Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus"

Transcripción

1 Herramientas de laboratorio aplicadas al diagnóstico y el monitoreo del tratamiento de la infección por VIH (Virus Inmunodeficiencia Humana) Fabián Fay CIBIC. Rosario. Argentina

2

3

4 Test de laboratorio para el diagnóstico, pronostico y seguimiento de la infección por HIV Detección de Anticuerpos Anti-HIV EIA Detección de Ag P24 Detección combinada Ag+Ac EIA Detección de Ac- anti-hiv (Western Blot) HIV-RNA cuantitativo (Carga Viral) Detección de HIV-DNA en CMSP Determinación de Resistencia a antiretrovirales Determinación de tropismo viral Test NAT para bancos de sangre

5 Historia Natural de la Infección por HIV-1 Respuesta Inmune Conteo CD4+ ARN HIV-1en Plasma Síntomas Meses Años Nature Medicine (1996) 2:625

6 Evolución natural de la carga viral en un paciente infectado log (copias/ml) Nivel Replicativo de base , Este nivel de replicación obtenido condiciona el pronostico de la evolución hacia SIDA. Tiempo infección (meses) años

7

8 Diagnóstico de HIV Test de screening: Anticuerpo Anti-HIV 3era generación: Ac. Anti HIV 4ta generación: Test combinado: Ac. Anti-HIV + AgP24 HIV HIV RNA Ag P24 Ac- anti-hiv. Exposición HIV RNA P24 Acanti HIV Dias

9 Diagnóstico de HIV HIV RNA Ag P24 Anticuer. ELISA 3 (+) ELISA 4 (COMBINADO) (+) Exposición HIV RNA P24 Ac-anti HIV Dias

10 Algoritmo Diagnóstico Cómo confirmar un Elisa de HIV (+)? Elisa HIV (+) Límite Carga Viral HIV detección 20 UI/ml Anticuerpos Western Blot No define nivel de replicación Decisión de Tratamiento

11 Diagnóstico de HIV Ac- Anti-HIV (+) 3er generación HIV RNA Ag P24 Anticuer. Exposición HIV RNA Western Blot (+) DIAGNOSTICO CONFIRMADO IND REPETIR EN 1 MES (-) FALSO POSITIVO DE ELISA P24 Ac-anti HIV Dias

12 Ac- Anti-HIV (+) 4ta generación HIV RNA Ag P24 Antic. Exposición HIV RN A Diagnóstico de HIV P24 Acanti HIV Dias Western Blot (+) DIAGNOSTICO CONFIRMADO INDETERMINADO O NEGATIVO HACER P24 O CARGA VIRAL (+) SE CONFIRMA EL DIAGNÓSTICO (-) RESULTADO DISCORDANTE RECOMENDACIÓN REPETIR ELISA Y CARGA VIRAL AL MES DE LA PRIMERA MUESTRA

13 Algoritmo Diagnóstico Cómo confirmar un Elisa de HIV (+)? Elisa HIV (+) Carga Viral HIV Límite detección 20 UI/ml Decisión de Tratamiento Ventajas: Sobre la misma muestra del screening se realiza la confirmación de la infección y se estratifica al paciente para definir si se inicia o no el tratamiento. Se minimizan los tiempos de resolución del diagnóstico evitando el drop-out de pacientes para ser tratados.

14 Test de Laboratorio en el seguimiento de pacientes con HIV Test cuantitativos: Parámetros que permiten observar la evolución, definir la decisión terapéutica y evaluar la respuesta a la misma. Son independientes de las características individuales del Huésped y o de la población del virus de HIV que lo infecta. Ejemplos: Carga Viral, Recuento de CD4.

15 Test de Laboratorio en el seguimiento de pacientes con HIV Nuevos Tests: Permiten definir y caracterizar parámetros específicos del Huésped o de la población de Virus de HIV que lo infecta con el objeto de poder tomar decisiones terapéuticas específicas para cada asociación Huésped-Virus Pueden ser utilizados en distintos momentos: previo al inicio de la terapia antiviral o como soporte de las decisiones a tomar una vez instaurada la misma.

16 Test que aportan datos individuales de la relación Huésped - Virus Test que detectan características de la población de Virus infectante: Test de Resistencia (Geno / Fenotipo) Test de Tropismo Trofile TM / Genotropismo Test que definen características específicas del Test que definen características específicas del Huésped: HLA B*5107 TDM para drogas utilizadas en el tratamiento

17 Uso de la carga viral Pronóstico Decisión terapéutica Evaluación de la falla terapeútica Desarrollo de resistencia Eficacia terapéutica Monitoreo respuesta

18 Cuando realizar una Indicación de testeo de Carga Viral de HIV-1 En el momento del diagnóstico y cada 4 meses en los pacientes no tratados Inmediatamente antes de iniciar una terapia antiretroviral. A las 4 semanas de iniciada la terapia para verificar su eficacia. Una vez obtenida una carga viral indetectable, cada 3-4 meses para el seguimiento de la misma. Ante la aparición de eventos clínicos de importancia o disminución marcada de los CD4 +. Para confirmar falla terapéutica luego de obtener valores detectables en pacientes que habían logrado bajar sus niveles de viremia por debajo de 50 copias/ml

19 Métodos Comerciales disponibles RealTime TM HIV-1 m2000rt (Abbott, North Chicago, IL, USA) NucliSENS EasyQ HIV-1 v2.0 (biomerieux; Boxtel, Netherlands) Cobas Taqman (Roche; Pleasanton, CA, USA) CAP/CTM v.2.0 VERSANT HIV-1 RNA 1.0 kinetic PCR (kpcr) / VERSANT bdna (Siemmens, Berkeley California)

20 Límites de detección Rango activo del ensayo Rango activo de medición Límite Detectable de detección pero no cuantificable cuantitativa (Hit rate 95%) 50%) 25 cps/ml (~ 14.4 IU/ml) NucliSENS EasyQ HIV-1 v ,000,000 cps/ml ~ 5,700,000 IU/ml 48 cps/ml (~ 27.3 IU/ml) CAP/CTQ HIV-1 Roche 10,000,000 cps/ml ~ 5,700,000 IU/ml 40 cps/ml (~ 22.8 IU/ml) m2000 real time Abbott 10,000,000 cps/ml ~ 5,700,000 IU/ml 35 cps/ml (~ 21.1 IU/ml) k PCR Versant 11,000,000 cps/ml ~ 6,200,000 IU/ml Carga viral ,000 10, ,000 1,000,000 10,000,000

21 Correlación entre métodos R 2 : En 91% de las muestras las diferencias fueron < 0,5log Taylor et al, Antiviral therapy :

22 Impacto de los subtipos sobre la carga viral HIV-1 Extraordinaria variabilidad genética. Grupo M (Major) 9 Subtipos ( A, B, C, D, F,G, H, J y K) 43 Formas recombinantes Circulantes CRFs (*1) Grupo O (outlier) Variantes N(new), P + del 90% de las infecciones a HIV-1 en el mundo son asociadas a formas no-b (*1, 2) Subtipos circulantes en Argentina: B, F, B/F, C y A * 1 Taylor B, Sobieszczyk M, McCutchan F, Hammer S: The challenge of HIV-1 subtype diversity. N. Engl. J. Med.358, (2008). * 2 Perrin L, Kaiser L, Yerly S: Travel and the spread of HIV-1 genetic variants. Lancet Infect. Dis.3,22-27 (2003).

23 Impacto de los subtipos sobre la carga viral Comparison of the RealTime HIV-1, COBAS TaqMan 48 v1.0, Easy Q v1.2, and Versant v3.0 assays for Determination of HIV-1 Viral Loads in a Cohort of Canadian Patients with Diverse HIV Subtype Infections. JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 2011, p Deirdre Church,1,3,4* Daniel Gregson,1,3,4 Tracie Lloyd,1 Marina Klein,5 Brenda Beckthold,2 Kevin Laupland,1,4 and M. John Gill2,3,4 Calgary Laboratory Services1 and Southern Alberta HIV Clinic,2 Alberta Health Services, and the Departments of Pathology and Laboratory Medicine3 and Medicine,4 University of Calgary, Calgary, Alberta, and the McGill HIV Clinic, McGill University, Montreal, Quebec,5 Canada

24 Impacto de los subtipos sobre la carga viral Estas razones indican la gran importancia en la elección del método a utilizar de acuerdo a los subtipos y formas recombinantes en la región tanto en pacientes naive como tratados. Se deberían realizar estudios comparativos que muestren la correcta cuantificación de dichos métodos para dichas variantes. Todas estas observaciones fortalecen también el hecho de mantener el mismo método para el seguimiento de pacientes tratados, especialmente en el contexto de infecciones por subtipos no-b por las diferencias existentes en estos con los diferentes ensayos.

25 Nuevos métodos de carga viral de HIV PROS Mejora en la sensibilidad y reproducibilidad Menor tiempo de ensayo Disminución de los riesgos de contaminación (extracción cerrada, amplificación-detección en tiempo real en tubo cerrado) Menor volumen de muestra Mayor versatilidad en los flujos de trabajo (8 96 muestras) Otros materiales sobre los que trabajar (DBS, tejidos, fluidos) CONTRAS Costo (el costo de los tratamientos ha bajado, el de la carga viral ha subido) Aspectos técnicos y logísticos para su implementación Provisión de reactivos en tiempo y forma Condiciones correctas para su implementación tecnológica Subcuantificación de subtipos y CRF Variabilidad entre distintos ensayos

26 Que hacer cuando aparece un blip? Carga Viral BLIP ( copias/ml) EVALUAR FALLA TRATAMIENTO Limite de detección 50 copias/ml Seguir frecuencia de seguimiento normal Repetir la carga viral dentro del mes. Descartar fallas de adherencia o procesos que puedan aumentar temporalmente la viremia, En general un blip se resuelve en un nuevo valor no detectable o en un valor mayor. En este último caso, evaluar falla de tratamiento y posible resistencia

27 Nuevos (viejos) objetivos en los test de Carga Viral Significado clínico de valores entre el límite de detección y el límite de cuantificación Capacidad para detectar y cuantificar eficientemente todos los subtipos y formas recombinantes circulantes existentes para evitar subestimaciones y falsos negativos. Seguir mejorando la estandarización respecto de las unidades de referencia para disminuir el impacto del cambio de metodología para un paciente. Medición de CV en otros materiales en forma estandarizada Medición cuantitativa de HIV-DNA proviral

28 Ciclo replicativo del HIV Sitios de acción de los antivirales.

29 Objetivos de la Terapia antiretroviral Suprimir la replicación viral: Disminuir la CV lo máximo posible. En lo posible a niveles indetectables. Mantenerlo así el mayor tiempo posible. Se evitará así la generación de nuevas mutantes, o la propagación de cepas resistentes preexistentes.

30 Efecto de la terapia antiviral Carga viral Presión de la Droga Virus Salvaje (WT) susceptible a la droga Virus mutante Resistente a la droga Tiempo

31 Evolución actual con HAART Carga viral Inicio Terapia CD4/mm3 Nivel de detección tiempo

32 Desarrollo de Resistencia Capacidad del virus de cambiar hacia una forma poblacional que mejora o incrementa su capacidad para replicarse en presencia de inhibidores de dicha replicación. Inicio de Tratamiento Quasiespecies susceptibles a la Droga Quasispecies resistentes a la Droga Carga Viral Supresión Incompleta Potencia Inadecuada Niveles de droga inadecuados Falta de adherencia Resistencia Pre-existentes Selección de quasiespecies resistentes Tiempo

33 Desafíos de la Resistencia a drogas en el HIV HIV se puede volver resistente a todas las drogas disponibles. La replicación de variantes resistentes a drogas lleva al paciente a la falla de tratamiento. Durante la falla de tratamiento, el HIV desarrolla patrones de mutación complejos que causa en muchos casos resistencias cruzadas e imposibilita el uso de otras drogas. Los virus resistentes a drogas pueden ser transmitidos a otros pacientes complicando su tratamiento inicial, dispersando las variantes resistentes en la población (aumento de la resistencia poblacional primaria) Si bien tratamientos de rescate pueden volver a suprimir la replicación viral, las variantes resistentes persisten en reservorios virales (santuarios) y pueden re-emerger en condiciones favorables para su replicación.

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina

APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR. Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina APLICACIONES DEL LABORATORIO DE BIOLOGIA MOLECULAR Javier Sfalcin Líder de Biología Molecular CIBIC - Rosario - Argentina BiologÍa Molecular: es una disciplina que se enfoca principalmente en el estudio

Más detalles

PORQUE BUSCAMOS LA HEPATITIS C?

PORQUE BUSCAMOS LA HEPATITIS C? PORQUE BUSCAMOS LA HEPATITIS C? ESTE INDIVIDUO TIENE HCV? ESTA PERSONA (POTENCIAL DONANTE DE SANGRE) PUEDE ESTAR EXPUESTO A HCV? QUE EFECTOS TIENE LA INFECCION POR HCV EN EL HIGADO? CUAL ES LA PROBABILIDAD

Más detalles

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia.

Perinatal Transmisión al bebé, durante el embarazo, parto o lactancia. Dr. Horacio Salomón Investigador Principal del CONICET Director del INBIRS (Ex-CNRSIDA) UBA-CONICET Contacto sexual Relaciones sexuales sin protección por contacto directo con fluidos corporales como secreciones

Más detalles

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009

NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV. Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 NOCIONES DE EPIDEMIOLOGÍA Y DIAGNOSTICO DE HIV Dra G Carballal Laboratorio de Virología Clínica CEMIC, 2009 La Pandemia de SIDA Personas que viven con el HIV/SIDA Total 40 millones Adultos 38 Niños 2 Nuevas

Más detalles

Estrategia utilizada

Estrategia utilizada Estrategia utilizada 1) Extracción HIV RNA V3 7114 7218 2) One Step RT-PCR (x triplicado) 3) 2 nd PCR (A1 A2 A3) A1 A2 A3 4) Secuencuiación A1 A2 A3 TGTACAAGACCCAACAACAATACAAGAAAAAGTATACATGTAGGACG AGGGAGATCAATTTATGCAACAGAAAAAATAATAGGAGATACAAAAC

Más detalles

Algoritmos diagnósticos para VIH

Algoritmos diagnósticos para VIH Algoritmos diagnósticos para VIH ALGORITMOS DIAGNÓSTICOS PARA VIH Los avances tecnológicos de los distintos ensayos para el tamizaje y diagnóstico de la infección por VIH, conjuntamente con la necesidad

Más detalles

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS

INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS INTERPRETACION DE LOS RESULTADOS DE LA HEPATITIS VIRALES EN ADULTOS S. Microbiología Hospital General Universitario de Elche Abril 2009 HEPATITIS A INTRODUCCION La principal característica diferencial

Más detalles

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio

Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio Reducción de la transmisión vertical del VIH en Colombia. Proyecto Madre-Hijo. Diagnóstico y seguimiento por laboratorio El VIRUS PRUEBAS PRESUNTIVAS ELISA: es la prueba convencional para la detección

Más detalles

Diagnóstico microbiológico de la infección por HIV

Diagnóstico microbiológico de la infección por HIV Diagnóstico microbiológico de la infección por HIV Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Alicante E-mail: rodriguez_juadia@gva.es http://microbiología-alicante.umh.es

Más detalles

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica

PRUEBA DE VIH. Universidad de Panamá USAID Proyecto Capacity Centroamérica PRUEBA DE VIH Universidad de Panamá USAID Proyecto Capacity Centroamérica Es la prueba de detección que produce los resultados rápidamente, en aproximadamente 20 minutos y utiliza sangre de una vena o

Más detalles

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS

6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS 6 INFECCIÓN POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH) Y SIDA. TRATAMIENTO Y PREVENCIÓN DE LAS INFECCIONES OPORTUNISTAS ASOCIADAS Introducción.................... 663 Clasificación de la infección

Más detalles

Facultad de Ciencias Bioquímicas y Farmacéuticas Área de Integración n Disciplinar y Estudio de la Problemática Profesional TPP I Unidad 2 Aspectos biológicos del VIH Algunos datos importantes 1959 Se

Más detalles

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007

Problemas en el Diagnostico de la Infección VIH. Diplomado de Atención Integral del VIH-SIDA. 2007 Problemas en el Diagnostico de la Infección VIH Diplomado de Atención Integral del VIH-SIDA. 2007 Algunas Generalidades Sub - tipos del VIH y pruebas de laboratorio Analogía del VIH 1 y 2 es de: 40-60%

Más detalles

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt

Rol del Laboratorio en el Diagnóstico. CMV en pacientes transplantados. Bioquímica Mariela Merkt Rol del Laboratorio en el Diagnóstico y Prevención n de la Infección n por CMV en pacientes transplantados Bioquímica Mariela Merkt CMV: Características Familia β Herpesviridae DNA doble cadena Virus envuelto

Más detalles

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas

Pruebas rápidas r. Estrategias preventivas. Propuesta de nuevas estrategias preventivas XV ENCUENTRO ESTATAL PARA ONG s Madrid, 1-3 de Octubre 2009 Diagnóstico tardío o. Pruebas rápidas r Dra Carmen Rodríguez Centro Sanitario Sandoval Madrid Estrategias preventivas La prevención de nuevas

Más detalles

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema

INTRODUCIÓN. Los datos de la distribución geográfica quedarían distribuidos según el siguiente esquema INTRODUCIÓN Hagamos un repaso de los datos recogidos en la bibliografía. Infección por VHC: Infección crónica por VHC afecta al 3% de la población mundial Incidencia de infección aguda: 1/100.000 habitantes

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires OBJETIVO DETECTAR Y DESCARTAR PRECOZMENTE UNIDADES DE SANGRE DE DONANTES CON VIREMIA PARA HIV, HBV Y HCV, CON PRUEBAS SEROLÓGICAS

Más detalles

CONVENIO 036 de 2012

CONVENIO 036 de 2012 CONVENIO 036 de 2012 Guía de Práctica Clínica basada en la evidencia científica para la atención integral del VIH/Sida en niñas y niños. Guía de práctica clínica basada en la evidencia científica para

Más detalles

5-MARCO DE REFERENCIA

5-MARCO DE REFERENCIA 5-MARCO DE REFERENCIA Para hablar de pruebas diagnosticas es necesario el conocimiento de ciertos términos que a continuación se describen. Sensibilidad: Es la probabilidad de obtener una prueba positiva

Más detalles

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia

8 Congreso Argentino de Salud Integral del Adolescente. Dr. Eduardo Rubinstein. Hospital Francisco J. Muñiz Adolescencia 8 Congreso Argentino de Salud Integral del Adolescente Dr. Eduardo Rubinstein Hospital Francisco J. Muñiz Adolescencia VIH EN ADOLESCENTES: QUE HAY DE NUEVO? En diagnóstico de infección por VIH En seguimiento

Más detalles

ESTUDIOS DE POBLACIONES Y SUBPOBLACIONES LINFOCITARIAS POR CMF

ESTUDIOS DE POBLACIONES Y SUBPOBLACIONES LINFOCITARIAS POR CMF ESTUDIOS DE POBLACIONES Y SUBPOBLACIONES LINFOCITARIAS POR CMF Dra. Mónica Saracco Instituto de Investigaciones Biomédicas en Retrovirus y SIDA (ex CNRS) Aplicaciones Clínicas Analisis de subpoblaciones

Más detalles

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar

Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B. Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar Herramientas para el diagnóstico, seguimiento y tratamiento en Hepatitis B Fabián Fay CIBIC Rosario Argentina ffay@cibic.com.ar HBV - Marcadores Serológicos HBsAg: Antígeno de Superficie Anti-HBc (total):

Más detalles

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida

PRUEBA RAPIDA EN EMBARAZADAS (n=62,214 2009-Junio 2010) NO REACTIVO n=218 REACTIVO INDETERMINADO. Tabla 9: Resultados Prueba rápida 11-RESULTADOS 11.1-Interpretación y análisis de resultados Un total de de 62,214 mujeres embarazadas se realizaron la prueba rápida de VIH durante años 2009 hasta junio 2010 (Tabla 9). De ellas, 61,808

Más detalles

PERFIL DE LOS NUEVOS CABA 2010-2011

PERFIL DE LOS NUEVOS CABA 2010-2011 PERFIL DE LOS NUEVOS DIAGNÓSTICOS CABA 2010-2011 Distribución de las notificaciones según sexo y estadio clínico al momento del diagnóstico CABA 2010-2011 Estadio % mujeres % hombres SRA 1,9 1,8 Asintomático

Más detalles

11.2-DISCUSIÓN Prueba rápida

11.2-DISCUSIÓN Prueba rápida 11.2-DISCUSIÓN Prueba rápida Como se observa en la tabla 9 del total de las embarazadas (62,214) a las que se les realizo la prueba rápida un 99.3%(61,808) de ellas dio como resultado no reactivo, tan

Más detalles

PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO

PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO PCR EN TIEMPO REAL, UNA HERRAMIENTA EN EL PACIENTE TRASPLANTADO Dra. Carolina Rodríguez Laboratorio Dr. Stamboulian División Biología Molecular Introducción En la actualidad, el paciente trasplantado,

Más detalles

Diversidad Genética del VIH: Importancia para la Salud Pública Global

Diversidad Genética del VIH: Importancia para la Salud Pública Global Diversidad Genética del VIH: Importancia para la Salud Pública Global Alvaro Carrascal, MD, MPH Director, División de Atención de Salud Instituto del SIDA Departamento de Salud del Estado de Nueva York

Más detalles

Como interpretar las pruebas de serología hepatica

Como interpretar las pruebas de serología hepatica Introducción Para descartar en un paciente la presencia de infección viral se deben determinar exclusivamente el antígeno de superficie del virus de la hepatitis B (VHB) (HbsAg) y los anticuerpos frente

Más detalles

Nuevo algoritmo diagnóstico de la Infección por VIH

Nuevo algoritmo diagnóstico de la Infección por VIH Nuevo algoritmo diagnóstico de la Infección por VIH Dra. Manuelita Zavala Pineda Médico Adscrito Servicio Infectología Hospital General de México Dr. Eduardo Liceaga Marcadores inmunológicos y virológicos

Más detalles

Propuesta de nuevos algoritmos para el diagnóstico de VIH

Propuesta de nuevos algoritmos para el diagnóstico de VIH Propuesta de nuevos algoritmos para el diagnóstico de VIH Propuesta de nuevos algoritmos para el diagnóstico de VIH Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas

Más detalles

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica

Blga. Gisely Hijar Guerra. Responsable de los Procesos de la Prueba de Genotipificación de VIH Centro Nacional de Salud Publica Genotipificación de VIH en el INS: técnica local y técnicas convencionales Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. lar Responsable de los Procesos

Más detalles

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH

PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH PROCEDIMIENTO DE LABORATORIO PARA LA PRUEBA DE GENOTIPIFICACIÓN DEL VIH Blga. Gisely Hijar Guerra Coordinación del Laboratorio de Biotecnología y Biología Molecular. Responsable de los Procesos de la Prueba

Más detalles

Diagnóstico microbiológico de la infección por el VIH. Procedimientos en Microbiología Clínica

Diagnóstico microbiológico de la infección por el VIH. Procedimientos en Microbiología Clínica Procedimientos en Microbiología Clínica Recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica 6b Diagnóstico microbiológico de la infección por el VIH Editores Coordinador

Más detalles

IMPORTANCIA DEL LABORATORIO EN EL DIAGNÓSTICO Y SEGUIMIENTO DE LA INFECCIÓN VIH. María Delgado Yagüe Resindente de M. Interna H.U.F.

IMPORTANCIA DEL LABORATORIO EN EL DIAGNÓSTICO Y SEGUIMIENTO DE LA INFECCIÓN VIH. María Delgado Yagüe Resindente de M. Interna H.U.F. IMPORTANCIA DEL LABORATORIO EN EL DIAGNÓSTICO Y SEGUIMIENTO DE LA INFECCIÓN VIH María Delgado Yagüe Resindente de M. Interna H.U.F.A DIAGNÓSTICO IMPORTANCIA DEL LABORATORIO EN EL DIAGÓSTICO DE LA INFECCIÓN

Más detalles

Algoritmos y actualizaciones en el diagnóstico de las Hepatitis en el Laboratorio. Marta Morito Aguilar. Residente 2º año. Área de laboratorio.

Algoritmos y actualizaciones en el diagnóstico de las Hepatitis en el Laboratorio. Marta Morito Aguilar. Residente 2º año. Área de laboratorio. Algoritmos y actualizaciones en el diagnóstico de las Hepatitis en el Laboratorio Marta Morito Aguilar. Residente 2º año. Área de laboratorio. Introducción. - Es una enfermedad inflamatoria que afecta

Más detalles

PRINCIPIO DE LA PRUEBA: USO PREVISTO:

PRINCIPIO DE LA PRUEBA: USO PREVISTO: ESPECIFICACIONES DEL KIT: Cat. No Cantidad Reactivo Almacenamiento ADRT0011 1 x 20 PRUEBAS 1 x 3 ml Diluente USO PREVISTO: HIV 2-30 C El HIV-1/2 Plus Combo Rapid Test es un inmunoensayo de flujo lateral

Más detalles

FeLV Ag / FIV Ab Test Kit

FeLV Ag / FIV Ab Test Kit SensPERT FeLV Ag / FIV Ab Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz.

Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz. Autores Bioq. María Belén Bouzas Jefa de División Análisis Clínicos. Hospital de Infecciosas Francisco Muñiz. Bioq. Analia Cudola Jefa de Departamento Laboratorio Central. Ministerio de Salud Pública de

Más detalles

ARTÍCULO ORIGINAL REPRODUCIBILITY OF A QUANTIFICATION ASSAY, NUCLISENS HIV - 1 QT, IN HIV POSITIVE PLASMA SAMPLES

ARTÍCULO ORIGINAL REPRODUCIBILITY OF A QUANTIFICATION ASSAY, NUCLISENS HIV - 1 QT, IN HIV POSITIVE PLASMA SAMPLES Rev Chil Infect (2002); 19 (1): 25-31 ARTÍCULO ORIGINAL Estudio de reproducibilidad del examen de cuantificación de VIH-1 por la técnica Nuclisens HIV-1 QT en muestras de plasma de pacientes infectados

Más detalles

ALGORITMOS CLINICA DE ENFERMEDADES INFECCIOSAS REVISTA CIENTIFICA NÚMERO 7 VOLUMEN 3 JULIO-SEPTIEMBRE 2015 1

ALGORITMOS CLINICA DE ENFERMEDADES INFECCIOSAS REVISTA CIENTIFICA NÚMERO 7 VOLUMEN 3 JULIO-SEPTIEMBRE 2015 1 ALGORITMOS REVISTA CIENTIFICA NÚMERO 7 VOLUMEN 3 JULIO-SEPTIEMBRE 2015 1 Elaborado por: Licda. Leticia García, Enfermera Profesional / Licda. Claudia Rodríguez, Química Farmacéutica. REVISTA CIENTIFICA

Más detalles

FAMILIA RETROVIRIDAE. Prof. Adj. Dra. Dora Ruchansky Departamento de Bacteriologia y Virología Instituto de Higiene - Facultad de Medicina Abril 2010

FAMILIA RETROVIRIDAE. Prof. Adj. Dra. Dora Ruchansky Departamento de Bacteriologia y Virología Instituto de Higiene - Facultad de Medicina Abril 2010 FAMILIA RETROVIRIDAE Prof. Adj. Dra. Dora Ruchansky Departamento de Bacteriologia y Virología Instituto de Higiene - Facultad de Medicina Abril 2010 FAMILIA SUBFAMILIA GENERO EJEMPLOS Retroviridae Orthoretrovirinae

Más detalles

HEPATITIS C, EPIDEMIA SILENTE

HEPATITIS C, EPIDEMIA SILENTE PILDORAS EPIDEMIOLOGICAS Hepatitis C en el Mundo Se estima una prevalencia de 200 millones de portadores a nivel mundial con una mortalidad anual de 350 mil personas como consecuencia del efecto crónico

Más detalles

Diagnóstico Serológico de Sífilis Técnicas treponémicas

Diagnóstico Serológico de Sífilis Técnicas treponémicas Diagnóstico Serológico de Sífilis Técnicas treponémicas T.M. Rodrigo Colina Morales Laboratorio de Infecciones de Transmisión Sexual Sección Bacteriología Mayo 2014 FTA-ABS (Fluorescent Treponemal Antibody

Más detalles

http://youtu.be/j8bl3jmfg4g

http://youtu.be/j8bl3jmfg4g http://youtu.be/j8bl3jmfg4g El VIH -1 entra a la célula del huésped al ligarse con el receptor CD4. Luego interacciona con las citoquinas ya sea del - co- receptor CCR5 predominantemente, - o el CXCR4

Más detalles

SEGUIMIENTO CLÍNICO Y ANALÍTICO DEL PACIENTE VIH. VACUNACIONES PREVENCIÓN Y MANEJO DE LAS COMORBILIDADES EN EL VIH

SEGUIMIENTO CLÍNICO Y ANALÍTICO DEL PACIENTE VIH. VACUNACIONES PREVENCIÓN Y MANEJO DE LAS COMORBILIDADES EN EL VIH SEGUIMIENTO CLÍNICO Y ANALÍTICO DEL PACIENTE VIH. VACUNACIONES PREVENCIÓN Y MANEJO DE LAS COMORBILIDADES EN EL VIH Pilar Vázquez Rodríguez Servicio de M. Interna B Complejo Hospitalario Universitario de

Más detalles

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C

Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C Nuevos ensayos moleculares de la tecnología SUMA para el diagnóstico de las hepatitis B y C MSc. Anny Armas Cayarga Laboratorio de Biología Molecular Centro de Inmunoensayo Octubre 16, 2015 Qué es el diagnóstico

Más detalles

infección por el virus.

infección por el virus. Utilización de distintos reactivos y metodologías para el estudio de Anticuerpos anti HTLV- I/II en donantes de sangre José, A. (*); Orofino, M. T. (*); Murlo, P. (**); García, C. (**) (*) Bioquímica.

Más detalles

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR)

METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) METODOLOGÍAS UTILIZADAS EN INVESTIGACIÓN BÁSICA Y APLICADA REACCION EN CADENA DE LA POLIMERASA (PCR) Centro de de Microscopía Electrónica Facultad de de Ciencias Médicas Universidad Nacional de de Córdoba

Más detalles

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt

Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Nadia Isabel Hornquist Hurtarte Química Bióloga Clínica de Enfermedades Infecciosas Hospital Roosevelt Fase aguda: Entre el 40% a 90% sintomáticos (similar mononucleosis) Fase crónica: asintomaticos El

Más detalles

Diagnóstico microbiológico de la infección por el VIH

Diagnóstico microbiológico de la infección por el VIH REVISIÓN Diagnóstico microbiológico de la infección por el VIH Juan Carlos López-Bernaldo de Quirós a, Rafael Delgado b, Federico García c, José M.ª Eiros d y Raúl Ortiz de Lejarazu d a Servicio de Microbiología.

Más detalles

INSTRUCTIVO PARA GESTION DE MEDICACIÓN ESPECIAL:

INSTRUCTIVO PARA GESTION DE MEDICACIÓN ESPECIAL: 20 Manual para Procedimientos, Dispositivos y Medicación SUR Form. C.1.1.1. Se informa a Ud. que, con el fin de realizar la solicitud de Efavirenz (EFV) / Nevirapina (NVP) / Abacavir (ABC) / Lamivudina

Más detalles

Pruebas de bajo costo para el seguimiento al tratamiento de VIH

Pruebas de bajo costo para el seguimiento al tratamiento de VIH Pruebas de bajo costo para el seguimiento al tratamiento de VIH (Economical assays for monitoring HIV-1 treatment) Lisa Frenkel Profesora de Pediatria y Medicina del Laboratorio Marzo 2010 Uso de pruebas

Más detalles

Cualitativos Caso de Aplicación

Cualitativos Caso de Aplicación Validación n de Métodos M Cualitativos Caso de Aplicación Agenda Introducción Definiciones Clasificación Validación Evaluación de Métodos Cualitativos Caso de Aplicación Conclusiones Introducción La validación

Más detalles

MUTAGÉNESIS LETAL COMO NUEVA ESTRATEGIA ANTIVIRAL. Investigador principal: Miguel Ángel Martínez de la Sierra. Centro: Fundació irsicaixa

MUTAGÉNESIS LETAL COMO NUEVA ESTRATEGIA ANTIVIRAL. Investigador principal: Miguel Ángel Martínez de la Sierra. Centro: Fundació irsicaixa MUTAGÉNESIS LETAL COMO NUEVA ESTRATEGIA ANTIVIRAL Investigador principal: Miguel Ángel Martínez de la Sierra Centro: Fundació irsicaixa Duration: 3 years MEMORIA FINAL 1. Resumen del proyecto La variabilidad

Más detalles

EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA

EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA EVOLUCIÓN DEL VIRUS DE LA INMUNODEFICIENCIA HUMANA (VIH-1): MUTACIONES REVERTANTES EN EL GEN DE LA TRANSCRIPTASA REVERSA Liliana Gómez Flores Ramos 1, Martha Escoto Delgadillo 2, Eduardo Vázquez Valls

Más detalles

Bioq. María Elina Acevedo Biología Molecular Fundación Hemocentro Buenos Aires Tamizaje de infecciones transmisibles por transfusión en Argentina (Ley 22.990 - Ley Nacional de Sangre ) HVB: Enzimoinmunoensayos

Más detalles

Procedimientos en Microbiología Clínica. Recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica

Procedimientos en Microbiología Clínica. Recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica Procedimientos en Microbiología Clínica Recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica 6a. Diagnóstico microbiológico de la infección por el VIH 2 0 0 6 Editores:

Más detalles

Investigador principal: Dr. Jordi Casabona Barbarà. Centro: Hospital Universitari Germans Trias i Pujol. Duración: 3 años MEMORIA FINAL. 1.

Investigador principal: Dr. Jordi Casabona Barbarà. Centro: Hospital Universitari Germans Trias i Pujol. Duración: 3 años MEMORIA FINAL. 1. CUANTIFICACIÓN Y CARACTERIZACIÓN EPIDEMIOLÓGICA DE LOS SEROCONVERSORES POR EL VIH A TRAVÉS DE LA TÉCNICA SEROLOGICAL TESTING ALGORITHM FOR RECENT HIV SEROCONVERSION (STARHS) Investigador principal: Dr.

Más detalles

Guía de Detecció n y Diagnó sticó Integral de VIH/SIDA

Guía de Detecció n y Diagnó sticó Integral de VIH/SIDA Guía de Detecció n y Diagnó sticó Integral de VIH/SIDA Ciudad de México, 2011 Guía de Detección y Diagnóstico Integral de VIH/SIDA - 1 - Índice Antecedentes 3 Objetivos 5 Definiciones operativas 5 Resumen

Más detalles

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela

Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de Santiago de Compostela PACIENTE CON SINDROME MENINGEO Y EXANTEMA Caso presentado por: E. Losada, A. Antela, A. Prieto. Unidad de Enfermedades Infecciosas. Servicio de Medicina Interna. Complejo Hospitalario Universitario de

Más detalles

Qué es calidad de vida

Qué es calidad de vida Cuando nos encontramos frente a un diagnóstico de una enfermedad crónica y posteriormente peligrosa para la vida, esto nos lleva a realizar cambios que nos permitan enfrentar la enfermedad y conservar

Más detalles

Nuevos enfoques diagnósticos de la infección por VIH

Nuevos enfoques diagnósticos de la infección por VIH Nuevos enfoques diagnósticos de la infección por VIH Santiago Estrada M.D Laboratorio Clínico VID Agosto 28 de 2015 Hoja informativa para los pacientes que solicitan una prueba de VIH Recomendaciones para

Más detalles

INFORME VIH - SIDA COMUNITAT VALENCIANA

INFORME VIH - SIDA COMUNITAT VALENCIANA INFORME VIH - SIDA COMUNITAT VALENCIANA VIGILANCIA EPIDEMIOLÓGICA AÑO 2014 RESPONSABLE DE LA EDICIÓN: Dirección General de Salud Pública. Avda. Cataluña, 21 46020 Valencia http://www.sp.san.gva.es/epidemiologia

Más detalles

Pruebas serológicas para dengue

Pruebas serológicas para dengue Pruebas serológicas para dengue El 40% de la población mundial corre riesgo de infección por dengue Durante más de 25 años, Focus Diagnostics ha sido un líder en el desarrollo de ensayos inmunológicos

Más detalles

Seguridad transfusional

Seguridad transfusional Bioquímica. Adriana Alter Noviembre 2013 Seguridad transfusional Criterios de transfusión Control Agentes emergentes Evitar descarte Seguridad transfusional Medidas Donantes de Repetición y Voluntarios

Más detalles

PCR en Tiempo Real. Introducción

PCR en Tiempo Real. Introducción Introducción Página 1 de 6 Introducción general La reacción en cadena de la polimerasa, cuyas iniciales en inglés son PCR ("polymerase chain reaction"), es una técnica que fue desarrollada por Kary Mullis

Más detalles

«Claves» en la salud de personas con VIH Enfoque de seguimiento para una atención integral

«Claves» en la salud de personas con VIH Enfoque de seguimiento para una atención integral «Claves» en la salud de personas con VIH Enfoque de seguimiento para una atención integral Dra. Zaida Arteta Dalchiele Prof. Adj. Enfermedades Infecciosas Clave 1: Diagnóstico precoz Normalizar la prueba

Más detalles

TM CLAUDIO MIRANDA Sección SIDA. BQ. EUGENIO RAMIREZ Sección Virus Oncogénicos. TM LILIAN VERA D. Sección Virus Hepáticos y Emergentes

TM CLAUDIO MIRANDA Sección SIDA. BQ. EUGENIO RAMIREZ Sección Virus Oncogénicos. TM LILIAN VERA D. Sección Virus Hepáticos y Emergentes TALLER PARA EL ANALISIS DE RESULTADOS PEEC HBsAg, VHC, Ac- anti VIH y HTLV I/II TM CLAUDIO MIRANDA Sección SIDA BQ. EUGENIO RAMIREZ Sección Virus Oncogénicos TM LILIAN VERA D. Sección Virus Hepáticos y

Más detalles

DIAGNÓSTICO Y TRATAMIENTO DE LAS INFECCIONES POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA TIPO 2

DIAGNÓSTICO Y TRATAMIENTO DE LAS INFECCIONES POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA TIPO 2 DIAGNÓSTICO Y TRATAMIENTO DE LAS INFECCIONES POR EL VIRUS DE LA INMUNODEFICIENCIA HUMANA TIPO 2 Carmen Maroto Vela, Carmen Bernal Zamora y Fe García García Departamento de Microbiología. Facultad de Medicina.

Más detalles

PAREJAS SERODISCORDANTE

PAREJAS SERODISCORDANTE PAREJAS SERODISCORDANTE Las parejas serodiscordantes son aquellas en las que uno de los dos miembros es seropositivo al virus de la inmunodeficiencia humana (VIH). La elevada incidencia del VIH en pacientes

Más detalles

RESUMEN EJECUTIVO EN ESPAÑOL

RESUMEN EJECUTIVO EN ESPAÑOL RESUMEN EJECUTIVO EN ESPAÑOL Guía de Práctica Clínica para la prevención, diagnóstico, evaluación y tratamiento de la Hepatitis C en enfermedad renal crónica Page 1 of 8 GUIA 1: DETECCIÓN Y EVALUACIÓN

Más detalles

Nuevo algoritmo diagnóstico en la infección por VIH

Nuevo algoritmo diagnóstico en la infección por VIH Nuevo algoritmo diagnóstico en la infección por VIH Perspectiva de la nueva guía colombiana de adultos SANDRA LILIANA VALDERRAMA B. Médica Infectóloga. Universidad Nacional Hospital Universitario San Ignacio,

Más detalles

CARACTERIZACIÓN FENOTÍPICA Y MOLECULAR DE LOS LINFOMAS NO HODGKINIANOS ASOCIADOS AL SIDA A TRAVÉS DE TÉCNICAS DE TISSUE MICROARRAYS

CARACTERIZACIÓN FENOTÍPICA Y MOLECULAR DE LOS LINFOMAS NO HODGKINIANOS ASOCIADOS AL SIDA A TRAVÉS DE TÉCNICAS DE TISSUE MICROARRAYS CARACTERIZACIÓN FENOTÍPICA Y MOLECULAR DE LOS LINFOMAS NO HODGKINIANOS ASOCIADOS AL SIDA A TRAVÉS DE TÉCNICAS DE TISSUE MICROARRAYS Investigador principal: José Luis Mate Sanz Centro: Hospital Universitari

Más detalles

Hepatitis viral tipo C (HCV) RT-PCR

Hepatitis viral tipo C (HCV) RT-PCR Hepatitis viral tipo C (HCV) RT-PCR Celía, Alejandro Fabián Taborda, Florencia Ines Características Generales del HCV Agente etiológico de las HNANB transmitidas por transfusiones Flia: Flaviviridae Género:

Más detalles

Pablo Galindo Orrego. Residente Medicina Interna. Universidad de La Sabana, Bogotá 2012.

Pablo Galindo Orrego. Residente Medicina Interna. Universidad de La Sabana, Bogotá 2012. RESISTENCIAS DEL VIH POR GENOTIPIFICACIÓN Y CARACTERISTICAS ASOCIADAS, EN PACIENTES SIN EXPOSICIÓN PREVIA A TRATAMIENTO ANTIRRETROVIRAL-TAR (NAÏVE o VÍGENES A TRATAMIENTO), BAJO ATENCIÓN INTEGRAL ESPECIALIZADA

Más detalles

Interpretación de resultados

Interpretación de resultados Interpretación de la serología en las hepatitis virales Domingo Sánchez Sendín y Pedro Nogales Aguado Centro de Salud Las Águilas. Área 7. Madrid. España.? Es útil la serología para diagnosticar las hepatitis

Más detalles

VIH / sida prevención y atención sanitaria P R O C E S O S Definición funcional Proceso que tras la identificación de una situación o práctica de riesgo, conduce a: La programación de medidas preventivas

Más detalles

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES

GUIAS DE ATENCION EN VIH SIDA. Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES GUIAS DE ATENCION EN VIH SIDA Madeleyne Jaramillo Zapata Enfermera, Universidad de Antioquia Mg. En Administración en salud, Universidad CES VIH en cifras En 2011, el Programa de las Naciones Unidas sobre

Más detalles

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT

Canine Parvovirus Test Kit. SensPERT CONCEPTO SENSPERT SensPERT Canine Parvovirus Test Kit CONCEPTO SENSPERT La línea de diagnóstico SensPERT de Rapid Test proporciona una solución rápida, específica y fiable para los médicos veterinarios en su práctica clínica

Más detalles

Universidad Nacional de Rosario - Facultad de Ciencias MédicasM

Universidad Nacional de Rosario - Facultad de Ciencias MédicasM Universidad Nacional de Rosario - Facultad de Ciencias MédicasM Cátedra de Microbiología, Virología a y Parasitología HIV - Área Injuria - 2015 HTLV HIV Genero: Deltaretrovirus HTLV-1 y HTLV2 (Virus linfotrofico

Más detalles

SIDA EN AFRICA. África Holguín 5 Abril 2016

SIDA EN AFRICA. África Holguín 5 Abril 2016 SIDA EN AFRICA África Holguín 5 Abril 2016 DESDE ABRIL 2008. SUBPROGRAMA DE INMIGRACIÓN Y SALUD. GRUPO 33 TRABAJAMOS EN VARIABILIDAD GENÉTICA DEL VIH (desde 1994) DIFICULTA CONTROL VIH: resistencias, escape

Más detalles

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche

Hepatitis virales. Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis virales Juan Carlos Rodríguez Díaz S. Microbiología Hospital General Universitario de Elche Hepatitis Características generales Es un proceso asociado a muchas causas, tanto infecciosas como

Más detalles

CASO CLINICO: ELISA. Inmunología Clínica 2009

CASO CLINICO: ELISA. Inmunología Clínica 2009 CASO CLINICO: ELISA Inmunología Clínica 2009 Qué sabemos sobre la estructura del virus de la Hepatitis B? Acerca de la genotipificación. 7 genotipos, A-G. Su prevalencia difiere geográficamente, con genotipos

Más detalles

POR QUÉ YA NO SE RECOMIENDA ESPERAR 3 MESES PARA HACERSE LA PRUEBA DEL VIH?

POR QUÉ YA NO SE RECOMIENDA ESPERAR 3 MESES PARA HACERSE LA PRUEBA DEL VIH? QUÉ ES LA PRUEBA DEL VIH? La prueba del VIH es la única forma fiable de saber si una persona está o no infectada por el VIH, el virus del sida. Las pruebas de diagnóstico del VIH que se emplean habitualmente

Más detalles

Un centro de biotecnología al servicio de la salud

Un centro de biotecnología al servicio de la salud Tecnologías para la Vida S. de R.L. de C.V. En búsqueda del bienestar humano Un centro de biotecnología al servicio de la salud Mexicali, Baja California, México Septiembre de 2012 Tecnologías para la

Más detalles

Virus Hepatitis B. Confirmación HBsAg

Virus Hepatitis B. Confirmación HBsAg Virus Hepatitis B Confirmación HBsAg Dr. Eliecer Villagra Cornejo Sección Virus Hepáticos y Emergentes Subdepartamento Enfermedades Virales Laboratorio Biomédico Nacional de Referencia. Virus Hepatitis

Más detalles

El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes

El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes El 33% de las casi 1.000 infecciones por VIH en HSH detectadas en BCN Checkpoint son infecciones recientes F. Pujol, F. Pérez, A. Dalmau-Bueno, J. Saz, H. Taboada, G. Marazzi, A. Pérez, A. Carrillo, A.

Más detalles

ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA

ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA ACTUALIZACIÓN EN DENGUE Y CHIKUNGUNYA Diagnóstico de las infecciones por DENV y CHIKV María Gabriela Barbás Bioq. Esp.en Virología Jefa del Servicio Bioquímico Laboratorio Central de la Provincia de Córdoba

Más detalles

ORGANISMO ANDINO DE SALUD CONVENIO HIPÓLITO UNANUE (ORAS CONHU)

ORGANISMO ANDINO DE SALUD CONVENIO HIPÓLITO UNANUE (ORAS CONHU) 2007 ORGANISMO ANDINO DE SALUD CONVENIO HIPÓLITO UNANUE (ORAS CONHU) Dr. Juan F. Villacorta Santamato Situación de los Reactivos para diagnóstico del VIH y para el seguimiento de las personas que reciben

Más detalles

Los objetivos de las terapias contra VIH se centran en:

Los objetivos de las terapias contra VIH se centran en: I N T R O D U C C I Ó N Una vez que se identificó al VIH como causante del Síndrome de Inmunodeficiencia Adquirida (SIDA), el principal objetivo científico se convirtió en la búsqueda de algún medio para

Más detalles

DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ

DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ DIAGNÓSTICO DE LABORATORIO DE DENGUE EN PANAMÁ TM Brechla Moreno A. Instituto Conmemorativo Gorgas de Estudios de la Salud, Panamá Departamento de Virología y Biotecnología 2013 TÉCNICAS PARA LA DETECCIÓN

Más detalles

Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral

Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral Utilidad de distintos marcadores para el manejo de antirretrovirales: carga viral Consuelo Viladés Laborda Servicio de Medicina Interna, Hospital Universitario de Tarragona Joan XXIII, Tarragona Introducción

Más detalles

PREGUNTAS MAS FRECUENTES, A LOS EXPERTOS DEL SERVICIO TELEFONO VERDE AIDS (800 861061) DEL INSTITUTO SUPERIORE DI SANITA

PREGUNTAS MAS FRECUENTES, A LOS EXPERTOS DEL SERVICIO TELEFONO VERDE AIDS (800 861061) DEL INSTITUTO SUPERIORE DI SANITA PREGUNTAS MAS FRECUENTES, A LOS EXPERTOS DEL SERVICIO TELEFONO VERDE AIDS (800 861061) DEL INSTITUTO SUPERIORE DI SANITA P. Cuales son las pruebas que debo hacerme para saber si tengo la infección del

Más detalles

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional

Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional Aplicaciones de las Técnicas de Detección de Ácidos Nucléicos en Medicina Transfusional BIOQ. LILIANA DI TULLIO BUDASSI FAC. CS.BIOQUÍMICAS Y FARMACÉUTICAS UNIVERSIDAD NACIONAL DE ROSARIO lilianadt2003@yahoo.com.ar

Más detalles

Norma de Prevención de la Transmisión Vertical del VIH. Dra Loreto Twele Montecinos Infectologa Pediatra Hospital Puerto Montt

Norma de Prevención de la Transmisión Vertical del VIH. Dra Loreto Twele Montecinos Infectologa Pediatra Hospital Puerto Montt Norma de Prevención de la Transmisión Vertical del VIH Dra Loreto Twele Montecinos Infectologa Pediatra Hospital Puerto Montt Introducción En VIH, el primer protocolo de prevención de la transmisión vertical

Más detalles

Estudio prospectivo de niños con diagnóstico reciente de HIV-1: evaluación de parámetros virológicos, clínicos e inmunológicos.

Estudio prospectivo de niños con diagnóstico reciente de HIV-1: evaluación de parámetros virológicos, clínicos e inmunológicos. TÍTULO Estudio prospectivo de niños con diagnóstico reciente de HIV-1: evaluación de parámetros virológicos, clínicos e inmunológicos. Título corto: Estudio prospectivo de niños con HIV-1 1 RESUMEN El

Más detalles

Inicio de la terapia antirretroviral: Cúal es el límite de CD4+ recomendado?

Inicio de la terapia antirretroviral: Cúal es el límite de CD4+ recomendado? Inicio de la terapia antirretroviral: Cúal es el límite de CD4+ recomendado? Adaptado de Clinical Care Options www.clinicaloptions.com por la Fundación Apoyarte DHHS 2009: Cuando empezar Recuento de CD4+

Más detalles

Experiencia en la Implementación de asistencia técnica horizontal a países en para el testeo de VIH

Experiencia en la Implementación de asistencia técnica horizontal a países en para el testeo de VIH Experiencia en la Implementación de asistencia técnica horizontal a países en para el testeo de VIH Dr. Freddy Tinajeros Guzmán Consultor Internacional en ITS/VIH/SIDA Curitiba, 30 de octubre de 2013 El

Más detalles

Determinación Genotípica del Tropismo del VIH en la práctica clínica

Determinación Genotípica del Tropismo del VIH en la práctica clínica Documento de Consenso para la Determinación Genotípica del Tropismo del VIH en la práctica clínica Documento de Consenso para la Determinación Genotípica del Tropismo del VIH en la práctica clínica Eva

Más detalles

TÉCNICAS Y AVANCES DIAGNÓSTICOS EN LAS INFECCIONES RESPIRATORIAS DE ORIGEN VIRAL. Carla López Causapé Servicio de Microbiología HUSE

TÉCNICAS Y AVANCES DIAGNÓSTICOS EN LAS INFECCIONES RESPIRATORIAS DE ORIGEN VIRAL. Carla López Causapé Servicio de Microbiología HUSE TÉCNICAS Y AVANCES DIAGNÓSTICOS EN LAS INFECCIONES RESPIRATORIAS DE ORIGEN VIRAL Carla López Causapé Servicio de Microbiología HUSE IMPORTANCIA DE LAS INFECCIONES RESPIRATORIAS DE ORIGEN VIRAL Las Infecciones

Más detalles