplificación Tropi smo HIV- RNA Tropi smo HIV- RNA Tropismo en HIV- DNA proviral Tropismo en HIV- DNA proviral

10 Futuro inmediato: Aplicación de la segunda generación de tecnología de secuenciación: PIROSECUENCIACIÓN

11

12

13 Carga Viral en DBS (Dried Blood Spot Gota de sangre seca) DBS implica recolectar sangre entera en papel de filtro específico Whatman (Protein Saver 903 Card ref ) Usualmente se colocan 50 µl de sangre entera (o plasma) por cada spot (2 a 4 por cartón). Debe ser secado a temperatura ambiente y almacenado en un sobre con disecante para evitar degradación. Es una herramienta interesante ya que facilita el envío de muestras de lugares donde el acceso al hielo seco no es fácil y no existen condiciones para su implementación.

14 Correlation between HIV-1 viral load quantification in plasma, dried blood spots, and dried plasma spots using the Roche COBAS Taqman assay. J Clin Virol Jan;47(1):4-7. Epub 2009 Dec 4. Andreotti M et al N: 129 plasmas y DBS, N: 76 DPS Plasma : High pure / Taqman; DBS y DPS: Mini Mag/ Taqman DBS DPS Concordancia: 92,1%. CVPL: 4.17%± 0,63 CV DPS: 3,82 ± 0.53 P< Concordancia: 89,1%. CVPL: 4.45±0,79 log CVDBS: 4,13± 0,71 P< Sensibilidad: 88,2% (80,3%- 93,3%) Especificidad: 94,7% (71,9%- 99,7%) PPV: 98,9% (93,6-99,9) NPV: 58,1% (39,2-74,9) Sensibilidad: 91,3% (81,3%- 96,3%) Especificidad: 100% (56.0%- 100%) PPV: 100% (92,8-100) NPV: 58,1% (26,1-79,5)

15 Carga Viral en DBS (Dried Blood Spot Gota de sangre seca) Diversos estudios demostraron la efectividad para su uso (1,2,3) 1. Amellal B, Katlama C, Calvez V: Evaluation of the use of dried spots and of different storage conditions of plasma for HIV-1 RNA quantification. HIV Med.8, (2007). 2. Los Ayele resultados W, Schuurman R, Messele obtenidos T et al.: Use of se dried correlacionaron spots of whole blood, plasma, and entre mother's los milk collected diferentes on filter paper métodos for measurement (4) of HIV type 1 burden. J. Clin. Microbiol.45, (2007). 3. Sensibilidad Brambilla D, Jennings disminuida C, Aldrovandi G et al.: del Multicenter orden evaluation de of 1000 use of dried cps/ml blood and plasma (3 logs) spot specimens por in bajo quantitative imput assays for de HIV RNA: measurement, precision, and RNA stability. J. Clin. Microbiol.41, (2003). muestra (50ul) 4. Garrido C, Zahonero N, Corral A et al.: Correlation between HIV-1 RNA measurements obtained with dried blood spots and those obtained with plasma by use of NucliSENS EasyQ HIV-1 and Abbott Real-Time HIV load test. J. Clin. Microbiol.47, (2009). Considerando la recomendación de OMS en sus guías de cambiar la terapia con valores de CV > 5000 cps/ml (5) esta sensibilidad es adecuada ante la imposibilidad de acceder a las plataformas actuales. 5. WHO. Antiretroviral therapy for HIV infection in adults and adolescents: recommendations for a public health approach. Geneva, Degradación de Ac. Nucleicos en condiciones extremas. Imperfecta eficiencia en la extracción de acidos nucleicos Potencial interferencia del DNA proviral cuando se usa DBS

16 Muchas Gracias.

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus

Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Inmunodeficiencia Humana) Fabián Fay CIBIC. Rosario. Argentina Test de laboratorio para

Más detalles

Determinación de la carga viral del VIH-1 en muestras de sangre seca en papel de filtro

Determinación de la carga viral del VIH-1 en muestras de sangre seca en papel de filtro Determinación de la carga viral del VIH-1 en muestras de sangre seca en papel de filtro Nancy M Ruiz 1, María T Pérez, Héctor M Díaz 3, Maricela Izquierdo 4, Madeline Blanco 1, Liuber Y Machado 1, Eladio

Más detalles

ARTÍCULO ORIGINAL REPRODUCIBILITY OF A QUANTIFICATION ASSAY, NUCLISENS HIV - 1 QT, IN HIV POSITIVE PLASMA SAMPLES

ARTÍCULO ORIGINAL REPRODUCIBILITY OF A QUANTIFICATION ASSAY, NUCLISENS HIV - 1 QT, IN HIV POSITIVE PLASMA SAMPLES Rev Chil Infect (2002); 19 (1): 25-31 ARTÍCULO ORIGINAL Estudio de reproducibilidad del examen de cuantificación de VIH-1 por la técnica Nuclisens HIV-1 QT en muestras de plasma de pacientes infectados

Más detalles

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto

Más detalles

Evaluación comparativa de COBAS TaqMan HIV-1 y COBAS AMPLICOR HIV-1 para la cuantificación de carga viral plasmática de HIV-1

Evaluación comparativa de COBAS TaqMan HIV-1 y COBAS AMPLICOR HIV-1 para la cuantificación de carga viral plasmática de HIV-1 BREVE INFORME SOBRE INVESTIGACIÓN ORIGINAL Evaluación comparativa de COBAS TaqMan HIV-1 y COBAS AMPLICOR HIV-1 para la cuantificación de carga viral plasmática de HIV-1 Recibido: 01/04/2009 Aceptado: 26/05/2009

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Estrategia de Laboratorios para la Farmacorresistencia de la Organización Mundial de la Salud/HIVResNet

Estrategia de Laboratorios para la Farmacorresistencia de la Organización Mundial de la Salud/HIVResNet ---------------Antiviral Therapy 13 Suppl 2:49 57--------------- Estrategia de Laboratorios para la Farmacorresistencia de la Organización Mundial de la Salud/HIVResNet Silvia Bertagnolio 1 *, Inge Derdelinckx

Más detalles

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

Métodos de laboratorio para el diagnóstico pediátrico del VIH

Métodos de laboratorio para el diagnóstico pediátrico del VIH Métodos de laboratorio para el diagnóstico pediátrico del VIH Presidenta de la Nación Dra. Cristina Fernández de Kirchner Ministro de Salud Dr. Juan Luis Manzur Secretario de Promoción y Programas Sanitarios

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires OBJETIVO DETECTAR Y DESCARTAR PRECOZMENTE UNIDADES DE SANGRE DE DONANTES CON VIREMIA PARA HIV, HBV Y HCV, CON PRUEBAS SEROLÓGICAS

Más detalles

Pruebas de VPH disponibles, efectividad e implementación programática en el mundo. Rolando Herrero. Buenos Aires, Noviembre 2015

Pruebas de VPH disponibles, efectividad e implementación programática en el mundo. Rolando Herrero. Buenos Aires, Noviembre 2015 Pruebas de VPH disponibles, efectividad e implementación programática en el mundo. Rolando Herrero Buenos Aires, Noviembre 2015 La detección de infección por VPH es el método de elección para el tamizaje

Más detalles

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica Genotipificación de VIH en el INS: técnica local y técnicas convencionales Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. lar Responsable de los Procesos

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema INTRODUCIÓN Hagamos un repaso de los datos recogidos en la bibliografía. Infección por VHC: Infección crónica por VHC afecta al 3% de la población mundial Incidencia de infección aguda: 1/100.000 habitantes

Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

Evaluación del Sistema COBAS Ampliprep/COBAS AMPLICOR HIV-1 MONITOR TM Test 1.5 en Plasma Seminal

Evaluación del Sistema COBAS Ampliprep/COBAS AMPLICOR HIV-1 MONITOR TM Test 1.5 en Plasma Seminal VALIDACIÓN METODOLÓGICA ORIGINAL Evaluación del Sistema COBAS Ampliprep/COBAS AMPLICOR HIV-1 MONITOR TM Test 1.5 en Plasma Seminal Recibido: 13/10/2009 Aceptado: 22/11/2009 Sonia Castillo *, M. Soledad

Más detalles

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix

Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Métodos de determinación del virus del papiloma humano (HPV) en cribado de cáncer de cérvix Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Virus del Papiloma Humano- HPV

Más detalles

Pruebas de bajo costo para el seguimiento al tratamiento de VIH

Pruebas de bajo costo para el seguimiento al tratamiento de VIH Pruebas de bajo costo para el seguimiento al tratamiento de VIH (Economical assays for monitoring HIV-1 treatment) Lisa Frenkel Profesora de Pediatria y Medicina del Laboratorio Marzo 2010 Uso de pruebas

Más detalles

PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO

PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO Dra. Carolina Rodríguez Laboratorio Dr. Stamboulian División Biología Molecular Introducción En la actualidad, el paciente trasplantado,

Más detalles

LA EVOLUCIÓN DE LA GENÓMICA

LA EVOLUCIÓN DE LA GENÓMICA UAM 10 julio 2014 1 LA EVOLUCIÓN DE LA GENÓMICA 2 LOS DOS OBJETIVOS DE LA GENÓMICA IDENTIFICAR GENES CUANTIFICAR GENES DNA & RNA 3 CONOCER LOS GENES Y SUS VARIANTES IMPACTA EN EL ESTADO DE SALUD Y ENFERMEDAD

Más detalles

Determinación Genotípica del Tropismo del VIH en la práctica clínica

Determinación Genotípica del Tropismo del VIH en la práctica clínica Documento de Consenso para la Determinación Genotípica del Tropismo del VIH en la práctica clínica Documento de Consenso para la Determinación Genotípica del Tropismo del VIH en la práctica clínica Eva

Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes

El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes F. Pujol, F. Pérez, A. Dalmau-Bueno, J. Saz, H. Taboada, G. Marazzi, A. Pérez, A. Carrillo, A.

Más detalles

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx)

EVALUACION EXTERNA DEL DESEMPEÑO PARA LA DETECCION DEL VIRUS DE INFLUENZA TIPO A MEDIANTE LA TÉCNICA DE RT- PCR PANEL x (20xx) 1. OBJETIVO Evaluar el desempeño de los Laboratorios de Salud Pública participantes en cuanto a la detección del virus de la Influenza A mediante la técnica de RT PCR. 2. ALCANCE Este documento se tomo

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

VIPER LT TM Y BD ONCLARITY TM HPV ASSAY: UNA NUEVA APROXIMACIÓN AL DIAGNÓSTICO DEL VPH

VIPER LT TM Y BD ONCLARITY TM HPV ASSAY: UNA NUEVA APROXIMACIÓN AL DIAGNÓSTICO DEL VPH VIPER LT TM Y BD ONCLARITY TM HPV ASSAY: UNA NUEVA APROXIMACIÓN AL DIAGNÓSTICO DEL VPH Sabine Muench-Garthoff, Ph.D. European Marketing Manager STD, BD Diagnostics Como el virus del papiloma humano no

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

DIAGNÓSTICO Y TRATAMIENTO DE LAS INFECCIONES POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA TIPO 2

DIAGNÓSTICO Y TRATAMIENTO DE LAS INFECCIONES POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA TIPO 2 DIAGNÓSTICO Y TRATAMIENTO DE LAS INFECCIONES POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA TIPO 2 Carmen Maroto Vela, Carmen Bernal Zamora y Fe García García Departamento de Microbiología. Facultad de Medicina.

Más detalles

Estrategia de Laboratorios para la Farmacorresistencia de la Organización Mundial de la Salud/HIVResNet

Estrategia de Laboratorios para la Farmacorresistencia de la Organización Mundial de la Salud/HIVResNet ---------------Antiviral Therapy 13 Suppl 2:49 57--------------- Estrategia de Laboratorios para la Farmacorresistencia de la Organización Mundial de la Salud/HIVResNet Silvia Bertagnolio 1 *, Inge Derdelinckx

Más detalles

ZONA GRIS: IMPORTANCIA DE LA FASE PREANALITICA EN BIOLOGÍA MOLECULAR.

ZONA GRIS: IMPORTANCIA DE LA FASE PREANALITICA EN BIOLOGÍA MOLECULAR. ZONA GRIS: IMPORTANCIA DE LA FASE PREANALITICA EN BIOLOGÍA MOLECULAR. Autores: Dª. Sonia Vidal Rico. D. Fernando Grossón García. D. Carlos Pascual Ferrer. Dª. Elena Vidal Rico. Dª. Concepción Tuset Ruiz.

Más detalles

Nuevos enfoques diagnósticos de la infección por VIH

Nuevos enfoques diagnósticos de la infección por VIH Nuevos enfoques diagnósticos de la infección por VIH Santiago Estrada M.D Laboratorio Clínico VID Agosto 28 de 2015 Hoja informativa para los pacientes que solicitan una prueba de VIH Recomendaciones para

Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles

PORQUE BUSCAMOS LA HEPATITIS C?

PORQUE BUSCAMOS LA HEPATITIS C? PORQUE BUSCAMOS LA HEPATITIS C? ESTE INDIVIDUO TIENE HCV? ESTA PERSONA (POTENCIAL DONANTE DE SANGRE) PUEDE ESTAR EXPUESTO A HCV? QUE EFECTOS TIENE LA INFECCION POR HCV EN EL HIGADO? CUAL ES LA PROBABILIDAD

Más detalles

Propuesta de nuevos algoritmos para el diagnóstico de VIH

Propuesta de nuevos algoritmos para el diagnóstico de VIH Propuesta de nuevos algoritmos para el diagnóstico de VIH Propuesta de nuevos algoritmos para el diagnóstico de VIH Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas

Más detalles

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS

PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS PROTOCOLOS DE OBTENCIÓN, CONSERVACIÓN Y ENVÍO DE MUESTRAS BIOLÓGICAS ESTUDIO TRASLACIONAL PROSPECTIVO DE DETERMINACIÓN DE FACTORES PREDICTIVOS DE EFICACIA Y TOXICIDAD EN PACIENTES CON CÁNCER ÍNDICE 1 INTRODUCCIÓN....

Más detalles

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa)

PCR. Componentes del PCR. PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) PCR PCR Polymerase Chain Reaction (Reacción en Cadena de la Polimerasa) Es una técnica de biología molecular descrita en 1986 por Kary Mullis. (Nobel de química en 1993) Necesidad de pruebas de diagnóstico

Más detalles

Unidad de Investigación Clínica Ensayos Clínicos Fase I y II. Unidad de Investigació

Unidad de Investigación Clínica Ensayos Clínicos Fase I y II. Unidad de Investigació Unidad de Investigación Clínica Ensayos Clínicos Fase I y II La Unidad de Investigació Investigación Clí Clínica (UIC) es un proyecto adscrito al Subprograma de Dinamizació Dinamización del Entorno Investigador

Más detalles

Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales

Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales Revista Mexicana de Patología Clínica 1998; Volumen 45(3): 159-161 Carga viral y subpoblaciones linfocitarias en la infección con VIH- 1. Comparación entre sus determinaciones basales NOHEMI PATRICIA CASTILLO

Más detalles

SOBREEXPRESIÓN DEL GEN WT1 PARA LA MONITORIZACIÓN DE LA ENFERMEDAD RESIDUAL MÍNIMA EN LA LEUCEMIA MIELOBLÁSTICA AGUDA

SOBREEXPRESIÓN DEL GEN WT1 PARA LA MONITORIZACIÓN DE LA ENFERMEDAD RESIDUAL MÍNIMA EN LA LEUCEMIA MIELOBLÁSTICA AGUDA SOBREEXPRESIÓN DEL GEN WT1 PARA LA MONITORIZACIÓN DE LA ENFERMEDAD RESIDUAL MÍNIMA EN LA LEUCEMIA MIELOBLÁSTICA AGUDA Investigador principal: Dr. David Gallardo Giralt Institut Català d Oncologia Duración:

Más detalles

Universidad Nacional de Rosario - Facultad de Ciencias MédicasM

Universidad Nacional de Rosario - Facultad de Ciencias MédicasM Universidad Nacional de Rosario - Facultad de Ciencias MédicasM Cátedra de Microbiología, Virología a y Parasitología HIV - Área Injuria - 2015 HTLV HIV Genero: Deltaretrovirus HTLV-1 y HTLV2 (Virus linfotrofico

Más detalles

Diagnóstico microbiológico de la infección por el VIH

Diagnóstico microbiológico de la infección por el VIH REVISIÓN Diagnóstico microbiológico de la infección por el VIH Juan Carlos López-Bernaldo de Quirós a, Rafael Delgado b, Federico García c, José M.ª Eiros d y Raúl Ortiz de Lejarazu d a Servicio de Microbiología.

Más detalles

Hubbard AAHIVM PREVENMED Mother Child &Adolescent. Program Comité Binacional San Diego-Tijuana VIH/SIDA ITS. phubbard@ucsd.edu www.ucsdmcap.

Hubbard AAHIVM PREVENMED Mother Child &Adolescent. Program Comité Binacional San Diego-Tijuana VIH/SIDA ITS. phubbard@ucsd.edu www.ucsdmcap. Dra. Patricia E. González lez-moreno Hubbard AAHIVM PREVENMED Mother Child &Adolescent Program Comité Binacional San Diego-Tijuana VIH/SIDA ITS phubbard@ucsd.edu www.ucsdmcap.org PRUEBAS DE VIH/SIDA 1

Más detalles

Dra. Natàlia Casamitjana

Dra. Natàlia Casamitjana VALIDACIÓN DE LA DETERMINACIÓN DEL RNA DEL VIRUS DE LA HEPATITIS C, RNA DEL VIH-1 Y DNA DEL VIRUS DE LA HEPATITIS B EN LECHE HUMANA MEDIANTE UN SISTEMA AUTOMÁTICO DE AMPLIFICACIÓN DE ÁCIDOS NUCLEICOS Dra.

Más detalles

ESTUDIO PRENATAL PARA SINDROME DE DOWN Y DEFECTOS DEL TUBO NEURAL En los últimos años se ha comenzado ha realizar, con gran aceptación en Europa y

ESTUDIO PRENATAL PARA SINDROME DE DOWN Y DEFECTOS DEL TUBO NEURAL En los últimos años se ha comenzado ha realizar, con gran aceptación en Europa y ESTUDIO PRENATAL PARA SINDROME DE DOWN Y DEFECTOS DEL TUBO NEURAL En los últimos años se ha comenzado ha realizar, con gran aceptación en Europa y EEUU, el método de screening prenatal en suero que permite

Más detalles

BIBLIOGRAFÍA INTERNACIONAL

BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Clinical infectious diseases HIV-infected Ugandan adults taking antiretroviral therapy with CD4 counts > 200 cel/µl who discontinue cotrimoxazole prophylaxis have increased risk

Más detalles

Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz.

Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz. Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz. Bioq. Analia Cudola Jefa de Departamento Laboratorio Central. Ministerio de Salud Pública de

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Tamizaje de infecciones transmisibles por transfusión en Argentina (Ley 22.990 - Ley Nacional de Sangre ) HVB: Enzimoinmunoensayos

Más detalles

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales

IiSGM 2015. Objetivo del Curso. III Curso de Técnicas Experimentales página 2 Objetivo del Curso El objetivo del «Curso de Técnicas Experimentales en Investigación Biomédica» es proporcionar a los asistentes unas nociones básicas sobre las metodologías y tecnología habitualmente

Más detalles

Aplicaciones de la Biología Molecular en la Salud

Aplicaciones de la Biología Molecular en la Salud Aplicaciones de la Biología Molecular en la Salud Ácidos nucleicos Dr. Javier Quinteiro (USC) Ácidos nucleicos ADN Genoma Información más detallada acerca de un organismo Accesible a través de secuenciación

Más detalles

Licda. Yarisel Rodríguez Mgtra. Dalis Mojica ICGES/LCRSP

Licda. Yarisel Rodríguez Mgtra. Dalis Mojica ICGES/LCRSP Licda. Yarisel Rodríguez Mgtra. Dalis Mojica ICGES/LCRSP RED NACIONAL DE DENGUE PROGRAMA DE EVALUACIÓN EXTERNA DE LA CALIDAD SUPERVISIONES PRUEBAS DE PROFICIENCIA CONTROL DE CALIDAD INDIRECTO No hay laboratorios

Más detalles

INTRODUCCIÓN A LAS TÉCNICAS DE DETECCIÓN DE ÁCIDOS NUCLÉICOS (N.A.T.)

INTRODUCCIÓN A LAS TÉCNICAS DE DETECCIÓN DE ÁCIDOS NUCLÉICOS (N.A.T.) INTRODUCCIÓN A LAS TÉCNICAS DE DETECCIÓN DE ÁCIDOS NUCLÉICOS (N.A.T.) BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar INFECCIONES

Más detalles

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela PACIENTE CON SINDROME MENINGEO Y EXANTEMA Caso presentado por: E. Losada, A. Antela, A. Prieto. Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de

Más detalles

RD-100i OSNA La nueva generación de análisis de ganglios centinela en cáncer de mama

RD-100i OSNA La nueva generación de análisis de ganglios centinela en cáncer de mama RD-1i OSNA La nueva generación de análisis de ganglios centinela en cáncer de mama RD-1i OSNA La nueva generación de análisis de ganglios centinela en cáncer de mama La biopsia de ganglios centinela se

Más detalles

Tecnología y avances en el diagnóstico del VIH

Tecnología y avances en el diagnóstico del VIH SERIE DE BOLETINES TÉCNICOS Tecnología y avances en el diagnóstico del VIH Qué es la tecnología de diagnóstico del VIH? La tecnología de diagnóstico del VIH se refiere tanto a la tecnología para hacer

Más detalles

Analizador portátil til CD4. Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos

Analizador portátil til CD4. Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos Analizador portátil til CD4 Solución innovadora y revolucionaria para el seguimiento de pacientes HIV positivos Qué es PIMA? Es la primer solución point-of-care para el análisis de CD4. Diseñado para desempeñarse

Más detalles

ms9 (Septina 9 metilada) Biomarcador del Cáncer Colorectal Luis Sáenz Mateos R3 Análisis Clínicos

ms9 (Septina 9 metilada) Biomarcador del Cáncer Colorectal Luis Sáenz Mateos R3 Análisis Clínicos ms9 (Septina 9 metilada) Biomarcador del Cáncer Colorectal Luis Sáenz Mateos R3 Análisis Clínicos Cáncer de Colon La incidencia de cáncer de colon en España supera los 25.000 casos nuevos al año. El número

Más detalles

INFECCION POR HHV6 EN TRANSPLANTADOS RENALES: UNA CONTROVERSIA EN EL DIAGNOSTICO. Julieta Giménez Carolina Carrizo

INFECCION POR HHV6 EN TRANSPLANTADOS RENALES: UNA CONTROVERSIA EN EL DIAGNOSTICO. Julieta Giménez Carolina Carrizo INFECCION POR HHV6 EN TRANSPLANTADOS RENALES: UNA CONTROVERSIA EN EL DIAGNOSTICO Julieta Giménez Carolina Carrizo Infection with Herpesvirus 6 after Kidney-Pancreas Transplant Hombre, 29 añosa Enfermedad

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

Cuantificación Absoluta por RT-qPCR

Cuantificación Absoluta por RT-qPCR Curso de actualización y perfeccionamiento Diseño, ejecución y reporte de experimentos de retrotranscripción seguida de reacción en cadena de la polimerasa cuantitativa en tiempo real (RT-qPCR) Cuantificación

Más detalles

Diagnóstico microbiológico de la infección por el VIH. Procedimientos en Microbiología Clínica

Diagnóstico microbiológico de la infección por el VIH. Procedimientos en Microbiología Clínica Procedimientos en Microbiología Clínica Recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica 6b Diagnóstico microbiológico de la infección por el VIH Editores Coordinador

Más detalles

Utilidad de la Biología Molecular en el Diagnóstico y Vigilancia del Dengue

Utilidad de la Biología Molecular en el Diagnóstico y Vigilancia del Dengue Utilidad de la Biología Molecular en el Diagnóstico y Vigilancia del Dengue José Usme Ciro Unidad de Secuenciación y Análisis Genómico Grupo de Virología Instituto Nacional de Salud Virus dengue (DENV)

Más detalles

METODOS MOLECULARES DE INNOVACION EN BANCO DE SANGRE

METODOS MOLECULARES DE INNOVACION EN BANCO DE SANGRE VI CONGRESO DEL GRUPO COOPERATIVO IBERO- AMERICANO DE MEDICINA TRANSFUSIONAL G-CIAMT 06-11 de junio 2009 METODOS MOLECULARES DE INNOVACION EN BANCO DE SANGRE Dr. César Sánchez Zúñiga Laboratorio de Biomedicina

Más detalles

Herramientas diagnósticas moleculares e inmunológicas para el virus Chikungunya

Herramientas diagnósticas moleculares e inmunológicas para el virus Chikungunya Herramientas diagnósticas moleculares e inmunológicas para el virus Chikungunya Jhon Carlos Castaño Osorio, MD, PhD. Facultad Ciencias de la Salud, Universidad del Quindío Pereira, 03/08/2014 Aspectos

Más detalles

PERFIL DE LOS NUEVOS CABA 2010-2011

PERFIL DE LOS NUEVOS CABA 2010-2011 PERFIL DE LOS NUEVOS DIAGNÓSTICOS CABA 2010-2011 Distribución de las notificaciones según sexo y estadio clínico al momento del diagnóstico CABA 2010-2011 Estadio % mujeres % hombres SRA 1,9 1,8 Asintomático

Más detalles

Aspectos clínicos a considerar en el monitoreo del VIH

Aspectos clínicos a considerar en el monitoreo del VIH UNIVERSIDAD NACIONAL AUTONOMA DE NICARAGUA CENTRO DE INVESTIGACIONES Y ESTUDIOS DE LA SALUD DIPLOMADO CENTROAMERICANO SOBRE MONITOREO Y EVALUACIÓN DE POLÍTICAS Y PROGRAMAS DE VIH-SIDA Aspectos clínicos

Más detalles

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar HBV - Marcadores Serológicos HBsAg: Antígeno de Superficie Anti-HBc (total):

Más detalles

Determinación de la carga viral para el diagnóstico precoz de la infección perinatal por el virus de la inmunodeficiencia humana tipo 1 (VIH-1)

Determinación de la carga viral para el diagnóstico precoz de la infección perinatal por el virus de la inmunodeficiencia humana tipo 1 (VIH-1) Determinación de la carga viral para el diagnóstico precoz de la infección perinatal por el virus de la inmunodeficiencia humana tipo 1 (VIH-1) S. Resino García, R. Alonso Arias, J.L. Jiménez Fuentes,

Más detalles

GenomeLab GeXP Sistema de Análisis Genético

GenomeLab GeXP Sistema de Análisis Genético GenomeLab GeXP Sistema de Análisis Genético PLATAFORMA CON MULTIPLES APLICACIONES DETECCIÓN DE VIRUS, BACTERIAS, LEVADURAS, HONGOS, APLICACIONES ESPECIALES, ETC. GenomeLab GeXP GenomeLab GeXP Qué es? Es

Más detalles

Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral

Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral Consuelo Viladés Laborda Servicio de Medicina Interna, Hospital Universitario de Tarragona Joan XXIII, Tarragona Introducción

Más detalles

ACTUALIZACIONES EN PRUEBAS SEROLOGICAS Y MOLECULARES EN BANCO DE SANGRE

ACTUALIZACIONES EN PRUEBAS SEROLOGICAS Y MOLECULARES EN BANCO DE SANGRE FUNDACIÓN HEMOCENTRO BUENOS AIRES ACTUALIZACIONES EN PRUEBAS SEROLOGICAS Y MOLECULARES EN BANCO DE SANGRE IMPLEMENTACIÓN DENAT EN ARGENTINA Jorge Rey Jefe Div. ETT Hospital de Clínicas Universidad de Buenos

Más detalles

IMPORTANCIA DEL LABORATORIO EN EL DIAGNÓSTICO Y SEGUIMIENTO DE LA INFECCIÓN VIH. María Delgado Yagüe Resindente de M. Interna H.U.F.

IMPORTANCIA DEL LABORATORIO EN EL DIAGNÓSTICO Y SEGUIMIENTO DE LA INFECCIÓN VIH. María Delgado Yagüe Resindente de M. Interna H.U.F. IMPORTANCIA DEL LABORATORIO EN EL DIAGNÓSTICO Y SEGUIMIENTO DE LA INFECCIÓN VIH María Delgado Yagüe Resindente de M. Interna H.U.F.A DIAGNÓSTICO IMPORTANCIA DEL LABORATORIO EN EL DIAGÓSTICO DE LA INFECCIÓN

Más detalles

El desarrollo de técnicas moleculares de laboratorio nos ha permitido la detección y

El desarrollo de técnicas moleculares de laboratorio nos ha permitido la detección y Ensayos de cuantificación de carga viral VIH-1. El desarrollo de técnicas moleculares de laboratorio nos ha permitido la detección y cuantificación de las moléculas de ARN de VIH-1 en sangre periférica

Más detalles

BUENOS AIRES, 2 B OCT 2 O 11. de la Administración Nacional de Medicamentos, Alimentos y Tecnología

BUENOS AIRES, 2 B OCT 2 O 11. de la Administración Nacional de Medicamentos, Alimentos y Tecnología S~de'P~4, R~dÓHe1H4tit«t04 AN.M.A.T "2011- Afio del Trabajo Decente, la Salud y Seguridad de los Trabajadores". OIUQa,CIm." 7 3, 5 BUENOS AIRES, 2 B OCT 2 O 11 VISTO el Expediente NO 1-0047-0000-005731-11-1,

Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA

2. NIVEL MEDIO 1. NIVEL BASICO BIOLOGIA MOLECULAR 2.1 DNA SALIVA BIOLOGIA MOLECULAR Hemos elaborado un programa en 3 niveles, en función del tipo de estudiante y las posibilidades del centro educativo: 1. NIVEL BASICO 2. NIVEL MEDIO DANAEXTRACTOR KIT Práctica que constituye

Más detalles

En la actualidad, la estrategia de manejo de la

En la actualidad, la estrategia de manejo de la Antagonistas de CCR5 en la infección por virus de inmunodeficiencia humana (VIH): aspectos generales y tropismo viral Pablo Ferrer C. (1), Consuelo Rodríguez M. (2), Rocío Tordecilla F. (2), María A. Guzmán

Más detalles

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana

Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana Experiencias en Q-PCR para la aplicación y diagnóstico en Medicina Humana MSc. Gonzalo Manrique Laboratorio de Biología Molecular Asociación Española Junio de 2009 INDICE INTRODUCCION (conceptos básicos,

Más detalles

Procedimientos en Microbiología Clínica. Recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica

Procedimientos en Microbiología Clínica. Recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica Procedimientos en Microbiología Clínica Recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica 6a. Diagnóstico microbiológico de la infección por el VIH 2 0 0 6 Editores:

Más detalles

Diagnóstico del Dengue

Diagnóstico del Dengue Solución Total: Todo lo que usted necesita saber acerca del Diagnóstico del Dengue Prueba Rápida Dengue Duo ( + Ab Combo) Dengue IgG/IgM ELISA Dengue IgM capture ELISA Dengue IgG capture ELISA ELISA 2

Más detalles

Avances recientes en HIV/SIDA: Patogénesis, historia natural y carga viral.

Avances recientes en HIV/SIDA: Patogénesis, historia natural y carga viral. Avances recientes en HIV/SIDA: Patogénesis, historia natural y carga viral. Recent developments in HIV/SIDA: Pathogenesis, natural history and viral load. Campo Rafael E, MD.* Scerpella Ernesto G. MD.*

Más detalles

A1C Cuál es su número? La no muy conocida prueba de A1C, puede decirle mucho de como mantenerse saludable.

A1C Cuál es su número? La no muy conocida prueba de A1C, puede decirle mucho de como mantenerse saludable. A1C Cuál es su número? La no muy conocida prueba de A1C, puede decirle mucho de como mantenerse saludable. "Yo nunca he escuchado sobre una prueba de A1C. Qué puede hacer por mí?" "Le puede ayudar a descubrir

Más detalles

DIAGNÓSTICO DEL CITOMEGALOVIRUS EN LOS PACIENTES TRASPLANTADOS Y ENSAYOS DE SENSIBILIDAD ANTIVIRAL

DIAGNÓSTICO DEL CITOMEGALOVIRUS EN LOS PACIENTES TRASPLANTADOS Y ENSAYOS DE SENSIBILIDAD ANTIVIRAL DIAGNÓSTICO DEL CITOMEGALOVIRUS EN LOS PACIENTES TRASPLANTADOS Y ENSAYOS DE SENSIBILIDAD ANTIVIRAL Santiago Melón García y María de Oña Navarro Sección de Virología, Servicio de Microbiología I, Hospital

Más detalles

BIBLIOGRAFÍA INTERNACIONAL

BIBLIOGRAFÍA INTERNACIONAL BIBLIOGRAFÍA INTERNACIONAL Clinical infectious diseases HIV infection is associated with decreased thrombin generation La infección por VIH se asocia con disminución de la generación de trombina Hsue PY

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS

PLIEGO DE PRESCRIPCIONES TÉCNICAS PLIEGO DE PRESCRIPCIONES TÉCNICAS Expediente : 2015/000023 Titulo Localidad : Suministro e instalación de Sistema robotizado de ampliación y cuantificación de ácitos nucleicos en tiempo real, financiado

Más detalles

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes

Biología Molecular en el Diagnóstico de Enfermedades Infecciosas. Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Biología Molecular en el Diagnóstico de Enfermedades Infecciosas Dirección Médica Bq. Ivonne Vergara P. Laboratorio Biología Molecular Clínica Las Condes Existen diversas técnicas de Biología Molecular

Más detalles

Enfermedades Infecciosas y Microbiología Clínica

Enfermedades Infecciosas y Microbiología Clínica Volumen 29, Extraordinario 5, Diciembre 2011 Publicación mensual www.elsevier.es/eimc PUBLICACIÓN OFICIAL DE LA SOCIEDAD ESPAÑOLA DE ENFERMEDADES INFECCIOSAS Y MICROBIOLOGÍA CLÍNICA Programa Externo de

Más detalles

SEGUIMIENTO CLÍNICO Y ANALÍTICO DEL PACIENTE VIH. VACUNACIONES PREVENCIÓN Y MANEJO DE LAS COMORBILIDADES EN EL VIH

SEGUIMIENTO CLÍNICO Y ANALÍTICO DEL PACIENTE VIH. VACUNACIONES PREVENCIÓN Y MANEJO DE LAS COMORBILIDADES EN EL VIH SEGUIMIENTO CLÍNICO Y ANALÍTICO DEL PACIENTE VIH. VACUNACIONES PREVENCIÓN Y MANEJO DE LAS COMORBILIDADES EN EL VIH Pilar Vázquez Rodríguez Servicio de M. Interna B Complejo Hospitalario Universitario de

Más detalles

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN.

El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. PROGRAMA CONTROL DE CALIDAD DE MUESTRAS El Banco Nacional de ADN oferta un control de calidad de muestras de ADN y ARN. El programa completo de control de calidad de muestras de ADN y ARN engloba diferentes

Más detalles

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS S. Microbiología Hospital General Universitario de Elche Abril 2009 HEPATITIS A INTRODUCCION La principal característica diferencial

Más detalles

HOSPITAL CLÍNIC-IDIBAPS RED NACIONAL DE CENTROS DE CÁNCER PROGRAMA DE GENÓMICA Y PROTEÓMICA

HOSPITAL CLÍNIC-IDIBAPS RED NACIONAL DE CENTROS DE CÁNCER PROGRAMA DE GENÓMICA Y PROTEÓMICA HOSPITAL CLÍNIC-IDIBAPS RED NACIONAL DE CENTROS DE CÁNCER PROGRAMA DE GENÓMICA Y PROTEÓMICA CATÁLOGO DE OFERTA DE SERVICIOS GENÓMICOS I. INFORMACIÓN GENERAL: NOMBRE DE UNIDAD: Unidad de Genómica CENTRO

Más detalles

Virus de Inmunodeficiencia Humana y Síndrome de Inmunodeficiencia Adquirida (VIH y SIDA)

Virus de Inmunodeficiencia Humana y Síndrome de Inmunodeficiencia Adquirida (VIH y SIDA) PS2008_006 V2014 SPA International Confederation of Midwives Virus de Inmunodeficiencia Humana y Síndrome de Inmunodeficiencia Adquirida (VIH y SIDA) Antecedentes El virus de inmunodeficiencia humana (VIH)

Más detalles

versus PCR en Tiempo Real PCR convencional no es cuantitativo

versus PCR en Tiempo Real PCR convencional no es cuantitativo PCR convencional o PCR de punto final versus PCR en Tiempo Real PCR convencional no es cuantitativo S Lobos C - U de Chile 1 PCR clásico La cantidad de producto no está relacionada con la cantidad de DNA

Más detalles

PROCEDIMIENTOS DE BIOLOGÍA MOLECULAR PARA EL ESTUDIO DE LA INFECCIÓN POR EL VIH

PROCEDIMIENTOS DE BIOLOGÍA MOLECULAR PARA EL ESTUDIO DE LA INFECCIÓN POR EL VIH PROCEDIMIENTOS DE BIOLOGÍA MOLECULAR PARA EL ESTUDIO DE LA INFECCIÓN POR EL VIH CURSO DE FORMACIÓN CONTINUADA A DISTANCIA 2011-2012 ACTUALIZACIONES EN EL LABORATORIO CLÍNICO Nº 6 I.S.S.N.- 1988-7477 Título:

Más detalles

Nueva estrategia para optimizar la terapia génica de la ataxia de Friedreich. Sara Pérez-Luz. spluz@cbm.csic.es

Nueva estrategia para optimizar la terapia génica de la ataxia de Friedreich. Sara Pérez-Luz. spluz@cbm.csic.es Nueva estrategia para optimizar la terapia génica de la ataxia de Friedreich Sara Pérez-Luz spluz@cbm.csic.es La ataxia de Friedreich es una enfermedad autosómica recesiva causada por mutaciones en el

Más detalles

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013

PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 PLIEGO DE PRESCRIPCIONES TÉCNICAS CONTRATO DE SUMINISTROS. ADQUISICIÓN DE EQUIPOS Nº EXPEDIENTE: 2/2013 REF/ PROYECTO: PROMIS 2012 NÚMERO DE LOTES: UNICO Este pliego contempla la adquisición de un sistema

Más detalles

Estudio de Costo Efectividad de NAT en México

Estudio de Costo Efectividad de NAT en México Estudio de Costo Efectividad de NAT en México Metodología y Resultados Eleanor Saunders, MSc Consultora Senior en Economía de la Salud TISalud, Mexico Objectivos Presentar la metodología y resultados del

Más detalles

Prevalencia de hepatitis C por reacción en cadena de polimerasa (PCR) en donantes del banco de sangre

Prevalencia de hepatitis C por reacción en cadena de polimerasa (PCR) en donantes del banco de sangre TRABAJOS ORIGINALES Prevalencia de hepatitis C por reacción en cadena de polimerasa (PCR) en donantes del banco de sangre Prevalence of hepatitis C by RT-PCR in donors of the blood bank Yezid Alfonso Farfán,

Más detalles

RapidFinder STEC Detection Workflow

RapidFinder STEC Detection Workflow QUICK REFERENCE RapidFinder STEC Detection Workflow Aislamiento automático de ADN y detección de la PCR en tiempo real de E. coli O157:H7 y cepas "Big 6" de STEC no O157 Número de catálogo 4480466, 4428176,

Más detalles